The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP025225	Enterobacter cancerogenus strain CR-Eb1 chromosome, complete genome	4796512	1690543	1698300	4796512		Ostreococcus_lucimarinus_virus(16.67%)	7	NA	NA
AUJ80980.1|1690543_1691950_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	4.0e-37
AUJ80981.1|1692041_1693127_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	50.9	4.1e-98
AUJ80982.1|1693126_1694008_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	63.8	2.1e-105
AUJ80983.1|1694254_1695421_+	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	53.0	1.0e-110
AUJ80984.1|1695474_1696479_-	protein CapI	NA	A0A2K9L4U8	Tupanvirus	33.0	2.4e-36
AUJ80985.1|1696669_1697650_+	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
AUJ80986.1|1697688_1698300_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase	NA	A0A2H4UVM0	Bodo_saltans_virus	29.3	4.1e-15
>prophage 2
CP025225	Enterobacter cancerogenus strain CR-Eb1 chromosome, complete genome	4796512	1804365	1848424	4796512	terminase,tail,capsid,head,portal,holin,integrase	Enterobacterial_phage(32.0%)	58	1804183:1804242	1846448:1846511
1804183:1804242	attL	GATTTAAAATCCCTCGGCGTTCGCGCTGTGTGGGTTCAAGTCCCACTCCGGCTACCATGG	NA	NA	NA	NA
AUJ81077.1|1804365_1805376_-|integrase	integrase	integrase	K7PLZ2	Enterobacterial_phage	89.9	1.6e-176
AUJ81078.1|1805375_1805603_-	DUF4224 domain-containing protein	NA	K7PHA0	Enterobacterial_phage	100.0	3.4e-39
AUJ81079.1|1805643_1806477_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ81080.1|1806603_1806831_-	hypothetical protein	NA	K7PHA5	Enterobacterial_phage	68.2	9.9e-15
AUJ81081.1|1806817_1807840_-	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	91.0	4.2e-169
AUJ81082.1|1807839_1808253_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	80.3	6.4e-52
AUJ81083.1|1808697_1808895_-	hypothetical protein	NA	K7PGV8	Enterobacterial_phage	92.6	3.3e-06
AUJ81084.1|1809034_1809754_-	LexA family transcriptional repressor	NA	A0A2R2X2B0	Escherichia_phage	63.3	6.9e-78
AUJ81085.1|1809852_1810071_+	hypothetical protein	NA	A0A2K8HL98	Pseudomonas_phage	60.3	4.9e-11
AUJ81086.1|1810112_1810583_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	98.1	1.2e-78
AUJ81087.1|1810823_1811003_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	67.3	2.7e-15
AUJ81088.1|1810992_1811883_+	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	56.9	1.2e-34
AUJ81089.1|1811879_1812374_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ81090.1|1812373_1813126_+	hypothetical protein	NA	M1FN76	Enterobacteria_phage	82.8	1.6e-125
AUJ81091.1|1813130_1813796_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	79.2	5.6e-98
AUJ81092.1|1813792_1814020_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ81093.1|1814016_1814406_+	hypothetical protein	NA	K7PKN5	Enterobacterial_phage	88.9	4.9e-62
AUJ81094.1|1814421_1815147_+	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	51.8	2.0e-53
AUJ81095.1|1815143_1816133_+	hypothetical protein	NA	K7PJS6	Enterobacterial_phage	92.7	8.9e-185
AUJ81096.1|1816146_1816749_+	hypothetical protein	NA	A0A0U2S606	Escherichia_phage	52.2	5.0e-45
AUJ81097.1|1816872_1817658_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ81098.1|1817749_1818145_+	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	99.2	9.1e-64
AUJ81099.1|1818131_1818413_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	93.5	4.1e-42
AUJ81100.1|1818412_1819039_+	endolysin	NA	K7PJS7	Enterobacterial_phage	82.2	1.3e-96
AUJ81101.1|1819046_1819316_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	88.8	2.5e-33
AUJ81102.1|1819272_1819488_+	hypothetical protein	NA	K7PM01	Enterobacterial_phage	95.3	2.4e-18
AUJ81103.1|1819556_1820060_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ81104.1|1821533_1821833_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ81105.1|1822202_1823660_+	glycosyltransferase	NA	K7PKP3	Enterobacterial_phage	89.5	9.5e-268
AUJ81106.1|1823807_1824329_-	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	50.6	8.1e-36
AUJ81107.1|1824436_1825030_+	hypothetical protein	NA	S4TR53	Salmonella_phage	79.2	4.5e-91
AUJ81108.1|1825022_1825391_+	HNH endonuclease	NA	S4TTG9	Salmonella_phage	92.6	3.3e-60
AUJ81109.1|1825496_1825991_+|terminase	terminase	terminase	S4TNN3	Salmonella_phage	99.4	6.4e-83
AUJ81110.1|1825987_1827649_+|terminase	terminase	terminase	S4TSQ6	Salmonella_phage	98.6	0.0e+00
AUJ81111.1|1827707_1829642_+|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	93.3	0.0e+00
AUJ81112.1|1829845_1831204_+|portal	phage portal protein	portal	S4TTG7	Salmonella_phage	98.0	1.0e-255
AUJ81113.1|1831200_1832115_+|portal	phage portal protein	portal	S4TNN1	Salmonella_phage	76.9	1.3e-108
AUJ81114.1|1832111_1832438_+	DNA-packaging protein	NA	S4TSQ3	Salmonella_phage	63.0	5.4e-30
AUJ81115.1|1832509_1832722_+	hypothetical protein	NA	K7PGR0	Enterobacteria_phage	62.9	5.6e-12
AUJ81116.1|1832723_1833056_+|head,tail	head-tail adaptor protein	head,tail	K7PH08	Enterobacteria_phage	85.5	3.1e-49
AUJ81117.1|1833048_1833588_+	hypothetical protein	NA	Q9MCV1	Escherichia_phage	84.4	9.5e-80
AUJ81118.1|1833584_1833950_+	hypothetical protein	NA	A0A286S1R1	Klebsiella_phage	67.8	6.7e-45
AUJ81119.1|1834005_1834497_+|tail	phage tail protein	tail	A0A286S1Q8	Klebsiella_phage	71.6	4.7e-62
AUJ81120.1|1834550_1834931_+|tail	phage tail protein	tail	K7PJU9	Enterobacteria_phage	81.5	3.0e-48
AUJ81121.1|1834915_1835218_+|tail	phage tail protein	tail	Q9MCU7	Escherichia_phage	61.2	1.4e-27
AUJ81122.1|1835391_1836006_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ81123.1|1836075_1838577_+|tail	phage tail tape measure protein	tail	Q9MCU6	Escherichia_phage	55.8	2.8e-219
AUJ81124.1|1838593_1839187_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	82.2	1.7e-93
AUJ81125.1|1839186_1839771_+	hypothetical protein	NA	S4TND4	Salmonella_phage	84.5	1.6e-93
AUJ81126.1|1839777_1840176_+	hypothetical protein	NA	S4TR39	Salmonella_phage	80.3	3.8e-62
AUJ81127.1|1840175_1842974_+|tail	phage tail protein	tail	S4TTF5	Salmonella_phage	73.1	0.0e+00
AUJ81128.1|1842977_1843946_+	hypothetical protein	NA	G1CSU0	Cronobacter_virus	40.8	1.0e-55
AUJ81129.1|1844011_1845280_+|tail	phage tail protein	tail	A0A220NRP2	Escherichia_phage	46.0	1.6e-85
AUJ81130.1|1845375_1845642_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	93.2	4.0e-39
AUJ81131.1|1845739_1845979_+	hypothetical protein	NA	K7P7E2	Enterobacteria_phage	71.8	9.1e-27
AUJ81132.1|1845978_1846299_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	53.8	6.7e-25
AUJ81133.1|1846786_1847647_+	hypothetical protein	NA	NA	NA	NA	NA
1846448:1846511	attR	GATTTAAAATCCCTCGGCGTTCGCGCTGTGTGGGTTCAAGTCCCACTCCGGCTACCATGGGAAA	NA	NA	NA	NA
AUJ81134.1|1847707_1848424_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.3	1.3e-12
>prophage 3
CP025225	Enterobacter cancerogenus strain CR-Eb1 chromosome, complete genome	4796512	2068985	2127749	4796512	tail,head,coat,holin,integrase	Cronobacter_phage(35.85%)	81	2124597:2124614	2128100:2128117
AUJ81322.1|2068985_2070167_+|integrase	integrase	integrase	K7PGY1	Enterobacteria_phage	51.1	1.3e-118
AUJ81323.1|2070147_2070363_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ81324.1|2070471_2070828_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ81325.1|2070837_2071077_-	hypothetical protein	NA	Q6H9Z8	Enterobacteria_phage	48.7	1.8e-11
AUJ81326.1|2071039_2071552_-	SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.1	6.4e-70
AUJ81327.1|2071551_2071770_-	hypothetical protein	NA	M1FQT7	Enterobacteria_phage	65.3	3.5e-17
AUJ81328.1|2071873_2072626_-	hypothetical protein	NA	M1FN76	Enterobacteria_phage	86.0	8.2e-130
AUJ81329.1|2072622_2074596_-	phage N-6-adenine-methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	52.5	9.0e-136
AUJ81330.1|2074592_2074745_-	DUF1317 domain-containing protein	NA	T1SAR0	Salmonella_phage	44.2	1.3e-05
AUJ81331.1|2074744_2074966_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ81332.1|2074991_2075435_-	single-stranded DNA-binding protein	NA	A0A2H4JHK3	uncultured_Caudovirales_phage	65.3	3.6e-45
AUJ81333.1|2075435_2076062_-	single-stranded DNA-binding protein	NA	A0A1W6JP21	Morganella_phage	61.3	1.1e-63
AUJ81334.1|2076213_2076411_-	thioredoxin reductase	NA	NA	NA	NA	NA
AUJ81335.1|2076419_2077388_-	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	75.4	5.0e-39
AUJ81336.1|2077458_2077668_-	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	92.8	1.3e-32
AUJ83802.1|2077819_2077999_-	hypothetical protein	NA	A0A088CQ77	Enterobacteria_phage	54.2	7.3e-05
AUJ81337.1|2078214_2078469_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ81338.1|2078757_2079201_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ81339.1|2079214_2079907_-	hypothetical protein	NA	G8C7U1	Escherichia_phage	52.9	6.9e-59
AUJ81340.1|2080034_2080286_+	transcriptional regulator	NA	G8C7U2	Escherichia_phage	54.7	2.6e-16
AUJ81341.1|2080316_2080862_+	hypothetical protein	NA	K7P7P2	Enterobacteria_phage	93.4	7.8e-90
AUJ81342.1|2080947_2081856_+	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	95.7	1.2e-151
AUJ81343.1|2081852_2082542_+	phage replication protein	NA	G8C7U6	Escherichia_phage	93.4	1.8e-123
AUJ81344.1|2082543_2083119_+	protein ren	NA	K7PHG5	Enterobacteria_phage	38.0	2.2e-10
AUJ81345.1|2083115_2083730_+	hypothetical protein	NA	E7C9P6	Salmonella_phage	54.3	8.6e-53
AUJ81346.1|2083726_2084008_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ81347.1|2084369_2084576_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ81348.1|2084579_2085164_+	hypothetical protein	NA	K7PGV7	Enterobacterial_phage	93.9	1.1e-17
AUJ81349.1|2085612_2086068_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	65.6	2.0e-59
AUJ81350.1|2086067_2086238_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	90.6	3.8e-19
AUJ81351.1|2086230_2086521_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	89.6	2.4e-45
AUJ81352.1|2086517_2086880_+	hypothetical protein	NA	K7PM48	Enterobacteria_phage	83.2	1.9e-52
AUJ81353.1|2086876_2087260_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	43.8	6.0e-20
AUJ81354.1|2087256_2087373_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ81355.1|2087369_2088059_+	antiterminator	NA	I6PDF8	Cronobacter_phage	50.6	1.4e-56
AUJ81356.1|2088506_2088878_+|holin	holin	holin	A0A2D1GNJ3	Pseudomonas_phage	32.4	1.3e-06
AUJ81357.1|2088861_2089506_+	hypothetical protein	NA	F1C5D2	Cronobacter_phage	42.4	2.0e-36
AUJ81358.1|2089493_2089970_+	Rz lytic protein	NA	NA	NA	NA	NA
AUJ81359.1|2090400_2090925_+	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	99.4	6.1e-92
AUJ81360.1|2091289_2091475_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ81361.1|2091523_2091895_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ81362.1|2091997_2092621_+	hypothetical protein	NA	I6S676	Salmonella_phage	90.8	1.2e-110
AUJ81363.1|2092653_2093133_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	87.2	3.3e-60
AUJ81364.1|2093119_2094592_+	DNA-packaging protein	NA	G0ZND4	Cronobacter_phage	85.7	2.3e-253
AUJ81365.1|2094603_2096055_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	50.1	1.1e-117
AUJ81366.1|2095972_2096983_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	68.0	9.3e-113
AUJ81367.1|2097025_2097541_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ81368.1|2097606_2098995_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	64.7	4.2e-156
AUJ81369.1|2098998_2099439_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	63.7	9.8e-43
AUJ81370.1|2099450_2100527_+|coat	phage coat protein	coat	F1C5E1	Cronobacter_phage	77.1	7.8e-158
AUJ81371.1|2100536_2100938_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ81372.1|2100940_2101321_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	54.9	2.7e-28
AUJ81373.1|2101320_2101494_+	50S ribosomal protein L13	NA	Q5G8X7	Enterobacteria_phage	50.9	1.6e-12
AUJ81374.1|2101493_2101850_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	55.6	6.1e-27
AUJ81375.1|2101852_2102221_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	74.6	8.8e-45
AUJ81376.1|2102217_2102601_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	56.7	4.1e-37
AUJ81377.1|2102660_2103416_+	DNA breaking-rejoining protein	NA	G0ZNE6	Cronobacter_phage	48.6	8.1e-53
AUJ81378.1|2103466_2104210_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	51.3	1.6e-61
AUJ81379.1|2104282_2104657_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	54.4	3.5e-25
AUJ81380.1|2104713_2107035_+|tail	phage tail tape measure protein	tail	A0A1B1W284	Salmonella_phage	50.4	1.1e-145
AUJ81381.1|2107034_2107532_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	89.7	8.7e-88
AUJ81382.1|2107531_2108002_+	hypothetical protein	NA	F1C5F1	Cronobacter_phage	87.8	6.1e-75
AUJ81383.1|2108015_2108381_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	90.1	1.9e-63
AUJ81384.1|2108367_2110845_+|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	92.7	0.0e+00
AUJ81385.1|2113186_2115034_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ81386.1|2115037_2115376_-	4-amino-4-deoxy-L-arabinose-phospho-UDP flippase	NA	NA	NA	NA	NA
AUJ81387.1|2115375_2116326_-	glycosyl transferase family 2	NA	NA	NA	NA	NA
AUJ81388.1|2116548_2116788_+	hypothetical protein	NA	K7P7E2	Enterobacteria_phage	70.5	9.1e-27
AUJ81389.1|2116787_2117108_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.4	4.1e-22
AUJ81390.1|2117331_2117868_-	septation protein A	NA	NA	NA	NA	NA
AUJ81391.1|2117925_2118669_-	UPF0259 family protein	NA	NA	NA	NA	NA
AUJ81392.1|2119036_2119669_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
AUJ81393.1|2119706_2120045_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ81394.1|2120463_2120697_-	SirA-like protein	NA	NA	NA	NA	NA
AUJ81395.1|2120693_2121905_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
AUJ81396.1|2122125_2122650_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ81397.1|2122728_2123904_-	MFS transporter	NA	NA	NA	NA	NA
AUJ81398.1|2124028_2124994_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
2124597:2124614	attL	TCCTGCTCAAACTCCCAG	NA	NA	NA	NA
AUJ81399.1|2125089_2125866_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ81400.1|2126209_2126986_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUJ81401.1|2127146_2127749_+|integrase	integrase	integrase	A0A1V0E036	Clostridioides_phage	30.0	4.5e-06
2128100:2128117	attR	TCCTGCTCAAACTCCCAG	NA	NA	NA	NA
>prophage 4
CP025225	Enterobacter cancerogenus strain CR-Eb1 chromosome, complete genome	4796512	2596996	2605553	4796512		Escherichia_phage(66.67%)	10	NA	NA
AUJ81795.1|2596996_2598211_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	30.0	4.3e-48
AUJ81796.1|2598321_2598648_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	52.9	7.1e-22
AUJ81797.1|2598801_2599140_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ81798.1|2599139_2599700_+	spermidine acetyltransferase	NA	NA	NA	NA	NA
AUJ83818.1|2599717_2600428_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
AUJ81799.1|2600533_2600839_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AUJ81800.1|2600975_2603414_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.9	8.0e-219
AUJ81801.1|2603424_2604042_+	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	59.6	6.1e-75
AUJ81802.1|2604043_2604898_+	dimethylsulfoxide reductase	NA	A0A077SK59	Escherichia_phage	34.1	1.9e-21
AUJ81803.1|2604938_2605553_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.8	1.6e-30
>prophage 5
CP025225	Enterobacter cancerogenus strain CR-Eb1 chromosome, complete genome	4796512	3099564	3110760	4796512	protease	Vibrio_phage(33.33%)	6	NA	NA
AUJ82247.1|3099564_3102807_-	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	27.9	1.5e-84
AUJ83838.1|3102803_3103787_-	subtype I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YZM7	Vibrio_phage	34.3	5.8e-43
AUJ82248.1|3105632_3107912_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.9	1.5e-163
AUJ82249.1|3107939_3108260_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.9	4.5e-13
AUJ82250.1|3108527_3108749_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
AUJ82251.1|3108819_3110760_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.0	1.7e-38
