The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP021885	Enterococcus faecium strain WEFA23 chromosome, complete genome	2496099	79267	88330	2496099		Synechococcus_phage(16.67%)	9	NA	NA
AUJ66102.1|79267_79846_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.8	1.0e-26
AUJ68289.1|79842_80886_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.7	2.7e-62
AUJ66103.1|80917_82357_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	5.3e-53
AUJ66104.1|82341_84564_-	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.4	1.1e-150
AUJ66105.1|84564_85236_-	phosphoribosylformylglycinamidine synthase I	NA	NA	NA	NA	NA
AUJ66106.1|85237_85492_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AUJ66107.1|85491_86220_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	41.4	4.6e-45
AUJ66108.1|86475_86853_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ66109.1|87034_88330_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.1	1.0e-18
>prophage 2
CP021885	Enterococcus faecium strain WEFA23 chromosome, complete genome	2496099	446985	455581	2496099		Streptococcus_phage(66.67%)	9	NA	NA
AUJ66445.1|446985_449175_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	66.6	1.4e-286
AUJ66446.1|449613_450216_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	58.0	2.2e-53
AUJ66447.1|450269_451391_-	DNA polymerase IV	NA	NA	NA	NA	NA
AUJ66448.1|451499_452372_-	rRNA (cytidine-2'-O-)-methyltransferase	NA	M1PLC5	Streptococcus_phage	60.4	4.0e-88
AUJ66449.1|452440_452788_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	41.1	5.1e-18
AUJ66450.1|452780_453605_-	signal peptidase	NA	NA	NA	NA	NA
AUJ66451.1|453640_454579_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	34.1	5.5e-35
AUJ66452.1|454592_454922_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ66453.1|454936_455581_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.6	4.2e-58
>prophage 3
CP021885	Enterococcus faecium strain WEFA23 chromosome, complete genome	2496099	482141	584050	2496099	protease,tRNA,bacteriocin,transposase	Bacillus_phage(15.0%)	95	NA	NA
AUJ66479.1|482141_483059_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AUJ66480.1|483062_483800_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	40.0	2.3e-12
AUJ66481.1|483890_484418_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ66482.1|484597_485191_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	55.6	8.9e-55
AUJ66483.1|485294_485780_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AUJ66484.1|485931_486129_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ66485.1|486223_487984_-	ABC transporter	NA	W8CYL7	Bacillus_phage	28.8	2.9e-53
AUJ66486.1|487980_489711_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.2	7.1e-44
AUJ66487.1|490103_490316_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ66488.1|490317_491997_+	ribonuclease J	NA	NA	NA	NA	NA
AUJ66489.1|492007_492292_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ66490.1|492250_492451_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.2	3.7e-21
AUJ66491.1|492600_493293_-	DNA repair protein RadC	NA	NA	NA	NA	NA
AUJ66492.1|493347_494001_-	HAD family phosphatase	NA	NA	NA	NA	NA
AUJ66493.1|493990_495304_-	tetrahydrofolate synthase	NA	NA	NA	NA	NA
AUJ66494.1|495613_498259_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	43.1	1.4e-163
AUJ66495.1|498651_499299_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
AUJ66496.1|499871_501083_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
AUJ66497.1|501098_502241_-	cysteine desulfurase	NA	NA	NA	NA	NA
AUJ66498.1|502406_504128_-	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
AUJ66499.1|504326_504887_-	HAD family hydrolase	NA	A0A0H3UZF4	Geobacillus_virus	45.1	2.3e-28
AUJ66500.1|504912_505752_-	haloacid dehalogenase	NA	NA	NA	NA	NA
AUJ66501.1|505785_506619_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
AUJ66502.1|506850_507819_+	L-asparaginase	NA	NA	NA	NA	NA
AUJ66503.1|507973_508711_-	acyl-[acyl-carrier-protein] thioesterase	NA	NA	NA	NA	NA
AUJ66504.1|508726_509560_-	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
AUJ66505.1|509761_511090_-	aminopeptidase	NA	R4TV59	Phaeocystis_globosa_virus	38.1	7.3e-73
AUJ66506.1|512179_512809_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUJ66507.1|512931_513306_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
AUJ66508.1|513608_514787_-|transposase	IS256 family transposase ISEf1	transposase	NA	NA	NA	NA
AUJ66509.1|514948_515215_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AUJ68298.1|515224_515389_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
AUJ66510.1|515911_516214_+	hypothetical protein	NA	F0PIG8	Enterococcus_phage	53.3	1.2e-07
AUJ66511.1|516377_517337_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
AUJ66512.1|517470_517689_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ66513.1|517773_518952_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AUJ66514.1|519113_520544_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ66515.1|520540_521137_-	resolvase	NA	A0A0A8WIK3	Clostridium_phage	30.3	5.7e-09
AUJ66516.1|521038_521257_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ66517.1|521153_522280_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	53.7	4.3e-74
AUJ66518.1|522365_522596_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ66519.1|522637_522832_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ68299.1|522808_523033_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ66520.1|523337_524300_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.8	1.4e-20
AUJ66521.1|524301_525741_-	sucrose-6-phosphate hydrolase	NA	NA	NA	NA	NA
AUJ66522.1|525925_527872_+	PTS beta-glucoside transporter subunit EIIBCA	NA	NA	NA	NA	NA
AUJ66523.1|528135_529008_+	fructokinase	NA	NA	NA	NA	NA
AUJ66524.1|529242_529425_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ66525.1|529472_530635_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
AUJ66526.1|532516_533035_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ66527.1|533069_533558_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AUJ66528.1|534433_537583_-	deoxyribonuclease	NA	NA	NA	NA	NA
AUJ66529.1|537716_537953_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ66530.1|537934_538981_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUJ66531.1|539314_539629_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
AUJ66532.1|539684_541049_-	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
AUJ66533.1|541067_541370_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
AUJ66534.1|541417_542857_-	aryl-phospho-beta-D-glucosidase	NA	A0A0B5JD41	Pandoravirus	31.5	1.7e-51
AUJ66535.1|542930_543824_-	ROK family protein	NA	NA	NA	NA	NA
AUJ66536.1|544458_545412_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
AUJ66537.1|545692_546883_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AUJ66538.1|546967_547597_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ66539.1|547608_547920_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ66540.1|548468_549293_-	hydrolase	NA	NA	NA	NA	NA
AUJ66541.1|549510_551673_-	PTS glucose/maltose transporter subunit IIBCA	NA	A0A2I7SAJ6	Vibrio_phage	41.1	4.3e-06
AUJ66542.1|551953_554248_+	family 65 glycosyl hydrolase	NA	NA	NA	NA	NA
AUJ66543.1|554240_554906_+	beta-phosphoglucomutase	NA	M1H9H9	Acanthocystis_turfacea_Chlorella_virus	27.8	1.8e-11
AUJ66544.1|554898_555933_+	galactose mutarotase	NA	NA	NA	NA	NA
AUJ66545.1|556059_556740_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	2.5e-109
AUJ66546.1|558278_558473_-	peptide ABC transporter permease	NA	NA	NA	NA	NA
AUJ66547.1|558498_558660_-	peptide ABC transporter permease	NA	NA	NA	NA	NA
AUJ66548.1|562316_562514_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ66549.1|564848_565211_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ66550.1|565284_565665_-	RNA-binding protein	NA	NA	NA	NA	NA
AUJ66551.1|565746_566922_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AUJ66552.1|566998_567583_-	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	43.4	2.0e-27
AUJ66553.1|567783_568782_+	ferredoxin--NADP(+) reductase	NA	Q9JRK7	Streptococcus_phage	54.1	2.6e-30
AUJ66554.1|568893_569403_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	56.1	1.5e-39
AUJ66555.1|569432_570092_-	TIGR01906 family membrane protein	NA	NA	NA	NA	NA
AUJ66556.1|570093_570858_-	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
AUJ66557.1|570865_571543_-	transcriptional regulator	NA	NA	NA	NA	NA
AUJ66558.1|571579_572965_-	multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase	NA	NA	NA	NA	NA
AUJ68300.1|572933_573119_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ66559.1|573281_573797_-|tRNA	tRNA-specific adenosine deaminase	tRNA	NA	NA	NA	NA
AUJ66560.1|573903_574761_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
AUJ66561.1|574841_575177_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ66562.1|575243_576614_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AUJ66563.1|576691_577228_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ66564.1|577536_579018_+	M protein trans-acting positive regulator	NA	NA	NA	NA	NA
AUJ66565.1|579120_579828_-	peptidase	NA	NA	NA	NA	NA
AUJ66566.1|579906_580245_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
AUJ66567.1|580355_581318_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
AUJ66568.1|581332_582664_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ66569.1|582671_583352_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AUJ66570.1|583570_584050_-|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
>prophage 4
CP021885	Enterococcus faecium strain WEFA23 chromosome, complete genome	2496099	1301430	1356178	2496099	protease,tRNA,holin,transposase	uncultured_Mediterranean_phage(33.33%)	52	NA	NA
AUJ67201.1|1301430_1302072_-|holin	choline ABC transporter permease	holin	NA	NA	NA	NA
AUJ67202.1|1302075_1303251_-	glycine/betaine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	32.9	1.0e-17
AUJ67203.1|1303443_1304475_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
AUJ67204.1|1305093_1307733_+	magnesium-transporting ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	31.7	1.6e-84
AUJ67205.1|1307900_1308599_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ67206.1|1308816_1309962_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	40.9	2.5e-82
AUJ67207.1|1310058_1310439_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
AUJ67208.1|1310535_1310715_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ67209.1|1310743_1313341_+	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
AUJ67210.1|1313569_1314676_+	glycosyl hydrolase	NA	NA	NA	NA	NA
AUJ67211.1|1314692_1315721_+	TRAP transporter substrate-binding protein DctP	NA	NA	NA	NA	NA
AUJ68319.1|1315726_1316206_+	TRAP transporter permease DctQ	NA	NA	NA	NA	NA
AUJ67212.1|1316221_1317511_+	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
AUJ67213.1|1317530_1318334_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
AUJ67214.1|1318582_1319647_-	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
AUJ67215.1|1319643_1320729_-	phosphomevalonate kinase	NA	NA	NA	NA	NA
AUJ67216.1|1320741_1321719_-	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
AUJ67217.1|1321711_1322656_-	mevalonate kinase	NA	NA	NA	NA	NA
AUJ68320.1|1322977_1323631_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	52.3	1.1e-58
AUJ67218.1|1323715_1324621_+	magnesium transporter CorA	NA	NA	NA	NA	NA
AUJ67219.1|1324622_1325255_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ67220.1|1325574_1326099_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.3	1.4e-14
AUJ67221.1|1326170_1326371_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AUJ67222.1|1326423_1326783_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AUJ67223.1|1327034_1328372_+	citrate transporter	NA	NA	NA	NA	NA
AUJ67224.1|1328419_1330549_+	hydantoinase	NA	NA	NA	NA	NA
AUJ67225.1|1330523_1331213_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ67226.1|1331619_1332306_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ67227.1|1332685_1333126_-	4-hydroxybenzoyl-CoA thioesterase	NA	NA	NA	NA	NA
AUJ67228.1|1333129_1333975_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
AUJ67229.1|1334123_1335542_+	dipeptidase PepV	NA	NA	NA	NA	NA
AUJ67230.1|1335598_1336546_-	glycosyl transferase	NA	NA	NA	NA	NA
AUJ67231.1|1336768_1337119_-	peptidase	NA	NA	NA	NA	NA
AUJ67232.1|1337318_1338398_+	glutamyl aminopeptidase	NA	NA	NA	NA	NA
AUJ67233.1|1338540_1338861_+	thiol reductase thioredoxin	NA	NA	NA	NA	NA
AUJ67234.1|1338882_1339347_+	universal stress protein	NA	NA	NA	NA	NA
AUJ67235.1|1339551_1340157_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
AUJ67236.1|1340195_1341482_-|protease	serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.2	5.7e-22
AUJ67237.1|1341909_1342389_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
AUJ67238.1|1342591_1343794_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ67239.1|1343775_1344735_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
AUJ67240.1|1344983_1345490_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ67241.1|1345812_1346202_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ67242.1|1346360_1347104_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ67243.1|1347140_1347638_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUJ67244.1|1347693_1348602_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AUJ67245.1|1348827_1350006_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AUJ67246.1|1350137_1350389_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ67247.1|1350462_1351974_+	glutamate:gamma-aminobutyrate antiporter	NA	NA	NA	NA	NA
AUJ67248.1|1351986_1353387_+	glutamate decarboxylase	NA	NA	NA	NA	NA
AUJ67249.1|1353551_1354988_-	DNA-binding protein	NA	NA	NA	NA	NA
AUJ67250.1|1355218_1356178_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 5
CP021885	Enterococcus faecium strain WEFA23 chromosome, complete genome	2496099	1611504	1729585	2496099	protease,portal,tail,terminase,integrase,head,lysis,tRNA,capsid,transposase	Paenibacillus_phage(18.18%)	114	1603238:1603297	1673441:1674807
1603238:1603297	attL	TGGAATGGCAACAGTTTTTTTGACAAATTTTATAAGGTGCAGAACTTCTTTCCGTATGCT	NA	NA	NA	NA
AUJ67472.1|1611504_1612167_-|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis protein	lysis	NA	NA	NA	NA
AUJ68331.1|1612394_1612958_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AUJ67473.1|1612970_1613255_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ67474.1|1613273_1613966_+	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
AUJ67475.1|1613977_1614523_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	37.4	2.6e-24
AUJ67476.1|1614795_1618062_+	peptidase	NA	NA	NA	NA	NA
AUJ68332.1|1618293_1618482_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ67477.1|1618844_1620752_-	peptidase M13	NA	E3T4I7	Cafeteria_roenbergensis_virus	31.1	6.1e-81
AUJ67478.1|1620881_1621757_+	dihydrolipoamide dehydrogenase	NA	NA	NA	NA	NA
AUJ67479.1|1621836_1622811_+	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	32.2	2.0e-40
AUJ68333.1|1622999_1624136_+	cysteine desulfurase	NA	NA	NA	NA	NA
AUJ67480.1|1624272_1624617_+	cysteine desulfurase	NA	NA	NA	NA	NA
AUJ67481.1|1624887_1626174_+	MFS transporter	NA	A0A1B0RXG2	Streptococcus_phage	36.9	1.4e-68
AUJ67482.1|1626311_1626911_-	metallophosphatase	NA	A0A288TXW7	Enterococcus_phage	40.0	5.6e-33
AUJ67483.1|1627314_1628436_+|tRNA	tRNA(5-methylaminomethyl-2-thiouridine)- methyltransferase	tRNA	NA	NA	NA	NA
AUJ68334.1|1628681_1630103_+	arginine-ornithine antiporter	NA	NA	NA	NA	NA
AUJ67484.1|1630116_1631235_+	aminotransferase	NA	NA	NA	NA	NA
AUJ67485.1|1631294_1632587_-	MFS transporter	NA	NA	NA	NA	NA
AUJ68335.1|1632736_1633297_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ67486.1|1633425_1633803_+	DNA-binding protein	NA	NA	NA	NA	NA
AUJ67487.1|1633735_1635808_+	DNA topoisomerase III	NA	NA	NA	NA	NA
AUJ67488.1|1636018_1636966_-	glycosyltransferase	NA	V5USA4	Oenococcus_phage	51.0	5.0e-84
AUJ67489.1|1637211_1637676_+	cysteine methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	37.2	8.8e-18
AUJ67490.1|1637737_1638781_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ67491.1|1638848_1639085_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ67492.1|1639157_1640123_-	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
AUJ67493.1|1640356_1641202_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ67494.1|1641210_1641408_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ67495.1|1641392_1642580_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
AUJ67496.1|1642585_1642942_+	hypothetical protein	NA	M1PLC0	Streptococcus_phage	42.3	2.7e-22
AUJ67497.1|1642943_1643282_+	glycine cleavage system protein H	NA	NA	NA	NA	NA
AUJ68336.1|1643676_1644711_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	4.2e-28
AUJ67498.1|1644703_1645390_+	methionine ABC transporter permease	NA	NA	NA	NA	NA
AUJ67499.1|1645413_1646262_+	methionine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUJ67500.1|1646458_1647232_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.8	2.1e-08
AUJ67501.1|1647244_1648531_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
AUJ67502.1|1648527_1649763_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	48.0	1.0e-113
AUJ67503.1|1649749_1650220_+	iron-sulfur cluster assembly scaffold protein	NA	NA	NA	NA	NA
AUJ67504.1|1650224_1651616_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
AUJ67505.1|1651712_1652864_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	33.1	2.9e-54
AUJ67506.1|1652907_1653543_-	transcriptional regulator	NA	NA	NA	NA	NA
AUJ67507.1|1653731_1653956_+	transcriptional regulator	NA	NA	NA	NA	NA
AUJ67508.1|1653952_1654225_+	DNA-binding protein	NA	NA	NA	NA	NA
AUJ67509.1|1654300_1654546_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ67510.1|1654683_1654899_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ67511.1|1654895_1655801_+	hypothetical protein	NA	V5URM4	Enterococcus_phage	38.2	1.5e-05
AUJ67512.1|1655797_1657189_+	DNA primase	NA	A0A0M4RE09	Enterococcus_phage	34.1	4.4e-36
AUJ67513.1|1657490_1657898_+	DUF3206 domain-containing protein	NA	NA	NA	NA	NA
AUJ67514.1|1657900_1658098_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ67515.1|1658119_1658500_+	endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	40.7	4.2e-18
AUJ67516.1|1658634_1658790_+	DUF2292 domain-containing protein	NA	NA	NA	NA	NA
AUJ67517.1|1658858_1659332_+|terminase	terminase	terminase	NA	NA	NA	NA
AUJ67518.1|1659328_1661023_+|terminase	terminase	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	43.6	4.5e-128
AUJ67519.1|1660988_1661174_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ67520.1|1661177_1662353_+|portal	phage portal protein	portal	A0A1D6Z2A2	Staphylococcus_phage	35.3	2.1e-63
AUJ67521.1|1662345_1663869_+|capsid	phage major capsid protein	capsid	A0A1W6JPR8	Staphylococcus_phage	37.4	1.1e-48
AUJ67522.1|1663922_1664207_+	DNA-packaging protein	NA	NA	NA	NA	NA
AUJ67523.1|1664193_1664529_+|head,tail	head-tail adaptor protein	head,tail	V5UQC7	Enterococcus_phage	36.6	4.7e-13
AUJ67524.1|1664530_1664725_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ67525.1|1664838_1665531_+	hypothetical protein	NA	Q4ZB12	Staphylococcus_virus	26.8	1.3e-12
AUJ67526.1|1665549_1666203_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ67527.1|1666462_1667602_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	35.7	6.7e-59
AUJ67528.1|1668135_1669298_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	2.7e-79
AUJ67529.1|1669944_1670259_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ67530.1|1670311_1671070_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ67531.1|1671190_1671436_+	transcriptional regulator	NA	NA	NA	NA	NA
AUJ67532.1|1671511_1671790_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ67533.1|1672209_1673371_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
AUJ67534.1|1673802_1674228_+	DNA methyltransferase	NA	NA	NA	NA	NA
AUJ67535.1|1674837_1676334_-	M protein trans-acting positive regulator	NA	NA	NA	NA	NA
1673441:1674807	attR	AGCATACGGAAAGAAGTTCTGCACCTTATAAAATTTGTCAAAAAAACTGTTGCCATTCCAAACCCAATTTTTTTAAGACTAGGGTATTCAGGTGATAATGACCCAATACTCTCCAACGATGATTAAAAAAGTTTTTATCCAAAGAGATATTAAAAACTATAAATAAACTATTTAACCAATACTTTTGGTAAAATTCAAGTGATGACAGATTAAAGCTGGATATATATGCAGATATGTATGTAAGGACAAAAAGTTGATGAAGATTTAATACTGCAAAAAATAAATATTTCAGGAGGTGTATTTTTTGCCAACAACCAACTCCCTTTTGAGGTATCTGGCAGGAAAAAGTCAATTGTATAAATTTGAAAAAAACAATAGACAAGAGTATTGGAGAATATGAAATTTATATCGAGATATCGAGCATTTTGCAGAGGGAGCCGGGGTGGCCCATTCAGCTATTAATTCAAAAGAATGTGAAAATGACTGCAATTAATAATTTAGATAAATCTATGCGTTCTTTATGGTATTCAATATTAAATTATCCCAACAAATTTATCAATCTGATTAACAAAACCATTGTAAACATTGAAGAATGGCCAAGACAGAAAGAAATTTGTAAAAAAGAGTTTAATCATCCTTTTTCTCTAGAGGAAGGGTTTGCGACCTTCTTCCTAAATATAACGAACGTAAGTGGTATTACTAGCGGTGGACAGATAGAGGGGACAAAACAAGAAAGTAAGTACAAGGTAGGTTGTTGCTTTAATAAGCAATCTTTAATAAAAAAATAAGGGATATTTCTTTACTAAAAGATTCAATTAACTAATATGGATGTTGAATCTTATACAGATGGTATTTCATTTAATTATCCAAAAGAGAAAATGTTCATTTTTTTGAGCCTCCATATTTTAATCAATGTAAAAAAATCTTTATTTGAATTTATTGATAAAGATAAGCATAGCATTAGGGATTATTACTTATGACAATCCAGATGAAATTTATTGAGATTTACAAAGAATTTCGCTAAAAATATAAGTATATGCTTAGATATTCTGTTAATAATAAGCGTAAAGAAAAAGCTTGGGAATATCGTTTTACTAGTTAAATTACAAAAATTGATAATTTTGCTAATGTAGAACCTTTGAAACTAATTGATAAGTAGCTTTTTACCAAAAGCACACCACGTAACTTGAATACGATTGAAAACTAATCATTAAAATTTATTATTAGCAAAGTGATTAATCCTATTCAAAAAGTACCTAGCTTCAATTATCGTCAATGAACTTAATTTCATAGCTGAAGAAAAATCTGAATAAAGAAACGATGGCTGAACCCTTGATAGATAAGGGTTCAGCTCTTTTTAGGAACTT	NA	NA	NA	NA
AUJ67536.1|1676688_1680141_+	VWA domain-containing protein	NA	NA	NA	NA	NA
AUJ67537.1|1680143_1681565_+	cell surface protein	NA	NA	NA	NA	NA
AUJ67538.1|1681561_1683439_+	cell surface protein	NA	NA	NA	NA	NA
AUJ67539.1|1683530_1684361_+	class C sortase	NA	NA	NA	NA	NA
AUJ67540.1|1685025_1686188_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	50.9	1.0e-78
AUJ67541.1|1687581_1688988_+	6-phospho-beta-galactosidase	NA	NA	NA	NA	NA
AUJ67542.1|1689125_1689284_+	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
AUJ67543.1|1689304_1690204_+	protein lacX	NA	NA	NA	NA	NA
AUJ67544.1|1690535_1690826_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ67545.1|1691372_1691609_+	XRE family transcriptional regulator	NA	A0A097PBE6	Streptococcus_pyogenes_phage	53.4	1.5e-13
AUJ67546.1|1691845_1693960_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	38.9	1.2e-117
AUJ67547.1|1694140_1694473_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
AUJ67548.1|1694527_1694764_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ67549.1|1694982_1695174_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ67550.1|1695691_1697041_+	replication protein RepR	NA	NA	NA	NA	NA
AUJ67551.1|1697084_1697279_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ67552.1|1697410_1699252_+	DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	43.8	2.1e-102
AUJ67553.1|1699808_1699997_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ67554.1|1700443_1700653_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ67555.1|1700721_1701144_+	cupin	NA	Q2I8C5	Bacillus_phage	58.5	2.4e-38
AUJ67556.1|1701227_1701881_+	ABC transporter	NA	G3M9Y6	Bacillus_virus	36.9	6.2e-25
AUJ67557.1|1701877_1702642_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
AUJ67558.1|1702716_1702830_+	resolvase	NA	NA	NA	NA	NA
AUJ67559.1|1703151_1704313_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	2.7e-79
AUJ67560.1|1704596_1705433_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.5	6.8e-77
AUJ67561.1|1706688_1706880_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ67562.1|1707428_1708094_-	DNA-binding protein	NA	A0A2I7SCV6	Paenibacillus_phage	45.6	6.5e-06
AUJ67563.1|1708219_1710256_+	DUF1430 domain-containing protein	NA	NA	NA	NA	NA
AUJ67564.1|1711270_1712182_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AUJ67565.1|1712397_1712835_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ67566.1|1712929_1713814_+	diacylglycerol kinase	NA	NA	NA	NA	NA
AUJ67567.1|1714034_1717205_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ67568.1|1717224_1718253_+	cell wall anchor protein	NA	NA	NA	NA	NA
AUJ67569.1|1719094_1719835_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUJ67570.1|1719895_1721149_+	ATP-binding protein	NA	NA	NA	NA	NA
AUJ67571.1|1721470_1721698_+	transcriptional regulator	NA	NA	NA	NA	NA
AUJ67572.1|1721819_1722146_+	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
AUJ67573.1|1722213_1722927_+	class A sortase	NA	NA	NA	NA	NA
AUJ67574.1|1724209_1726075_+	PTS beta-glucoside transporter subunit EIIBCA	NA	NA	NA	NA	NA
AUJ67575.1|1726088_1727531_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	27.2	2.3e-32
AUJ67576.1|1727638_1728340_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ68337.1|1728546_1728978_+	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
AUJ67577.1|1729159_1729318_+	sugar isomerase	NA	NA	NA	NA	NA
AUJ67578.1|1729375_1729585_-|tRNA	phenylalanyl-tRNA synthetase subunit beta	tRNA	NA	NA	NA	NA
>prophage 6
CP021885	Enterococcus faecium strain WEFA23 chromosome, complete genome	2496099	2061262	2071078	2496099	tRNA	Streptococcus_phage(50.0%)	9	NA	NA
AUJ67885.1|2061262_2061979_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
AUJ67886.1|2061978_2063427_+	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.3	1.7e-19
AUJ67887.1|2063496_2064006_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ67888.1|2063995_2064721_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ67889.1|2064943_2067064_-	phosphoglycerol transferase	NA	W6LM83	Streptococcus_phage	58.1	2.8e-220
AUJ67890.1|2067293_2068472_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	48.9	5.1e-102
AUJ67891.1|2068487_2069246_+	3-dehydroquinase	NA	W6LP76	Streptococcus_phage	36.9	8.5e-26
AUJ67892.1|2069268_2069754_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
AUJ67893.1|2069824_2071078_-	aminoacetone oxidase family FAD-binding enzyme	NA	A0A2H4PQX1	Staphylococcus_phage	55.3	7.7e-24
