The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP021011	Bacillus velezensis strain GFP-2 chromosome, complete genome	3975220	73474	138109	3975220	tail,head,holin,integrase,coat,portal,tRNA,terminase,capsid	Bacillus_phage(39.47%)	76	71703:71732	114158:114187
71703:71732	attL	TTTTTTTCGTTTTAGGAATCATATTATAAA	NA	NA	NA	NA
AUJ59165.1|73474_74965_-	UDP-glucose--polyglycerol phosphate glucosyltransferase	NA	A0A1V0SGA9	Hokovirus	30.0	9.5e-05
AUJ59166.1|75310_75946_+	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
AUJ59167.1|76154_76682_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ59168.1|76876_78040_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	49.1	1.2e-68
AUJ59169.1|78085_78508_-|holin	holin	holin	D6R405	Bacillus_phage	87.2	3.6e-58
AUJ59170.1|78557_78743_-	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	72.1	5.8e-21
AUJ59171.1|78742_79105_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	56.3	5.1e-29
AUJ59172.1|79101_80925_-	hypothetical protein	NA	D6R402	Bacillus_phage	37.7	3.8e-80
AUJ59173.1|80939_83504_-	peptidase G2	NA	D6R401	Bacillus_phage	79.9	0.0e+00
AUJ59174.1|83557_85261_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	57.6	6.1e-181
AUJ59175.1|85275_86115_-|tail	phage tail protein	tail	D6R3Z9	Bacillus_phage	58.3	1.5e-92
AUJ59176.1|86108_90596_-|tail	phage tail tape measure protein	tail	A0A1Q1PVX7	Staphylococcus_phage	32.3	1.8e-62
AUJ59177.1|90793_91171_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ59178.1|91232_91841_-|tail	phage tail protein	tail	A0A2H4J8F3	uncultured_Caudovirales_phage	35.5	3.7e-24
AUJ59179.1|91855_92239_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ59180.1|92235_92634_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ59181.1|92630_92948_-|head,tail	phage head-tail adapter protein	head,tail	A0A2H4JCB1	uncultured_Caudovirales_phage	36.3	3.8e-12
AUJ59182.1|92937_93240_-	DNA-packaging protein	NA	A0A0S2GLH6	Bacillus_phage	45.2	3.6e-12
AUJ59183.1|93257_93674_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	50.0	6.5e-12
AUJ59184.1|93696_94989_-|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	49.4	1.1e-94
AUJ59185.1|95027_95654_-	peptidase U35	NA	Q9ZXF7	Bacillus_phage	77.2	7.3e-84
AUJ59186.1|95616_96897_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	63.1	1.6e-154
AUJ59187.1|97085_98795_-|terminase	terminase	terminase	A0A0S2GLF0	Bacillus_phage	63.1	1.7e-207
AUJ59188.1|98791_99307_-|terminase	terminase	terminase	A6M947	Geobacillus_virus	42.3	5.4e-32
AUJ59189.1|99270_99537_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ59190.1|99533_99899_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	54.2	2.3e-29
AUJ59191.1|100188_100662_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ59192.1|100795_101008_-	DNA-binding protein	NA	A0A1Z1LZP5	Bacillus_phage	45.5	3.4e-09
AUJ62667.1|101000_101183_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ59193.1|101533_102412_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ59194.1|102780_103299_-	Fis family transcriptional regulator	NA	A0A1L2JY33	Aeribacillus_phage	43.2	3.6e-28
AUJ59195.1|103318_103504_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ59196.1|103751_104417_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ59197.1|104579_104837_-	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	40.5	2.5e-06
AUJ59198.1|104872_105076_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	70.3	2.8e-21
AUJ59199.1|105373_105802_-	hypothetical protein	NA	S6B1L9	Thermus_phage	65.0	1.1e-43
AUJ59200.1|106037_106949_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	50.7	1.0e-54
AUJ59201.1|106869_107571_-	DnaD domain protein	NA	NA	NA	NA	NA
AUJ59202.1|107580_107769_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ59203.1|107768_108506_-	hypothetical protein	NA	A0A2P1JU03	Anoxybacillus_phage	42.4	4.8e-42
AUJ59204.1|108525_109446_-	hypothetical protein	NA	A0A0A7S0A9	Clostridium_phage	63.6	4.5e-90
AUJ59205.1|109442_109631_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ59206.1|109733_109931_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ59207.1|109927_110185_-	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	39.8	1.1e-09
AUJ59208.1|110181_110667_-	transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	47.9	3.6e-46
AUJ59209.1|110722_111451_-	phage regulatory protein	NA	A0A2H4J4N4	uncultured_Caudovirales_phage	68.3	1.4e-89
AUJ59210.1|111447_111762_-	hypothetical protein	NA	A0A2H4JDL0	uncultured_Caudovirales_phage	49.3	1.9e-11
AUJ59211.1|111774_111993_-	transcriptional regulator	NA	NA	NA	NA	NA
AUJ59212.1|112145_112523_+	transcriptional regulator	NA	A0A0A7RTK4	Clostridium_phage	45.3	5.0e-11
AUJ59213.1|112885_114082_+|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	43.9	5.5e-80
AUJ59214.1|114125_115430_-	xanthine permease	NA	NA	NA	NA	NA
114158:114187	attR	TTTTTTTCGTTTTAGGAATCATATTATAAA	NA	NA	NA	NA
AUJ59215.1|115426_116011_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
AUJ59216.1|116345_117848_-	carboxypeptidase M32	NA	NA	NA	NA	NA
AUJ59217.1|117959_119879_-	ATP-dependent helicase	NA	A0A2P1N0K5	Streptomyces_phage	21.7	3.0e-11
AUJ59218.1|119983_120175_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ59219.1|120341_120494_+	YpzG family protein	NA	NA	NA	NA	NA
AUJ59220.1|120552_121701_-	RNA methyltransferase	NA	NA	NA	NA	NA
AUJ59221.1|122234_122534_-	cell cycle protein GpsB	NA	NA	NA	NA	NA
AUJ59222.1|122613_123162_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ59223.1|123250_123487_-|coat	spore coat protein	coat	NA	NA	NA	NA
AUJ59224.1|123799_125038_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ59225.1|125057_127304_-	ATP-dependent helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	27.3	9.6e-09
AUJ59226.1|127402_127909_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
AUJ59227.1|128047_128461_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ59228.1|128490_128925_-|coat	spore coat protein	coat	NA	NA	NA	NA
AUJ59229.1|129111_129294_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ59230.1|129332_129701_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ59231.1|129746_129992_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ59232.1|130197_130302_+	spore protein	NA	NA	NA	NA	NA
AUJ59233.1|130345_131308_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ62668.1|131349_131958_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	34.3	1.0e-21
AUJ59234.1|131996_134780_+	peptidase	NA	NA	NA	NA	NA
AUJ59235.1|134857_135349_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ59236.1|135345_136005_-	endonuclease III	NA	NA	NA	NA	NA
AUJ59237.1|136023_136722_-	DNA replication protein DnaD	NA	NA	NA	NA	NA
AUJ59238.1|136816_138109_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	29.5	7.9e-56
>prophage 2
CP021011	Bacillus velezensis strain GFP-2 chromosome, complete genome	3975220	215037	221289	3975220		Staphylococcus_phage(66.67%)	10	NA	NA
AUJ59319.1|215037_215631_-	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.6e-14
AUJ59320.1|215620_216376_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.7	2.9e-10
AUJ59321.1|216583_216673_+	sporulation protein YjcZ	NA	NA	NA	NA	NA
AUJ59322.1|216760_217282_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ59323.1|217226_217442_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ59324.1|217347_217722_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUJ59325.1|217837_218302_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.3	1.2e-43
AUJ59326.1|218334_219531_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	1.6e-116
AUJ59327.1|219545_220193_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	1.5e-39
AUJ59328.1|220173_221289_-	riboflavin biosynthesis protein RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.6	2.6e-55
>prophage 3
CP021011	Bacillus velezensis strain GFP-2 chromosome, complete genome	3975220	1568300	1642036	3975220	protease,coat	Bacillus_phage(20.0%)	55	NA	NA
AUJ60575.1|1568300_1568960_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AUJ60576.1|1569064_1569253_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
AUJ60577.1|1569290_1569710_-	transcriptional regulator	NA	NA	NA	NA	NA
AUJ60578.1|1569808_1570042_+	amino acid permease	NA	NA	NA	NA	NA
AUJ60579.1|1570100_1571480_+	amino acid permease	NA	NA	NA	NA	NA
AUJ60580.1|1571544_1572045_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ60581.1|1572084_1573386_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	29.5	1.0e-23
AUJ60582.1|1573546_1573771_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
AUJ60583.1|1573975_1574749_+	Prespore-specific transcriptional regulator RsfA	NA	NA	NA	NA	NA
AUJ60584.1|1575049_1575325_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ60585.1|1575325_1575880_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ60586.1|1576245_1577109_-	octanoyl-[GcvH]:protein N-octanoyltransferase	NA	NA	NA	NA	NA
AUJ60587.1|1577155_1578055_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	40.2	2.1e-07
AUJ60588.1|1578170_1579148_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ60589.1|1579184_1580156_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
AUJ60590.1|1580418_1581183_+	heme-binding protein	NA	NA	NA	NA	NA
AUJ60591.1|1581325_1581523_+	transcriptional regulator	NA	NA	NA	NA	NA
AUJ60592.1|1581525_1581900_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ60593.1|1581920_1582115_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AUJ60594.1|1582267_1583026_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ60595.1|1583489_1583900_-	thiol reductase thioredoxin	NA	NA	NA	NA	NA
AUJ60596.1|1584300_1585080_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AUJ60597.1|1585096_1586296_-	aspartate aminotransferase	NA	NA	NA	NA	NA
AUJ60598.1|1586308_1587490_-	MFS transporter	NA	NA	NA	NA	NA
AUJ60599.1|1587486_1588905_-	carboxylate--amine ligase	NA	NA	NA	NA	NA
AUJ60600.1|1588922_1589684_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.5	4.4e-22
AUJ60601.1|1589680_1590391_-	bacilysin biosynthesis protein BacB	NA	NA	NA	NA	NA
AUJ60602.1|1590380_1590995_-	bacilysin biosynthesis protein BacA	NA	NA	NA	NA	NA
AUJ60603.1|1591156_1592395_-	MFS transporter	NA	NA	NA	NA	NA
AUJ60604.1|1592618_1593821_+	MFS transporter	NA	S4TR35	Salmonella_phage	24.5	5.5e-27
AUJ60605.1|1593853_1595272_-	amino acid permease	NA	NA	NA	NA	NA
AUJ60606.1|1595296_1596979_-	peptidase M20	NA	NA	NA	NA	NA
AUJ62722.1|1597049_1598597_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUJ60607.1|1598794_1600081_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
AUJ60608.1|1600311_1601247_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	1.4e-22
AUJ60609.1|1601247_1601946_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.5	1.6e-34
AUJ60610.1|1602179_1602461_-	AbrB family transcriptional regulator	NA	A0A2I7SC16	Paenibacillus_phage	47.3	1.6e-09
AUJ60611.1|1602673_1603543_-	protein liaG	NA	NA	NA	NA	NA
AUJ60612.1|1603581_1604286_-	bacitracin ABC transporter permease	NA	NA	NA	NA	NA
AUJ60613.1|1604383_1605307_-	bacitracin ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	47.3	4.9e-44
AUJ60614.1|1605528_1606182_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ60615.1|1606656_1608345_-	hypothetical protein	NA	W8CYL7	Bacillus_phage	25.6	2.0e-27
AUJ60616.1|1608440_1614863_-	hypothetical protein	NA	A0A2K9L3I8	Tupanvirus	21.9	2.7e-112
AUJ60617.1|1614914_1624028_-	hypothetical protein	NA	A0A2K9L3I8	Tupanvirus	26.1	5.5e-87
AUJ60618.1|1624058_1631672_-	hypothetical protein	NA	A0A2K9KZV5	Tupanvirus	21.3	3.6e-116
AUJ60619.1|1632659_1633115_-|coat	spore coat protein	coat	NA	NA	NA	NA
AUJ60620.1|1633111_1633960_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.3	5.4e-37
AUJ60621.1|1633980_1634928_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	42.9	7.7e-69
AUJ60622.1|1634930_1635668_-	glucose-1-phosphate thymidylyltransferase	NA	G3MA50	Bacillus_virus	42.7	5.0e-47
AUJ60623.1|1635695_1636700_-|coat	spore coat protein	coat	NA	NA	NA	NA
AUJ60624.1|1636701_1637442_-|coat	spore coat protein	coat	NA	NA	NA	NA
AUJ60625.1|1637434_1638556_-|coat	spore coat protein	coat	NA	NA	NA	NA
AUJ60626.1|1638555_1639419_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUJ60627.1|1639419_1640589_-	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	NA	NA	NA	NA
AUJ60628.1|1640611_1642036_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 4
CP021011	Bacillus velezensis strain GFP-2 chromosome, complete genome	3975220	2601763	2611654	3975220		Synechococcus_phage(50.0%)	9	NA	NA
AUJ61502.1|2601763_2603056_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	5.9e-19
AUJ61503.1|2603131_2603851_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.3	7.5e-48
AUJ61504.1|2603850_2604105_+	phosphoribosylformylglycinamidine synthase, purS protein	NA	M4QPE7	Synechococcus_phage	33.3	4.7e-05
AUJ61505.1|2604101_2604785_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AUJ61506.1|2604768_2606997_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	40.4	3.2e-158
AUJ61507.1|2606972_2608403_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	3.7e-54
AUJ61508.1|2608494_2609535_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.4	6.3e-64
AUJ61509.1|2609531_2610119_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.3	7.7e-27
AUJ61510.1|2610115_2611654_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.2	5.6e-77
>prophage 5
CP021011	Bacillus velezensis strain GFP-2 chromosome, complete genome	3975220	3051061	3084670	3975220	coat,tRNA	Planktothrix_phage(16.67%)	37	NA	NA
AUJ61923.1|3051061_3052054_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AUJ61924.1|3052794_3054429_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUJ61925.1|3054535_3055471_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AUJ61926.1|3055474_3056392_+	diguanylate cyclase	NA	NA	NA	NA	NA
AUJ61927.1|3056404_3057481_+	peptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	2.3e-16
AUJ61928.1|3057473_3058391_+	peptide ABC transporter ATP-binding protein	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.5e-05
AUJ61929.1|3058497_3059685_+	GTP-binding protein	NA	NA	NA	NA	NA
AUJ61930.1|3059802_3060381_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUJ61931.1|3060559_3060955_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
AUJ61932.1|3061012_3061669_-	hypothetical protein	NA	A0A0S4KZH7	Pseudomonas_phage	40.4	3.8e-30
AUJ61933.1|3061944_3062601_+	adaptor protein MecA	NA	NA	NA	NA	NA
AUJ61934.1|3062752_3063913_+	competence protein CoiA	NA	NA	NA	NA	NA
AUJ62783.1|3063957_3065970_+	oligoendopeptidase F	NA	NA	NA	NA	NA
AUJ61935.1|3066460_3067363_-	DsbA family protein	NA	NA	NA	NA	NA
AUJ61936.1|3067359_3067758_-	thiol management oxidoreductase	NA	NA	NA	NA	NA
AUJ61937.1|3067986_3068673_-	lytic transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	71.2	7.9e-39
AUJ61938.1|3068677_3069253_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
AUJ61939.1|3069377_3069743_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ61940.1|3069770_3070406_+	GTP pyrophosphokinase	NA	NA	NA	NA	NA
AUJ61941.1|3070423_3071224_+	NAD kinase	NA	NA	NA	NA	NA
AUJ61942.1|3071238_3072132_+	RNA pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.3	1.0e-06
AUJ61943.1|3072164_3072914_-	hypothetical protein	NA	A0A1V0SJW2	Klosneuvirus	26.7	9.0e-12
AUJ61944.1|3073141_3074986_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AUJ62784.1|3075235_3075943_+	thiaminase II	NA	NA	NA	NA	NA
AUJ62785.1|3075920_3076538_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
AUJ61945.1|3076521_3077631_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
AUJ61946.1|3077627_3077831_+	thiamine biosynthesis protein ThiS	NA	NA	NA	NA	NA
AUJ61947.1|3077833_3078598_+	thiazole synthase	NA	NA	NA	NA	NA
AUJ61948.1|3078594_3079605_+	thiamine biosynthesis protein MoeB	NA	NA	NA	NA	NA
AUJ61949.1|3079627_3080440_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AUJ61950.1|3080570_3081347_+	enoyl-[acyl-carrier-protein] reductase	NA	NA	NA	NA	NA
AUJ61951.1|3081444_3082053_+|coat	spore coat protein	coat	NA	NA	NA	NA
AUJ61952.1|3082111_3082555_-|coat	spore coat protein	coat	NA	NA	NA	NA
AUJ61953.1|3082703_3083186_-|coat	spore coat protein	coat	NA	NA	NA	NA
AUJ61954.1|3083336_3083837_-|coat	spore coat protein	coat	NA	NA	NA	NA
AUJ61955.1|3083929_3084244_-|coat	spore coat protein	coat	NA	NA	NA	NA
AUJ61956.1|3084283_3084670_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 6
CP021011	Bacillus velezensis strain GFP-2 chromosome, complete genome	3975220	3142324	3196234	3975220	portal,holin,protease	uncultured_Caudovirales_phage(26.09%)	58	NA	NA
AUJ62015.1|3142324_3143455_+	aspartate phosphatase	NA	A0A1P8CWN8	Bacillus_phage	47.9	1.3e-94
AUJ62016.1|3143720_3144674_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	69.3	1.1e-62
AUJ62017.1|3144711_3145089_-	helicase	NA	A5GYQ0	Lactococcus_phage	41.4	1.1e-15
AUJ62018.1|3145198_3145801_+	hypothetical protein	NA	A0A0Y0AJU6	Bacillus_phage	47.3	1.9e-41
AUJ62019.1|3145872_3146709_+	manganese catalase	NA	NA	NA	NA	NA
AUJ62020.1|3146730_3147321_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	3.0e-39
AUJ62021.1|3147468_3147807_-	transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	8.4e-18
AUJ62022.1|3147998_3148178_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ62023.1|3148167_3148995_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	49.5	2.9e-19
AUJ62024.1|3148894_3149695_+	hypothetical protein	NA	A6XMI1	Bacillus_virus	45.1	8.0e-59
AUJ62025.1|3149959_3150301_+|portal	phage portal protein	portal	NA	NA	NA	NA
AUJ62026.1|3150290_3150494_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	48.5	5.4e-12
AUJ62027.1|3150607_3151120_+	Fis family transcriptional regulator	NA	A0A0K2CNQ1	Brevibacillus_phage	44.6	2.2e-22
AUJ62028.1|3152322_3152694_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ62029.1|3152698_3152896_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	62.5	3.3e-14
AUJ62030.1|3152952_3153714_+|portal	phage portal protein	portal	NA	NA	NA	NA
AUJ62031.1|3153765_3154029_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	63.1	6.7e-23
AUJ62032.1|3154042_3154306_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	2.3e-23
AUJ62033.1|3154319_3155198_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	60.5	4.8e-81
AUJ62034.1|3155454_3155625_-	stage II sporulation protein SB	NA	NA	NA	NA	NA
AUJ62035.1|3155625_3156372_-	stage II sporulation protein SA	NA	NA	NA	NA	NA
AUJ62036.1|3156476_3157475_-	anion permease	NA	NA	NA	NA	NA
AUJ62037.1|3157487_3158105_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ62038.1|3158390_3159707_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
AUJ62039.1|3160029_3160980_+	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
AUJ62040.1|3161164_3163303_+	mannosyltransferase	NA	NA	NA	NA	NA
AUJ62041.1|3163314_3164286_+	glycosyltransferase	NA	A0A2H5BFL1	Salmonella_phage	41.3	3.2e-62
AUJ62042.1|3164649_3166002_-|protease	serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	33.3	1.6e-22
AUJ62043.1|3166286_3167846_+	MFS transporter	NA	NA	NA	NA	NA
AUJ62044.1|3168001_3168826_+	aminopeptidase	NA	NA	NA	NA	NA
AUJ62045.1|3168840_3169767_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AUJ62046.1|3169772_3170720_+	diguanylate cyclase	NA	NA	NA	NA	NA
AUJ62047.1|3170725_3171754_+	peptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	7.5e-17
AUJ62048.1|3171750_3173370_+	oligopeptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUJ62049.1|3173457_3174393_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
AUJ62050.1|3174399_3175497_+	dipeptide epimerase	NA	NA	NA	NA	NA
AUJ62051.1|3175493_3176393_+	peptidase	NA	A0A2H4PQY6	Streptomyces_phage	36.4	7.2e-16
AUJ62052.1|3176396_3177368_+	oligopeptide ABC transporter ATP-binding protein OppF	NA	G3M9Y6	Bacillus_virus	35.0	8.9e-20
AUJ62053.1|3177378_3178443_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
AUJ62054.1|3178513_3179374_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ62055.1|3179562_3180081_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AUJ62056.1|3180180_3180726_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUJ62057.1|3180913_3181252_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AUJ62058.1|3181251_3181566_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AUJ62059.1|3181639_3182542_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	36.2	1.2e-15
AUJ62060.1|3182910_3184023_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.2	5.5e-74
AUJ62061.1|3184019_3185267_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	49.9	8.9e-97
AUJ62062.1|3185380_3185806_+	Organic hydroperoxide resistance protein OhrA	NA	NA	NA	NA	NA
AUJ62787.1|3185833_3186280_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ62063.1|3186417_3186828_+	Organic hydroperoxide resistance protein OhrA	NA	NA	NA	NA	NA
AUJ62788.1|3187237_3187426_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ62064.1|3187556_3188021_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ62065.1|3188025_3189153_+	glycosyltransferase	NA	NA	NA	NA	NA
AUJ62066.1|3189173_3190325_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ62067.1|3190622_3191807_-	MFS transporter	NA	NA	NA	NA	NA
AUJ62068.1|3191888_3192560_+	transcriptional regulator YeiL	NA	NA	NA	NA	NA
AUJ62069.1|3192608_3194897_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
AUJ62070.1|3195274_3196234_-|protease	serine protease	protease	A0A127AWU5	Bacillus_phage	50.9	1.5e-72
>prophage 7
CP021011	Bacillus velezensis strain GFP-2 chromosome, complete genome	3975220	3708843	3715056	3975220		Bacillus_phage(50.0%)	7	NA	NA
AUJ62469.1|3708843_3709236_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	59.1	3.8e-30
AUJ62470.1|3709195_3711298_+	ribonucleotide-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.0	0.0e+00
AUJ62471.1|3711315_3712305_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.3	2.5e-155
AUJ62472.1|3712353_3712974_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	47.9	2.1e-46
AUJ62473.1|3713022_3713781_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.0	8.1e-53
AUJ62474.1|3713814_3714039_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ62475.1|3714087_3715056_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.9	8.0e-53
