The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP019091	Xanthomonas oryzae pv. oryzae strain MAI134 chromosome, complete genome	4730142	75161	129970	4730142	protease,transposase	Niemeyer_virus(20.0%)	36	NA	NA
AUJ14322.1|75161_75692_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ11107.1|75505_75925_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ11108.1|75967_77125_-	XylR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ14323.1|77321_79886_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUJ11109.1|79896_80682_+	Tat pathway signal protein	NA	NA	NA	NA	NA
AUJ14324.1|82666_82834_-	amino acid transporter	NA	NA	NA	NA	NA
AUJ11110.1|83323_83629_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11111.1|83838_85116_-	DNA topoisomerase	NA	A0A0U2TSJ7	Niemeyer_virus	35.5	4.1e-41
AUJ11112.1|85172_85553_+	Elastase inhibitor AFLEI Flags: Precursor	NA	NA	NA	NA	NA
AUJ11113.1|85754_90227_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
AUJ11114.1|90421_91903_+	glutamate synthase small subunit	NA	NA	NA	NA	NA
AUJ11115.1|93836_94895_-	hydroxyacid dehydrogenase	NA	A0A2K9L339	Tupanvirus	46.0	1.7e-77
AUJ11116.1|94880_95087_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11117.1|95202_96276_+	cellulase	NA	NA	NA	NA	NA
AUJ11118.1|96975_98028_+	cellulase	NA	NA	NA	NA	NA
AUJ11119.1|98810_99941_+	cellulase	NA	NA	NA	NA	NA
AUJ11120.1|100357_101374_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.6e-48
AUJ11121.1|101634_103446_-	aminopeptidase	NA	NA	NA	NA	NA
AUJ11122.1|103608_104265_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14325.1|104443_105661_+	peptidase M23	NA	NA	NA	NA	NA
AUJ11123.1|105765_107289_+	peptidase S41	NA	A0A0R6PIZ1	Moraxella_phage	29.2	1.0e-25
AUJ14326.1|108586_108907_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11124.1|109023_109716_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AUJ11125.1|109934_111275_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14327.1|112421_113480_+	radical SAM protein	NA	NA	NA	NA	NA
AUJ11126.1|113568_114537_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
AUJ11127.1|116624_117692_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUJ14328.1|117647_117845_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11128.1|118895_119351_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14329.1|119836_120034_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11129.1|120010_120505_-	YfcE family phosphodiesterase	NA	NA	NA	NA	NA
AUJ14330.1|120678_122862_-	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
AUJ11130.1|122873_126224_-	maltose alpha-D-glucosyltransferase	NA	NA	NA	NA	NA
AUJ11131.1|126220_129337_-	alpha-amylase	NA	NA	NA	NA	NA
AUJ11132.1|129549_129807_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11133.1|129706_129970_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
CP019091	Xanthomonas oryzae pv. oryzae strain MAI134 chromosome, complete genome	4730142	203036	269199	4730142	transposase	Ralstonia_phage(20.0%)	59	NA	NA
AUJ14339.1|203036_203462_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ11193.1|203770_207160_-	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
AUJ11194.1|207989_209219_+	lipase	NA	NA	NA	NA	NA
AUJ11195.1|209553_209856_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11196.1|210008_210806_-	2,5-didehydrogluconate reductase B	NA	A0A2H4PQR8	Staphylococcus_phage	35.5	3.9e-37
AUJ11197.1|210867_211896_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
AUJ11198.1|212034_213006_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AUJ11199.1|213238_214093_+	methyltransferase	NA	NA	NA	NA	NA
AUJ14340.1|214185_214758_+	pseudouridine synthase	NA	NA	NA	NA	NA
AUJ11200.1|214779_214974_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11201.1|215080_215521_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11202.1|215939_218441_-	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	25.7	1.6e-20
AUJ11203.1|218594_219233_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11204.1|219825_220299_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	48.7	2.1e-35
AUJ14341.1|220484_221189_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AUJ11205.1|223039_224296_-	aminotransferase V	NA	NA	NA	NA	NA
AUJ11206.1|225432_225825_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUJ11207.1|225936_228444_+	peptidase	NA	NA	NA	NA	NA
AUJ11208.1|228621_229080_-	gas vesicle protein	NA	NA	NA	NA	NA
AUJ11209.1|229305_229827_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
AUJ11210.1|230212_231181_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
AUJ11211.1|231385_231637_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11212.1|232073_232259_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11213.1|232987_233296_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11214.1|233292_233739_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11215.1|234824_235637_+	hydrolase TatD	NA	NA	NA	NA	NA
AUJ11216.1|236333_236531_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11217.1|236506_237394_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ11218.1|237409_238771_+	MFS transporter	NA	NA	NA	NA	NA
AUJ11219.1|239210_240092_+	NAD-dependent deacetylase	NA	A0A068EPD4	Bacillus_phage	23.3	6.6e-14
AUJ14342.1|240171_241269_+	oxidoreductase	NA	NA	NA	NA	NA
AUJ11220.1|241306_242185_+	oxidoreductase	NA	NA	NA	NA	NA
AUJ14343.1|242527_242920_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11221.1|243138_243990_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
AUJ11222.1|244073_244751_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUJ11223.1|244783_245191_-	ATP-binding protein	NA	W8CYF6	Bacillus_phage	32.5	4.7e-15
AUJ11224.1|245187_245433_-	histidine kinase	NA	NA	NA	NA	NA
AUJ14344.1|245449_246346_-	5,10-methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
AUJ11225.1|246603_247269_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11226.1|247268_248183_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ11227.1|248373_248967_+	FMN reductase	NA	NA	NA	NA	NA
AUJ11228.1|249109_250093_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11229.1|250120_251149_+	5-methyltetrahydropteroyltriglutamate-- homocysteine methyltransferase	NA	NA	NA	NA	NA
AUJ14345.1|251356_252313_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
AUJ11230.1|254722_255601_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUJ11231.1|255737_256169_+	transcriptional regulator	NA	NA	NA	NA	NA
AUJ11232.1|256386_256629_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11233.1|256679_257666_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	40.6	4.9e-42
AUJ11234.1|257750_257948_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14346.1|257997_258243_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11235.1|258485_261773_-	avirulence protein	NA	NA	NA	NA	NA
AUJ11236.1|262467_262737_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11237.1|262705_262969_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ11238.1|262821_263808_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-43
AUJ11239.1|263903_264872_+	recombinase XerD	NA	A0A1P8DJJ6	Virus_Rctr41k	44.0	7.7e-56
AUJ11240.1|265105_266944_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
AUJ14347.1|267118_267385_+	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
AUJ11241.1|267410_267956_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AUJ11242.1|268230_269199_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.1e-99
>prophage 3
CP019091	Xanthomonas oryzae pv. oryzae strain MAI134 chromosome, complete genome	4730142	273246	325048	4730142	tRNA,transposase	Leptospira_phage(50.0%)	39	NA	NA
AUJ14348.1|273246_273633_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ11245.1|276432_278232_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11246.1|278582_278852_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ11247.1|278704_279691_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.0	2.9e-42
AUJ11248.1|280111_280999_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUJ11249.1|281096_282287_+	4-hydroxybenzoate 3-monooxygenase	NA	NA	NA	NA	NA
AUJ11250.1|282698_283211_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11251.1|284781_285765_-	oxidoreductase	NA	NA	NA	NA	NA
AUJ11252.1|285865_286942_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AUJ14349.1|287193_288057_+	3-oxoadipate--succinyl-CoA transferase	NA	NA	NA	NA	NA
AUJ11253.1|288053_288842_+	3-oxoadipate--succinyl-CoA transferase subunit B	NA	NA	NA	NA	NA
AUJ11254.1|288838_290047_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
AUJ11255.1|290125_290863_+	protocatechuate 3,4-dioxygenase subunit beta	NA	NA	NA	NA	NA
AUJ11256.1|290867_291431_+	protocatechuate 3,4-dioxygenase subunit alpha	NA	NA	NA	NA	NA
AUJ11257.1|291928_293281_+	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
AUJ11258.1|293291_294074_+	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
AUJ11259.1|294099_294504_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AUJ11260.1|295983_296844_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ11261.1|296991_297852_+	serine protein kinase RIO	NA	NA	NA	NA	NA
AUJ11262.1|301146_303051_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
AUJ11263.1|303311_303491_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11264.1|303624_304092_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11265.1|304249_305209_+	serine dehydratase	NA	NA	NA	NA	NA
AUJ11266.1|305193_305808_+	protein sanA-like protein	NA	NA	NA	NA	NA
AUJ11267.1|305850_306270_+	isopropylmalate/homocitrate/citramalate synthase	NA	NA	NA	NA	NA
AUJ11268.1|306522_307428_-	aspartyl beta-hydroxylase	NA	H8ZJK8	Ostreococcus_tauri_virus	38.7	9.8e-37
AUJ11269.1|307676_308561_-	malonyl-[acyl-carrier protein] O-methyltransferase BioC	NA	NA	NA	NA	NA
AUJ14350.1|309450_310212_-	pimeloyl-[acyl-carrier protein] methyl ester esterase	NA	NA	NA	NA	NA
AUJ11270.1|310375_310750_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11271.1|310941_312147_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
AUJ11272.1|312238_313273_-	biotin synthase BioB	NA	NA	NA	NA	NA
AUJ11273.1|313316_314048_+	amidophosphoribosyltransferase	NA	NA	NA	NA	NA
AUJ11274.1|314303_315209_-	4-hydroxybenzoate polyprenyltransferase	NA	NA	NA	NA	NA
AUJ11275.1|316161_318102_-	HpaF protein	NA	NA	NA	NA	NA
AUJ11276.1|318665_321074_-	serine kinase	NA	NA	NA	NA	NA
AUJ11277.1|322541_323528_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.0	1.7e-42
AUJ11278.1|323380_323644_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ11279.1|323612_323822_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14351.1|324031_325048_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.6e-48
>prophage 4
CP019091	Xanthomonas oryzae pv. oryzae strain MAI134 chromosome, complete genome	4730142	353675	419781	4730142	transposase	Ralstonia_phage(45.45%)	50	NA	NA
AUJ11304.1|353675_354644_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	4.3e-99
AUJ11305.1|354769_356494_-	ABC transporter substrate-binding protein	NA	A0A0P0CRE2	Ostreococcus_lucimarinus_virus	28.9	7.8e-35
AUJ11306.1|356504_356717_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11307.1|356734_357676_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11308.1|357869_359234_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11309.1|359230_360859_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AUJ14354.1|361468_362926_+	starch synthase	NA	NA	NA	NA	NA
AUJ11310.1|362922_365154_+	glycogen-branching enzyme	NA	NA	NA	NA	NA
AUJ11311.1|365156_366914_+	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
AUJ14355.1|366970_368860_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
AUJ11312.1|368856_371460_+	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
AUJ11313.1|371482_371668_+	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
AUJ11314.1|371781_373944_+	glycogen debranching enzyme	NA	NA	NA	NA	NA
AUJ14356.1|373960_374593_+	NAD-dependent dehydratase	NA	NA	NA	NA	NA
AUJ11315.1|375104_376073_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AUJ14357.1|376554_376716_-	methylamine utilization protein	NA	NA	NA	NA	NA
AUJ11316.1|376961_377930_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
AUJ11317.1|380892_381861_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	4.3e-99
AUJ14358.1|382689_383706_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	3.3e-49
AUJ11318.1|384309_384579_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ11319.1|384431_385418_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.0	3.8e-42
AUJ11320.1|385436_386045_+|transposase	IS5 family transposase	transposase	K4I1H9	Acidithiobacillus_phage	65.4	4.4e-41
AUJ11321.1|386078_386834_-	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AUJ11322.1|386797_387103_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11323.1|387184_388621_+	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
AUJ11324.1|388969_389401_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14359.1|389813_390008_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11325.1|390447_391737_-	RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	3.5e-40
AUJ11326.1|391744_391996_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11327.1|392332_393313_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	56.5	1.1e-89
AUJ11328.1|393776_394100_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11329.1|394041_394284_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11330.1|394337_395861_-	branched-chain alpha-keto acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
AUJ14360.1|396242_397226_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
AUJ11331.1|397305_398394_-	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
AUJ14361.1|402555_403449_+	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
AUJ11332.1|405410_406001_+	disulfide bond formation protein DsbD	NA	NA	NA	NA	NA
AUJ11333.1|406355_406844_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ11334.1|407010_408081_+	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
AUJ11335.1|408445_409771_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
AUJ14362.1|410194_410575_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11336.1|410971_411325_-	Na+/H+ antiporter subunit G	NA	NA	NA	NA	NA
AUJ11337.1|411321_411606_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
AUJ11338.1|411602_412109_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
AUJ11339.1|412105_413650_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
AUJ11340.1|413646_414021_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
AUJ11341.1|414020_416849_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
AUJ11342.1|417389_417875_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11343.1|418678_419665_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.0	2.9e-42
AUJ11344.1|419517_419781_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
CP019091	Xanthomonas oryzae pv. oryzae strain MAI134 chromosome, complete genome	4730142	456262	565961	4730142	capsid,terminase,portal,tRNA,transposase,head,tail,integrase,plate	Stenotrophomonas_phage(43.48%)	111	520883:520927	563875:563919
AUJ11372.1|456262_456526_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ11373.1|456378_457365_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.0	2.9e-42
AUJ11374.1|457413_459627_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
AUJ11375.1|459993_461289_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
AUJ11376.1|461309_461924_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11377.1|461923_463159_-	ATPase	NA	A0A077SLJ9	Escherichia_phage	25.9	7.8e-21
AUJ11378.1|463208_464792_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/inosine monophosphate cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.6	8.1e-63
AUJ11379.1|464865_465483_+	CDP-alcohol phosphatidyltransferase	NA	NA	NA	NA	NA
AUJ11380.1|465502_465808_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11381.1|465804_466791_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.0	2.2e-42
AUJ11382.1|466643_466913_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ11383.1|467594_467867_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
AUJ14370.1|467973_468819_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11384.1|469235_469445_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11385.1|469528_469906_-	transcriptional regulator	NA	NA	NA	NA	NA
AUJ11386.1|470049_470559_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14371.1|470705_471647_-	ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AUJ14372.1|473332_473725_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11387.1|473721_474087_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11388.1|474225_475593_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AUJ11389.1|475586_476036_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11390.1|476068_476554_-	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
AUJ11391.1|476652_477099_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AUJ11392.1|477910_480235_-	cytochrome C biogenesis protein	NA	NA	NA	NA	NA
AUJ11393.1|480240_480573_-	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
AUJ11394.1|481706_482693_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.0	2.9e-42
AUJ11395.1|482906_485129_-	primosomal protein N'	NA	NA	NA	NA	NA
AUJ11396.1|485597_486623_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14373.1|486675_487209_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11397.1|488826_490203_+	MATE family efflux transporter	NA	NA	NA	NA	NA
AUJ11398.1|490287_492189_+	signal peptide peptidase SppA	NA	A0A291AUM2	Sinorhizobium_phage	27.4	2.8e-09
AUJ11399.1|492376_492589_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11400.1|492695_493472_+	tropinone reductase	NA	NA	NA	NA	NA
AUJ11401.1|493633_494308_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11402.1|494304_495066_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11403.1|495278_495842_-|tRNA	tRNA threonylcarbamoyladenosine biosynthesis protein RimN	tRNA	NA	NA	NA	NA
AUJ11404.1|495852_498345_-	DNA topoisomerase I	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	35.3	1.9e-114
AUJ11405.1|498527_499802_-	RDD family protein	NA	NA	NA	NA	NA
AUJ11406.1|499843_500566_-	pilus assembly protein PilA	NA	NA	NA	NA	NA
AUJ11407.1|500606_501080_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11408.1|501122_502265_-	DNA-processing protein DprA	NA	NA	NA	NA	NA
AUJ11409.1|502336_503473_-	peptidoglycan-binding protein LysM	NA	G3MBQ1	Bacillus_virus	57.1	1.7e-09
AUJ11410.1|503605_504118_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	2.6e-18
AUJ11411.1|505433_506747_+	16S rRNA (cytosine(967)-C(5))-methyltransferase	NA	NA	NA	NA	NA
AUJ11412.1|506797_508519_+	dolichyl-phosphate-mannose--protein mannosyltransferase	NA	NA	NA	NA	NA
AUJ11413.1|508683_509961_+	polymerase	NA	NA	NA	NA	NA
AUJ11414.1|510158_510983_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AUJ11415.1|510983_512042_+	CDP-glycerol glycerophosphotransferase	NA	NA	NA	NA	NA
AUJ11416.1|512208_513714_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14374.1|513710_514220_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11417.1|514329_515463_-	GTP cyclohydrolase	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.1e-28
AUJ11418.1|515705_516227_+	N-acetyltransferase	NA	NA	NA	NA	NA
AUJ11419.1|516425_517340_-	lipid A biosynthesis lauroyl acyltransferase	NA	NA	NA	NA	NA
AUJ11420.1|517440_517881_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
AUJ11421.1|517989_519864_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
AUJ11422.1|520056_520377_+	hypothetical protein	NA	NA	NA	NA	NA
520883:520927	attL	CTCATAATCCTTTGGTTGAAGGTTCGAATCCTTCTGGGCCCACCA	NA	NA	NA	NA
AUJ11423.1|520996_522184_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	50.5	6.0e-111
AUJ11424.1|522183_522408_-	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	71.4	6.1e-17
AUJ11425.1|522404_522611_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11426.1|522607_522880_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14376.1|522876_523026_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11427.1|523118_523394_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14375.1|523386_523542_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11428.1|523555_523966_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11429.1|524191_524470_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14377.1|524466_524685_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14378.1|524993_527666_-	bifunctional DNA primase/helicase	NA	V9IQW5	Stenotrophomonas_phage	69.7	0.0e+00
AUJ11430.1|527699_527912_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11431.1|527908_528187_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11432.1|528197_528518_-	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	56.5	6.3e-23
AUJ11433.1|528520_528778_-	DNA-binding protein	NA	A0A2H4JE67	uncultured_Caudovirales_phage	46.4	6.6e-07
AUJ11434.1|528849_529287_+	transcriptional regulator	NA	E5E3P4	Burkholderia_phage	32.0	5.4e-09
AUJ14379.1|529647_529932_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11435.1|529947_530934_-	late control protein	NA	V9IQM7	Stenotrophomonas_phage	54.8	2.5e-94
AUJ11436.1|530930_531332_-	oxidoreductase	NA	V9IQX3	Stenotrophomonas_phage	62.3	6.0e-39
AUJ11437.1|531344_534215_-|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	47.5	6.2e-194
AUJ11438.1|534247_534361_-	hypothetical protein	NA	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
AUJ11439.1|534369_534672_-|tail	phage tail protein	tail	A4PE51	Ralstonia_virus	62.6	6.3e-25
AUJ11440.1|534717_535227_-|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	79.9	1.8e-72
AUJ11441.1|535257_536424_-|tail	phage tail protein	tail	E5FFG9	Burkholderia_phage	62.4	4.6e-132
AUJ11442.1|536435_536795_-|plate	baseplate assembly protein	plate	V9IQW0	Stenotrophomonas_phage	66.1	4.3e-36
AUJ11443.1|536791_537355_-|plate	baseplate assembly protein	plate	Q9ZXL0	Pseudomonas_virus	43.7	3.1e-25
AUJ11444.1|537415_537994_-|tail	phage tail protein	tail	NA	NA	NA	NA
AUJ11445.1|538001_539507_-	hypothetical protein	NA	V9IQX0	Stenotrophomonas_phage	47.0	2.1e-52
AUJ11446.1|539516_540062_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	54.7	3.5e-50
AUJ11447.1|540054_540945_-|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	53.7	7.2e-85
AUJ11448.1|541026_541476_-	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	54.7	1.8e-36
AUJ11449.1|541463_541883_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	65.2	2.0e-40
AUJ11450.1|541879_542368_-	hypothetical protein	NA	A0A1S5NQ26	Burkholderia_phage	52.8	4.2e-26
AUJ11451.1|542367_543009_-	lysozyme	NA	V9IQK6	Stenotrophomonas_phage	60.9	7.9e-49
AUJ11452.1|543005_543281_-	hypothetical protein	NA	V9IQV8	Stenotrophomonas_phage	59.8	3.0e-21
AUJ11453.1|543273_543630_-	hypothetical protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	4.5e-22
AUJ11454.1|543634_543844_-|tail	phage tail protein	tail	K4PAW7	Burkholderia_phage	59.4	5.4e-15
AUJ11455.1|543843_544311_-|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	49.7	9.2e-31
AUJ11456.1|544410_545130_-|terminase	terminase	terminase	Q9ZXM2	Pseudomonas_virus	63.4	2.0e-69
AUJ11457.1|545133_546153_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	70.9	2.1e-136
AUJ11458.1|546199_547042_-|capsid	phage capsid protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	52.6	1.7e-67
AUJ11459.1|547163_548948_+|terminase	terminase	terminase	V9IQL5	Stenotrophomonas_phage	75.1	1.2e-267
AUJ11460.1|548947_549967_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	72.5	4.1e-140
AUJ11461.1|549987_550218_+	hypothetical protein	NA	V9IQK2	Stenotrophomonas_phage	54.8	1.9e-13
AUJ11462.1|550150_550855_+	DNA modification methylase	NA	V9IQV5	Stenotrophomonas_phage	77.8	3.3e-109
AUJ11463.1|550886_551354_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11464.1|551353_552532_-	DNA-binding protein	NA	NA	NA	NA	NA
AUJ11465.1|553262_556022_+	type IV secretion protein Rhs	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.3	1.8e-41
AUJ11466.1|556030_556957_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11467.1|556953_559788_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11468.1|559815_560547_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11469.1|560573_562916_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11470.1|562941_563682_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11471.1|564858_565845_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	40.5	2.9e-42
563875:563919	attR	CTCATAATCCTTTGGTTGAAGGTTCGAATCCTTCTGGGCCCACCA	NA	NA	NA	NA
AUJ11472.1|565697_565961_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
CP019091	Xanthomonas oryzae pv. oryzae strain MAI134 chromosome, complete genome	4730142	585025	665497	4730142	transposase	Leptospira_phage(25.0%)	48	NA	NA
AUJ11485.1|585025_585994_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
AUJ11486.1|589119_590193_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	47.9	4.3e-84
AUJ11487.1|590679_592887_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11488.1|596578_597097_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11489.1|597258_600084_+	bifunctional glutamine synthetase adenylyltransferase/deadenyltransferase	NA	NA	NA	NA	NA
AUJ11490.1|600179_600740_-	hypothetical protein	NA	A0A2I7SAW6	Vibrio_phage	29.6	5.1e-12
AUJ11491.1|601305_601731_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11492.1|601734_602370_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ11493.1|604861_605362_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11494.1|606254_607202_-	nucleoside-diphosphate sugar epimerase	NA	NA	NA	NA	NA
AUJ11495.1|607336_607927_+	nitroreductase family protein	NA	NA	NA	NA	NA
AUJ11496.1|608137_608932_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
AUJ11497.1|611238_613926_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
AUJ11498.1|614089_615058_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	2.8e-98
AUJ14382.1|615250_616267_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	3.3e-49
AUJ11499.1|616313_617255_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14383.1|617264_618281_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	3.3e-49
AUJ11500.1|618327_619269_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11501.1|619272_619596_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11502.1|620693_621680_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-43
AUJ11503.1|621532_621796_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ11504.1|621840_622071_-	hypothetical protein	NA	A0A077SK28	Escherichia_phage	58.0	5.4e-08
AUJ11505.1|622120_625948_+	avirulence protein	NA	NA	NA	NA	NA
AUJ14384.1|626039_626432_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ11506.1|626325_626850_+	hypothetical protein	NA	S5WIU1	Leptospira_phage	43.3	3.9e-22
AUJ11507.1|627013_628597_-	oxidoreductase	NA	M1NLX1	Moumouvirus	27.5	6.5e-36
AUJ11508.1|628987_629179_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14385.1|631679_633992_-	S9 family peptidase	NA	NA	NA	NA	NA
AUJ11509.1|635907_636999_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14386.1|637963_638872_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUJ11510.1|639039_639915_+	EamA family transporter	NA	NA	NA	NA	NA
AUJ11511.1|640192_641965_-	cellulase	NA	NA	NA	NA	NA
AUJ11512.1|642362_644063_-	1,4-beta-cellobiosidase	NA	NA	NA	NA	NA
AUJ11513.1|645076_645346_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ11514.1|645198_646185_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.0	2.2e-42
AUJ11515.1|646425_647802_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
AUJ14387.1|647888_648884_-	type III secretion system effector protein	NA	NA	NA	NA	NA
AUJ11516.1|649129_650041_+	magnesium transporter	NA	NA	NA	NA	NA
AUJ14388.1|650244_650511_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11517.1|650636_650921_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11518.1|651250_651697_+	autotransporter	NA	NA	NA	NA	NA
AUJ11519.1|652244_653927_-	alpha,alpha-trehalase	NA	NA	NA	NA	NA
AUJ11520.1|654179_654965_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11521.1|656208_657213_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14389.1|657251_658193_-	histidine kinase	NA	NA	NA	NA	NA
AUJ11522.1|658728_661608_-	peptidase M16	NA	NA	NA	NA	NA
AUJ11523.1|661860_664443_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	29.2	3.2e-08
AUJ11524.1|665020_665497_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 7
CP019091	Xanthomonas oryzae pv. oryzae strain MAI134 chromosome, complete genome	4730142	695455	752450	4730142	protease,tail,transposase,tRNA	Synechococcus_phage(14.29%)	46	NA	NA
AUJ11543.1|695455_695932_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ11544.1|696594_697146_+	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
AUJ11545.1|697249_698617_+|protease	ATP-dependent protease ATP-binding subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	29.5	4.7e-43
AUJ11546.1|698819_699275_-|tRNA	tRNA-specific adenosine deaminase	tRNA	NA	NA	NA	NA
AUJ11547.1|699271_699775_-	drug:proton antiporter	NA	NA	NA	NA	NA
AUJ11548.1|699851_700940_-	hemolysin secretion protein D	NA	NA	NA	NA	NA
AUJ14394.1|700936_702586_-	MFS transporter	NA	NA	NA	NA	NA
AUJ11549.1|702672_703434_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase	NA	NA	NA	NA	NA
AUJ11550.1|703606_704497_+	diguanylate cyclase	NA	NA	NA	NA	NA
AUJ11551.1|704618_706631_+	aminopeptidase	NA	NA	NA	NA	NA
AUJ11552.1|706803_707523_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11553.1|707822_708446_+	HAD family hydrolase	NA	NA	NA	NA	NA
AUJ11554.1|708557_709490_-	carbohydrate kinase family protein	NA	NA	NA	NA	NA
AUJ11555.1|709765_710812_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	21.2	2.7e-06
AUJ11556.1|710984_712325_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AUJ11557.1|712321_712807_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AUJ11558.1|712810_714871_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
AUJ11559.1|714867_715986_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
AUJ11560.1|715898_716105_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11561.1|716463_717495_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.3e-74
AUJ11562.1|718788_720180_+	endopolygalacturonase	NA	NA	NA	NA	NA
AUJ11563.1|720448_721588_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
AUJ11564.1|721584_723000_+	hypothetical protein	NA	F5B3X9	Synechococcus_phage	50.6	4.3e-15
AUJ11565.1|723501_724707_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	40.9	1.6e-66
AUJ11566.1|725006_725660_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11567.1|725786_726065_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11568.1|726052_726751_+	octanoyltransferase	NA	NA	NA	NA	NA
AUJ11569.1|726765_727779_+	lipoyl synthase	NA	NA	NA	NA	NA
AUJ11570.1|728178_730362_+|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	31.4	3.7e-82
AUJ11571.1|730652_731519_-	endonuclease	NA	NA	NA	NA	NA
AUJ11572.1|731680_732736_+	ADP-ribose pyrophosphatase	NA	A0A1B0V161	Roseobacter_phage	47.1	2.9e-80
AUJ11573.1|732858_734262_+	nicotinate phosphoribosyltransferase	NA	A0A218M332	Acidovorax_phage	52.6	6.6e-133
AUJ11574.1|736445_737243_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11575.1|737367_737748_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11576.1|737919_739257_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11577.1|739277_740219_+	6-phosphogluconate dehydrogenase (decarboxylating)	NA	A9NI29	Synechococcus_phage	45.8	3.8e-68
AUJ14395.1|741776_742139_+	BON domain-containing protein	NA	NA	NA	NA	NA
AUJ11578.1|742423_744235_+	histidine kinase	NA	A0A2K9L0Z8	Tupanvirus	27.8	3.5e-09
AUJ11579.1|744231_744672_+	two-component system response regulator	NA	NA	NA	NA	NA
AUJ11580.1|744675_746178_+	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L5I4	Tupanvirus	26.9	4.9e-09
AUJ11581.1|746269_746785_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AUJ11582.1|746953_747691_-	pteridine reductase	NA	NA	NA	NA	NA
AUJ11583.1|747758_748943_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUJ11584.1|750038_750233_-	hypothetical protein	NA	U5P4I9	Shigella_phage	49.0	6.5e-07
AUJ11585.1|750343_751237_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.9	4.1e-96
AUJ11586.1|751481_752450_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	2.8e-98
>prophage 8
CP019091	Xanthomonas oryzae pv. oryzae strain MAI134 chromosome, complete genome	4730142	775339	830775	4730142	tRNA,transposase	Staphylococcus_phage(31.25%)	47	NA	NA
AUJ11600.1|775339_775963_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	41.4	1.2e-33
AUJ11601.1|775995_777228_-|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	K4IEX3	Salmonella_phage	41.5	2.3e-73
AUJ14396.1|779443_779800_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11602.1|779839_780532_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14397.1|782626_783364_-	endonuclease	NA	NA	NA	NA	NA
AUJ11603.1|783413_784229_-	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AUJ11604.1|784320_784971_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AUJ14398.1|785064_785805_-	cytochrome C	NA	NA	NA	NA	NA
AUJ11605.1|786006_786630_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
AUJ14399.1|786723_787419_-	nodulin 21	NA	NA	NA	NA	NA
AUJ11606.1|787634_788999_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AUJ11607.1|789185_790688_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.8	1.0e-14
AUJ11608.1|790684_791404_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUJ11609.1|791542_792643_+	glycosyltransferase	NA	A0A142BZU7	Faustovirus	28.5	1.7e-14
AUJ11610.1|793778_794054_+	regulator	NA	NA	NA	NA	NA
AUJ11611.1|794118_795228_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.4	3.8e-35
AUJ11612.1|795296_795872_+	S-(hydroxymethyl)glutathione synthase	NA	NA	NA	NA	NA
AUJ11613.1|795931_796762_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AUJ11614.1|796891_797101_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11615.1|797152_798121_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
AUJ11616.1|798294_798771_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11617.1|798767_799112_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11618.1|799287_800949_-	energy-dependent translational throttle protein EttA	NA	A0A1B0RXA0	Streptococcus_phage	28.6	1.3e-39
AUJ11619.1|801174_801672_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11620.1|802342_804673_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUJ11621.1|804858_806112_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.7	1.2e-101
AUJ11622.1|806125_806641_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11623.1|806640_807165_+	NrdR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ14400.1|807170_807647_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUJ11624.1|807643_808753_+	riboflavin biosynthesis protein RibD	NA	A0A1V0SE20	Indivirus	35.4	9.1e-45
AUJ11625.1|809992_810595_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	36.0	3.9e-26
AUJ11626.1|810591_811731_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	34.0	6.1e-52
AUJ11627.1|812044_812509_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	40.3	2.2e-24
AUJ11628.1|812505_812976_+	N utilization substance protein B	NA	NA	NA	NA	NA
AUJ11629.1|813196_814171_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
AUJ11630.1|814192_814615_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ11631.1|814580_815057_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ11632.1|817005_818358_+	type III secretion system effector protein	NA	NA	NA	NA	NA
AUJ11633.1|818807_818900_+	K+-transporting ATPase subunit F	NA	NA	NA	NA	NA
AUJ11634.1|818915_820709_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AUJ11635.1|820721_822770_+	potassium-transporting ATPase subunit B	NA	E4ZFI9	Streptococcus_phage	28.2	1.7e-36
AUJ11636.1|822810_823440_+	potassium-transporting ATPase C chain	NA	NA	NA	NA	NA
AUJ11637.1|823490_826151_+	two-component sensor histidine kinase	NA	B5LWN0	Feldmannia_species_virus	28.1	1.6e-10
AUJ11638.1|826140_826857_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUJ11639.1|828443_829460_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.3	1.6e-48
AUJ11640.1|829677_829860_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ14401.1|829929_830775_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	40.5	1.6e-41
>prophage 9
CP019091	Xanthomonas oryzae pv. oryzae strain MAI134 chromosome, complete genome	4730142	838020	909654	4730142	protease,transposase,tRNA	Leptospira_phage(20.0%)	56	NA	NA
AUJ11644.1|838020_838290_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ11645.1|838930_839917_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.0	2.9e-42
AUJ11646.1|839769_840033_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ14402.1|840354_840537_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ11647.1|842105_843491_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AUJ14403.1|843487_844027_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11648.1|844056_844425_-	YraN family protein	NA	NA	NA	NA	NA
AUJ11649.1|844429_846160_-	LppC family lipoprotein	NA	NA	NA	NA	NA
AUJ11650.1|846241_847063_+	rRNA (cytidine-2'-O-)-methyltransferase	NA	M1PLC5	Streptococcus_phage	38.3	9.5e-39
AUJ14404.1|848478_848703_-	plasmid maintenance protein CcdB	NA	NA	NA	NA	NA
AUJ11651.1|848778_849546_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11652.1|849860_850316_+	cell division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
AUJ14405.1|850360_851374_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase	NA	NA	NA	NA	NA
AUJ11653.1|851370_851634_+	cell division protein FtsL	NA	NA	NA	NA	NA
AUJ11654.1|851767_853645_+	cell division protein	NA	NA	NA	NA	NA
AUJ11655.1|853641_855129_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
AUJ11656.1|855125_856637_+	UDP-N-acetylmuramoylalanyl-D-glutamyl-2, 6-diaminopimelate--D-alanyl-D-alanine ligase	NA	NA	NA	NA	NA
AUJ11657.1|856626_857712_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
AUJ11658.1|859080_860406_+	UDP-N-acetylglucosamine--N-acetylmuramyl- (pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase	NA	NA	NA	NA	NA
AUJ11659.1|860402_861836_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
AUJ11660.1|861832_862789_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
AUJ11661.1|862913_863735_+	cell division protein FtsQ	NA	NA	NA	NA	NA
AUJ11662.1|863731_864967_+	cell division protein FtsA	NA	NA	NA	NA	NA
AUJ11663.1|865276_866521_+	cell division protein FtsZ	NA	NA	NA	NA	NA
AUJ11664.1|866748_867660_+	UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
AUJ11665.1|867846_868293_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11666.1|868293_869235_+	peptidase M23	NA	A0A292GJG6	Xanthomonas_phage	45.7	7.8e-29
AUJ11667.1|869391_872130_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
AUJ11668.1|872595_872964_+	glyoxalase	NA	NA	NA	NA	NA
AUJ11669.1|873104_874052_+	DNA mismatch repair protein MutT	NA	NA	NA	NA	NA
AUJ11670.1|874237_874867_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11671.1|875234_876062_-	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
AUJ11672.1|876101_877481_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11673.1|877971_878949_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
AUJ14406.1|879185_880943_+|protease	protease	protease	NA	NA	NA	NA
AUJ11674.1|881022_881205_-	glyoxalase	NA	NA	NA	NA	NA
AUJ11675.1|881805_882741_+	D-galactose 1-dehydrogenase	NA	NA	NA	NA	NA
AUJ11676.1|882895_883864_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AUJ11677.1|885049_885595_+	nucleoprotein/polynucleotide-associated enzyme	NA	NA	NA	NA	NA
AUJ11678.1|885824_886382_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11679.1|886621_887590_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
AUJ11680.1|887692_888379_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11681.1|888871_889804_+	sulfotransferase	NA	A0A1X9T5H0	Ranid_herpesvirus	36.4	1.2e-05
AUJ14407.1|889835_890618_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUJ11682.1|890847_892290_-	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	30.9	1.1e-47
AUJ11683.1|892602_893148_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11684.1|893341_896056_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
AUJ11685.1|896115_896751_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ14408.1|896884_897901_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.3	2.1e-48
AUJ11686.1|898111_899098_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-43
AUJ11687.1|898950_899214_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ14409.1|900547_903319_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUJ11688.1|903308_904907_+	phosphoanhydride phosphohydrolase	NA	NA	NA	NA	NA
AUJ11689.1|905252_906464_-	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	57.6	6.1e-119
AUJ11690.1|906708_907809_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11691.1|908655_909654_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
>prophage 10
CP019091	Xanthomonas oryzae pv. oryzae strain MAI134 chromosome, complete genome	4730142	1073862	1170210	4730142	protease,holin,transposase	Bacillus_phage(18.18%)	81	NA	NA
AUJ11835.1|1073862_1074831_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
AUJ11836.1|1076725_1078099_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11837.1|1078197_1080237_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
AUJ11838.1|1080444_1081467_-	NADPH:quinone reductase	NA	NA	NA	NA	NA
AUJ14423.1|1081440_1081635_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11839.1|1081882_1082980_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11840.1|1083172_1083682_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11841.1|1083701_1084562_+	pseudouridylate synthase	NA	NA	NA	NA	NA
AUJ11842.1|1084512_1084905_-	HNH endonuclease	NA	NA	NA	NA	NA
AUJ11843.1|1084907_1086116_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.5	1.7e-20
AUJ14424.1|1086287_1087304_+	sulfate transporter subunit	NA	NA	NA	NA	NA
AUJ11844.1|1087307_1088168_+	sulfate ABC transporter permease subunit CysT	NA	NA	NA	NA	NA
AUJ11845.1|1088164_1089118_+	sulfate ABC transporter permease subunit CysW	NA	NA	NA	NA	NA
AUJ14425.1|1089125_1090160_+	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	2.0e-25
AUJ11846.1|1090518_1091238_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14426.1|1091307_1092330_-	L-threonine 3-dehydrogenase	NA	NA	NA	NA	NA
AUJ11847.1|1092845_1095179_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AUJ11848.1|1095353_1097435_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
AUJ11849.1|1097443_1097920_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ11850.1|1098453_1100604_+	dipeptidyl-peptidase 7	NA	NA	NA	NA	NA
AUJ11851.1|1100696_1101341_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
AUJ11852.1|1102311_1103610_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AUJ11853.1|1103677_1104775_+	sporulation protein	NA	NA	NA	NA	NA
AUJ11854.1|1104989_1105736_+	colicin V synthesis protein	NA	NA	NA	NA	NA
AUJ11855.1|1105766_1107233_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.1	8.3e-86
AUJ14427.1|1107371_1108196_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11856.1|1109325_1109745_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11857.1|1109924_1110668_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
AUJ11858.1|1111301_1111844_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AUJ11859.1|1111824_1112961_-	glycosyl transferase	NA	NA	NA	NA	NA
AUJ11860.1|1113165_1114692_-	exopolyphosphatase	NA	NA	NA	NA	NA
AUJ11861.1|1114864_1116967_-	RNA degradosome polyphosphate kinase	NA	NA	NA	NA	NA
AUJ11862.1|1117070_1118414_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	33.3	8.5e-29
AUJ11863.1|1118471_1119161_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.7	5.9e-34
AUJ11864.1|1119335_1120982_-	peptidase	NA	NA	NA	NA	NA
AUJ11865.1|1121131_1121440_+	glutaredoxin 3	NA	A0A2L0UZG6	Agrobacterium_phage	43.2	4.7e-07
AUJ11866.1|1121436_1121832_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AUJ11867.1|1122046_1123054_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
AUJ11868.1|1123195_1123957_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11869.1|1125588_1125828_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11870.1|1126776_1127046_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ11871.1|1126898_1127885_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-43
AUJ11872.1|1127881_1128298_-	histidine kinase	NA	NA	NA	NA	NA
AUJ11873.1|1128836_1130129_+	trigger factor	NA	NA	NA	NA	NA
AUJ11874.1|1130221_1130848_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
AUJ11875.1|1130972_1132259_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
AUJ11876.1|1132402_1134874_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	9.9e-225
AUJ11877.1|1135087_1135360_+	DNA-binding protein HU	NA	A7KV42	Bacillus_phage	64.0	2.2e-21
AUJ11878.1|1135974_1137942_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AUJ11879.1|1138633_1139812_-	lytic transglycosylase	NA	NA	NA	NA	NA
AUJ11880.1|1139808_1140576_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AUJ11881.1|1140588_1141245_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11882.1|1141272_1141725_+	ribonuclease HI	NA	A0A1Q2U2R0	Vibrio_phage	55.4	2.8e-40
AUJ11883.1|1141733_1142468_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.6	1.1e-35
AUJ11884.1|1142902_1143607_-	protein phosphatase	NA	NA	NA	NA	NA
AUJ11885.1|1144352_1144730_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11886.1|1146551_1146956_+	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	35.9	5.0e-17
AUJ11887.1|1147166_1148216_-	ADP-heptose--LPS heptosyltransferase	NA	NA	NA	NA	NA
AUJ11888.1|1148236_1148986_+	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
AUJ11889.1|1148985_1149735_+	MBL fold metallo-hydrolase	NA	A0A0A0RUN7	Bacillus_phage	26.0	4.2e-09
AUJ11890.1|1149734_1150766_+	cyclic pyranopterin phosphate synthase MoaA	NA	NA	NA	NA	NA
AUJ11891.1|1150762_1151143_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AUJ14428.1|1151168_1151654_+	cyclic pyranopterin monophosphate synthase accessory protein	NA	NA	NA	NA	NA
AUJ11892.1|1151662_1151908_+	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
AUJ11893.1|1151904_1152354_+	molybdopterin-converting factor chain 2	NA	NA	NA	NA	NA
AUJ11894.1|1152799_1153654_-|transposase	transposase	transposase	U5P429	Shigella_phage	58.1	1.7e-86
AUJ14429.1|1153671_1153776_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ11895.1|1153965_1154952_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-43
AUJ11896.1|1154961_1155441_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11897.1|1155811_1157908_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	40.7	2.4e-46
AUJ11898.1|1157914_1158235_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AUJ11899.1|1158332_1158926_+	recombination protein RecR	NA	NA	NA	NA	NA
AUJ11900.1|1159027_1159378_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
AUJ11901.1|1159497_1160031_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11902.1|1160030_1161980_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11903.1|1161972_1162929_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ11904.1|1162934_1163888_-	ATPase	NA	NA	NA	NA	NA
AUJ11905.1|1163913_1165794_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ11906.1|1165919_1166888_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
AUJ11907.1|1167079_1168048_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
AUJ14430.1|1169193_1170210_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.2e-48
>prophage 11
CP019091	Xanthomonas oryzae pv. oryzae strain MAI134 chromosome, complete genome	4730142	1320421	1400201	4730142	transposase	Ralstonia_phage(23.08%)	60	NA	NA
AUJ12005.1|1320421_1321408_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.9e-42
AUJ12006.1|1321492_1321750_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14449.1|1322279_1322906_-	hypothetical protein	NA	S0A0S0	Cellulophaga_phage	41.3	6.8e-29
AUJ12007.1|1323246_1324263_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.2e-48
AUJ12008.1|1326270_1327707_-	type IV secretion protein Rhs	NA	NA	NA	NA	NA
AUJ12009.1|1328541_1331436_-	calcium-binding protein	NA	A0A2D1GNI0	Pseudomonas_phage	27.9	5.7e-06
AUJ12010.1|1331460_1333998_-	type IV secretion protein Rhs	NA	NA	NA	NA	NA
AUJ14450.1|1334008_1334797_-	type VI secretion system protein ImpK	NA	NA	NA	NA	NA
AUJ12011.1|1334796_1336131_-	type VI secretion system-associated protein	NA	NA	NA	NA	NA
AUJ12012.1|1336282_1336891_-	type VI secretion system-associated lipoprotein	NA	NA	NA	NA	NA
AUJ12013.1|1337810_1338311_+	type VI secretion system-associated protein	NA	NA	NA	NA	NA
AUJ12014.1|1338314_1339811_+	EvpB family type VI secretion protein	NA	NA	NA	NA	NA
AUJ12015.1|1339952_1340450_+	Hcp family protein	NA	NA	NA	NA	NA
AUJ12016.1|1340597_1341086_+	type VI secretion protein	NA	NA	NA	NA	NA
AUJ12017.1|1341088_1342924_+	type VI secretion protein	NA	NA	NA	NA	NA
AUJ12018.1|1342887_1343979_+	type VI secretion protein	NA	NA	NA	NA	NA
AUJ12019.1|1344064_1346797_+	ClpV1 family T6SS ATPase	NA	A0A223W0B1	Agrobacterium_phage	29.6	9.3e-91
AUJ12020.1|1346827_1347181_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ12021.1|1347273_1350036_+	type IV secretion protein Rhs	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.8	5.1e-44
AUJ12022.1|1350010_1350883_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ12023.1|1350902_1353770_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ12024.1|1353781_1354807_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ12025.1|1355327_1356392_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
AUJ12026.1|1356406_1356658_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ12027.1|1356959_1358072_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
AUJ12028.1|1358068_1358611_-	shikimate kinase	NA	NA	NA	NA	NA
AUJ12029.1|1358777_1359377_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
AUJ12030.1|1359557_1359974_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ12031.1|1359986_1360760_+	PspA-IM30 family protein	NA	NA	NA	NA	NA
AUJ12032.1|1361869_1362541_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ12033.1|1362578_1362983_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ12034.1|1362995_1363568_+	hypothetical protein	NA	A0A191ZBZ0	Erwinia_phage	28.1	4.9e-10
AUJ12035.1|1363569_1364736_+	hypothetical protein	NA	B2ZXR7	Ralstonia_phage	41.8	9.8e-74
AUJ14451.1|1367675_1369358_+	peptidase M1	NA	NA	NA	NA	NA
AUJ12036.1|1370407_1373554_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUJ12037.1|1373573_1373810_-	transcriptional regulator	NA	NA	NA	NA	NA
AUJ12038.1|1373885_1374638_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AUJ12039.1|1374648_1375695_+	cupin	NA	NA	NA	NA	NA
AUJ12040.1|1375735_1377253_+	tryptophan halogenase	NA	A0A1D7SF58	Cyanophage	31.8	7.6e-50
AUJ12041.1|1377290_1378295_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AUJ12042.1|1378439_1378838_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ12043.1|1378968_1379154_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14452.1|1379406_1380360_-	endoproteinase ArgC	NA	NA	NA	NA	NA
AUJ12044.1|1381259_1382642_-	porin	NA	NA	NA	NA	NA
AUJ12045.1|1382834_1383599_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ12046.1|1383912_1384854_+	amino acid amidase	NA	NA	NA	NA	NA
AUJ12047.1|1385609_1386998_+	amino acid transporter	NA	NA	NA	NA	NA
AUJ12048.1|1387746_1388715_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.6e-98
AUJ14453.1|1389776_1390793_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.6e-48
AUJ12049.1|1390793_1392188_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AUJ12050.1|1392187_1393204_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AUJ14454.1|1393264_1394059_-	phospholipase	NA	NA	NA	NA	NA
AUJ12051.1|1394218_1395580_-	magnesium transporter	NA	NA	NA	NA	NA
AUJ12052.1|1395642_1395867_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ12053.1|1395867_1397598_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	24.1	1.0e-10
AUJ12054.1|1397656_1397926_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AUJ12055.1|1397918_1398311_-	PTS fructose IIA subunit family protein	NA	NA	NA	NA	NA
AUJ12056.1|1398320_1398539_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ12057.1|1398705_1399674_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.5e-99
AUJ12058.1|1399799_1400201_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 12
CP019091	Xanthomonas oryzae pv. oryzae strain MAI134 chromosome, complete genome	4730142	1425494	1490017	4730142	transposase	Ralstonia_phage(30.0%)	56	NA	NA
AUJ14457.1|1425494_1426511_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
AUJ12086.1|1427437_1427767_-	benzene 1,2-dioxygenase	NA	NA	NA	NA	NA
AUJ12087.1|1427763_1428303_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUJ14458.1|1428228_1428450_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ12088.1|1428497_1429742_-	cysteine sulfinate desulfinase	NA	Q2XUY6	environmental_halophage	41.7	5.0e-92
AUJ12089.1|1429738_1431001_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
AUJ12090.1|1431000_1431765_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.5	2.0e-11
AUJ12091.1|1432022_1433480_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
AUJ12092.1|1433495_1433954_-	transcriptional regulator	NA	NA	NA	NA	NA
AUJ12093.1|1434126_1434594_+	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
AUJ12094.1|1434698_1434917_+	peptidase	NA	NA	NA	NA	NA
AUJ12095.1|1435523_1436120_-	DUF1439 domain-containing protein	NA	NA	NA	NA	NA
AUJ12096.1|1436175_1436718_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ12097.1|1436775_1437117_-	DUF3861 domain-containing protein	NA	NA	NA	NA	NA
AUJ14459.1|1437174_1437789_-	peptidase	NA	NA	NA	NA	NA
AUJ12098.1|1437920_1438346_-	DNA-binding protein	NA	NA	NA	NA	NA
AUJ12099.1|1438901_1439900_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
AUJ12100.1|1439805_1440498_-	YggS family pyridoxal phosphate enzyme	NA	NA	NA	NA	NA
AUJ12101.1|1440908_1441328_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ12102.1|1441678_1442716_+	twitching motility protein PilT	NA	NA	NA	NA	NA
AUJ12103.1|1442829_1443960_+	type IV pili twitching motility protein PilT	NA	NA	NA	NA	NA
AUJ14460.1|1444249_1444912_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ12104.1|1445356_1446325_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.5e-99
AUJ12105.1|1447174_1447747_-	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
AUJ12106.1|1447743_1448178_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ12107.1|1449023_1449590_+	DUF179 domain-containing protein	NA	NA	NA	NA	NA
AUJ12108.1|1450062_1451010_+	aspartate carbamoyltransferase	NA	NA	NA	NA	NA
AUJ12109.1|1451446_1451881_+	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AUJ12110.1|1452063_1452633_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ12111.1|1452918_1453800_-	phenazine biosynthesis protein PhzF family	NA	NA	NA	NA	NA
AUJ12112.1|1454892_1457502_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
AUJ12113.1|1457485_1457944_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ12114.1|1457940_1459296_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ12115.1|1459276_1460683_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
AUJ14461.1|1460729_1460903_+	AsmA family protein	NA	NA	NA	NA	NA
AUJ14462.1|1461038_1461821_+	dienelactone hydrolase	NA	NA	NA	NA	NA
AUJ12116.1|1461915_1462884_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	4.3e-99
AUJ12117.1|1463138_1464137_-	octaprenyl-diphosphate synthase	NA	NA	NA	NA	NA
AUJ12118.1|1464412_1464946_+	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	60.9	1.9e-32
AUJ12119.1|1465229_1466714_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.9	8.5e-14
AUJ12120.1|1470226_1470904_+	HAD family hydrolase	NA	NA	NA	NA	NA
AUJ12121.1|1471222_1471411_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ12122.1|1471441_1471666_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ12123.1|1471665_1473738_-	carbon starvation protein A	NA	NA	NA	NA	NA
AUJ12124.1|1473969_1474827_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ12125.1|1474997_1475285_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ12126.1|1475688_1478505_+	type IV secretion protein Rhs	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.4	1.8e-52
AUJ12127.1|1478504_1479401_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ12128.1|1479397_1479862_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14463.1|1479885_1480365_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14464.1|1480707_1481724_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
AUJ14465.1|1482259_1482532_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AUJ12129.1|1483965_1484472_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ12130.1|1487206_1487668_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ12131.1|1487914_1488805_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ12132.1|1489048_1490017_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
>prophage 13
CP019091	Xanthomonas oryzae pv. oryzae strain MAI134 chromosome, complete genome	4730142	1574441	1667005	4730142	tRNA,protease,transposase	Staphylococcus_phage(26.32%)	83	NA	NA
AUJ12184.1|1574441_1577084_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.8	2.3e-171
AUJ12185.1|1577597_1578233_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ12186.1|1578255_1579284_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
AUJ12187.1|1579280_1580180_+	nicotinate-nicotinamide nucleotide adenylyltransferase	NA	NA	NA	NA	NA
AUJ12188.1|1580236_1580653_+	ribosome silencing factor RsfS	NA	NA	NA	NA	NA
AUJ12189.1|1580664_1581780_+	molecular chaperone DnaJ	NA	NA	NA	NA	NA
AUJ12190.1|1582105_1582315_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ12191.1|1582869_1583340_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
AUJ12192.1|1583777_1584452_-	energy transducer TonB	NA	NA	NA	NA	NA
AUJ12193.1|1584762_1587873_-	Oar protein	NA	NA	NA	NA	NA
AUJ12194.1|1588248_1588983_-	SIMPL domain-containing protein	NA	NA	NA	NA	NA
AUJ12195.1|1589121_1589694_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AUJ12196.1|1589693_1591193_+	ribonuclease E/G	NA	NA	NA	NA	NA
AUJ12197.1|1591333_1595254_+	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
AUJ14478.1|1595259_1596012_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ12198.1|1596110_1597556_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AUJ12199.1|1597812_1598394_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ12200.1|1598539_1599907_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
AUJ12201.1|1600056_1600386_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14479.1|1600512_1600902_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ12202.1|1600971_1602069_-|protease	protease	protease	NA	NA	NA	NA
AUJ12203.1|1602533_1603409_-	(2E,6E)-farnesyl diphosphate synthase	NA	NA	NA	NA	NA
AUJ12204.1|1603410_1603671_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
AUJ12205.1|1603702_1605007_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
AUJ12206.1|1605040_1606747_-	alkaline phosphatase	NA	NA	NA	NA	NA
AUJ12207.1|1606888_1608229_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
AUJ14480.1|1608400_1609075_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUJ12208.1|1609321_1609813_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AUJ12209.1|1610020_1610770_-	hypothetical protein	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
AUJ14481.1|1610879_1611452_-	glycoside hydrolase	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.4e-19
AUJ12210.1|1611526_1612006_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AUJ12211.1|1612234_1613479_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ12212.1|1613486_1614737_+	amino acid dehydrogenase	NA	NA	NA	NA	NA
AUJ12213.1|1614733_1616104_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.6	1.2e-33
AUJ14482.1|1616344_1616752_+	cysteine methyltransferase	NA	NA	NA	NA	NA
AUJ12214.1|1616792_1617491_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AUJ14483.1|1618133_1619150_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.6e-48
AUJ12215.1|1619348_1621364_-	peptidase M13	NA	NA	NA	NA	NA
AUJ12216.1|1621806_1622076_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ12217.1|1621928_1622915_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.9e-42
AUJ12218.1|1623993_1624962_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
AUJ14484.1|1625575_1625761_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ12219.1|1625795_1626365_-	deoxycytidine triphosphate deaminase	NA	S5VM63	Pseudomonas_phage	74.9	4.5e-72
AUJ12220.1|1626460_1627312_-	Fe-S-binding ATPase	NA	NA	NA	NA	NA
AUJ12221.1|1627806_1628775_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
AUJ12222.1|1628837_1629425_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ12223.1|1629490_1630459_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
AUJ12224.1|1630618_1630786_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ12225.1|1630813_1631248_-	HIT family protein	NA	NA	NA	NA	NA
AUJ12226.1|1631244_1631907_-	carboxymethylenebutenolidase	NA	NA	NA	NA	NA
AUJ12227.1|1632087_1633452_+	ribosomal protein S12 methylthiotransferase	NA	NA	NA	NA	NA
AUJ14485.1|1634308_1635325_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.1e-48
AUJ12228.1|1635240_1635471_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ12229.1|1635467_1635980_-	transcription elongation factor GreB	NA	NA	NA	NA	NA
AUJ12230.1|1636167_1636437_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ12231.1|1636289_1637276_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.0	2.2e-42
AUJ12232.1|1637682_1639188_-	ATP-binding protein	NA	A0A248XCZ8	Klebsiella_phage	45.4	5.5e-85
AUJ12233.1|1639377_1639563_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14486.1|1639647_1641066_+	lytic transglycosylase	NA	I1VXB7	Halocynthia_phage	30.6	4.2e-10
AUJ12234.1|1641615_1642464_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
AUJ12235.1|1642460_1643111_-	SCO family protein	NA	NA	NA	NA	NA
AUJ12236.1|1643191_1644118_+	ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AUJ12237.1|1644128_1645232_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	40.7	1.4e-74
AUJ12238.1|1645224_1646298_+	D-glycerate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	24.1	1.2e-14
AUJ12239.1|1646381_1647407_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUJ12240.1|1647980_1649933_+	ferrous iron transporter B	NA	NA	NA	NA	NA
AUJ12241.1|1649929_1650337_+	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
AUJ12242.1|1650509_1651283_+|tRNA	tRNA pseudouridine(38-40) synthase	tRNA	NA	NA	NA	NA
AUJ12243.1|1651279_1651948_+	N-(5'-phosphoribosyl)anthranilate isomerase	NA	NA	NA	NA	NA
AUJ12244.1|1652344_1653271_-	transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.1	3.0e-09
AUJ12245.1|1653376_1654594_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AUJ12246.1|1655040_1655847_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AUJ12247.1|1656170_1657058_+	acetyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
AUJ12248.1|1657054_1658404_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AUJ12249.1|1658526_1659465_+	flavonol synthase	NA	NA	NA	NA	NA
AUJ12250.1|1659674_1660358_+	methylamine utilization protein	NA	NA	NA	NA	NA
AUJ12251.1|1660354_1662721_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AUJ12252.1|1662717_1663590_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ12253.1|1663589_1664018_+	group 1 truncated hemoglobin	NA	NA	NA	NA	NA
AUJ12254.1|1664368_1665349_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.1	1.2e-45
AUJ14487.1|1665358_1666375_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
AUJ12255.1|1666368_1666563_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ12256.1|1666528_1667005_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 14
CP019091	Xanthomonas oryzae pv. oryzae strain MAI134 chromosome, complete genome	4730142	1690531	1766491	4730142	tRNA,integrase,transposase	Ralstonia_phage(33.33%)	55	1703147:1703206	1766494:1767652
AUJ12275.1|1690531_1691458_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
AUJ12276.1|1691614_1691875_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
AUJ12277.1|1692041_1694156_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
AUJ12278.1|1694529_1695570_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ12279.1|1695633_1696509_-	nicotinate-nucleotide diphosphorylase (carboxylating)	NA	NA	NA	NA	NA
AUJ12280.1|1696505_1696775_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ12281.1|1696833_1697337_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	38.7	3.6e-17
AUJ12282.1|1697333_1698479_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AUJ12283.1|1698620_1699199_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	39.6	4.9e-34
AUJ12284.1|1699320_1699641_+	monothiol glutaredoxin, Grx4 family	NA	NA	NA	NA	NA
AUJ12285.1|1699637_1700381_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUJ12286.1|1700377_1700977_+	hypothetical protein	NA	NA	NA	NA	NA
1703147:1703206	attL	GGAACCTCTGAACAACGCACCACAAATGCGAGACACTATTTGTTCGGAATGAGGAGGCAT	NA	NA	NA	NA
AUJ12287.1|1703208_1704177_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.1e-99
AUJ12288.1|1706210_1707596_+	LOG family protein	NA	NA	NA	NA	NA
AUJ12289.1|1707765_1708281_+	pre-pilin like leader sequence	NA	A0A1W6JT76	Pseudomonas_phage	42.5	1.1e-05
AUJ12290.1|1708277_1708754_+	type IV pilus modification protein PilV	NA	NA	NA	NA	NA
AUJ12291.1|1708750_1709917_+	pilus assembly protein PilW	NA	NA	NA	NA	NA
AUJ14491.1|1710385_1714387_+	pilus assembly protein	NA	NA	NA	NA	NA
AUJ12292.1|1714399_1714849_+	pilus assembly protein PilE	NA	NA	NA	NA	NA
AUJ12293.1|1715025_1715568_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
AUJ12294.1|1715706_1717728_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AUJ12295.1|1718255_1719242_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.0	2.9e-42
AUJ14492.1|1719523_1719958_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ12296.1|1720381_1721476_-	acyltransferase	NA	NA	NA	NA	NA
AUJ12297.1|1721935_1723603_-	urocanate hydratase	NA	NA	NA	NA	NA
AUJ12298.1|1723619_1724477_-	N-formylglutamate deformylase	NA	NA	NA	NA	NA
AUJ12299.1|1724661_1726203_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	42.8	2.7e-79
AUJ12300.1|1726216_1727422_-	imidazolonepropionase	NA	NA	NA	NA	NA
AUJ12301.1|1727497_1728853_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
AUJ12302.1|1729206_1729911_+	histidine utilization repressor	NA	NA	NA	NA	NA
AUJ12303.1|1730067_1731072_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ12304.1|1731645_1732209_-	poly(hydroxyalcanoate) granule associated protein	NA	NA	NA	NA	NA
AUJ12305.1|1732370_1732646_-	polyhydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
AUJ14493.1|1732886_1733696_+	FHA domain-containing protein	NA	NA	NA	NA	NA
AUJ12306.1|1733637_1734294_-	sulfoxide reductase heme-binding subunit YedZ	NA	NA	NA	NA	NA
AUJ12307.1|1734594_1735563_-	mononuclear molybdenum enzyme YedY	NA	NA	NA	NA	NA
AUJ12308.1|1735737_1736823_+	phosphoserine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	1.7e-75
AUJ12309.1|1736905_1738114_+	chorismate mutase	NA	NA	NA	NA	NA
AUJ12310.1|1738235_1739549_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AUJ12311.1|1739912_1740389_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ12312.1|1740526_1741495_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
AUJ14494.1|1742058_1742526_-	energy transducer TonB	NA	NA	NA	NA	NA
AUJ12313.1|1742886_1743654_-	energy transducer TonB	NA	NA	NA	NA	NA
AUJ12314.1|1743660_1745052_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	49.6	1.0e-93
AUJ12315.1|1745489_1746458_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
AUJ12316.1|1746673_1747258_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AUJ12317.1|1747357_1748374_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ12318.1|1748925_1749693_+|integrase	integrase	integrase	NA	NA	NA	NA
AUJ12319.1|1749689_1750676_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	40.6	2.2e-42
AUJ12320.1|1750882_1754410_-	avirulence protein	NA	NA	NA	NA	NA
AUJ14495.1|1760286_1760631_-	response regulator	NA	NA	NA	NA	NA
AUJ12321.1|1760933_1762451_+	circadian clock protein KaiC	NA	NA	NA	NA	NA
AUJ12322.1|1762437_1762992_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ12323.1|1762999_1763476_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ12324.1|1765522_1766491_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.1e-99
1766494:1767652	attR	ATGCCTCCTCATTCCGAACAAATAGTGTCTCGCATTTGTGGTGCGTTGTTCAGAGGTTCCCTAGGCGTGGACAACGCACGGCAACCTGCTACTTGCCTAATGCGCGCGCTGTTCAATCGGCATAGCGTGGTAGCCATCGCGCATTAGGCCCAGCCGCGCAGGAGCCGCCTGCGTCACCGCGCGCCACGCTCGGACCGCCGCGCACTGCCCATCGATTCGGCTACCGCGATCTTGTCTGCCACCGCTTTCTGCATTGGCGAGCCGGTCTCCAGCAAGCCATGCAGATGGCGCCAATGTGCGGTGGCCGCGGTGAAGTCTTGCTGCTGAAAATCGCTGATGCCCAGTAACCACAAACCGCGCTGATTGTCCGGCTCGCGGGCGATCACGTGCTGCAATCTTGCGCGCGACGCGGCATCGATGGCGAAGTCGCTGTGCGTGGCCATATCTGCCGCCACCCAGCCGACAATGGCGGCGCTGATGTCGGGTGCGATCCTGAGCGCTTGCGCATAGGCCTCACGCGCGTCGGCGGGGCGATCGTTGTGCTCGTCCGTTTTGGCCTGCTGCATCCAGCGTTCCAGCGCTTGTTCCTGCCTGTCGTCAGCGGTGCTCGCAGCCTGCGCCTGCCCGGCAGCAGCTGGTGGTGCCACTGCTTCGGCTTGCGGTGGCCGCGCTGCATACACGTGCGTGGCCATCGCCTCCGGCGCGCCCACCAGCCGGTATAAACCGGCCGTGGCCAGCGGCAGGCCGAGGACCAGCAGGATCGGCAAGCTGTAGCGCGCGTTGCCAGTACCGGTGGGCCGGCGCAGCAGCGGCACCAACAACAGCAGCAACGCCAACGCCACCAACGCTGCGCTTGCGACATAAAAACCCATCATCACCACTCTTCCTCAGCCTGAGGCGCCACCGGTGTCCCGATGCGCGCACGTTTGCGCACGGTGTGGATCACCACGCCCGCACCACCAGCCAACATCAGCGCCGGCCCGAACCACAGCAACCAGGTGCCGCGCTTGACCGGTGGGTCGTACAGCACGAAATCCGAATAGCGCTCGACCATGTATTGCTTGATCTGCGCATCGCTCTTGCCGGCCTGCAGCTGCGCGAACACCTGATGCCGCAAGTCGCGCGCGAGGCTGGCGTTGGAATCGGCGAGGTTTTCGTT	NA	NA	NA	NA
>prophage 15
CP019091	Xanthomonas oryzae pv. oryzae strain MAI134 chromosome, complete genome	4730142	1831468	1841345	4730142	tRNA	Escherichia_phage(28.57%)	9	NA	NA
AUJ14508.1|1831468_1833145_+	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.5	2.5e-38
AUJ12377.1|1833233_1833875_+	LexA repressor 2	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
AUJ12378.1|1834047_1835082_+	DNA recombination/repair protein RecA	NA	A0A0S2MVG1	Bacillus_phage	61.0	1.6e-112
AUJ14509.1|1835383_1835872_+	recombination regulator RecX	NA	NA	NA	NA	NA
AUJ12379.1|1835973_1838622_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.8	2.4e-83
AUJ12380.1|1838761_1838974_+	carbon storage regulator	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
AUJ12381.1|1839451_1839688_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ12382.1|1840717_1840972_+	hypothetical protein	NA	A0A0N7C1X7	Escherichia_phage	59.6	4.5e-08
AUJ12383.1|1840886_1841345_+	lysozyme	NA	D5LH07	Escherichia_phage	69.1	4.0e-55
>prophage 16
CP019091	Xanthomonas oryzae pv. oryzae strain MAI134 chromosome, complete genome	4730142	2140335	2198526	4730142	tRNA,protease,transposase	Ralstonia_phage(33.33%)	48	NA	NA
AUJ12594.1|2140335_2141472_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AUJ12595.1|2141468_2141927_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AUJ12596.1|2142177_2142498_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.3e-12
AUJ12597.1|2142641_2144924_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.6	5.1e-175
AUJ12598.1|2145131_2145350_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AUJ14531.1|2145430_2146183_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AUJ12599.1|2146316_2146946_-	cinnamoyl-CoA reductase	NA	NA	NA	NA	NA
AUJ12600.1|2147621_2148743_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUJ12601.1|2148800_2149769_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	2.0e-64
AUJ12602.1|2150052_2152410_+	cell division protein FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
AUJ12603.1|2152572_2154501_+	transglutaminase	NA	NA	NA	NA	NA
AUJ14532.1|2154607_2155237_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AUJ12604.1|2155349_2159516_-	type III effector	NA	NA	NA	NA	NA
AUJ14533.1|2159752_2161129_+	recombination factor protein RarA	NA	G3MBE0	Bacillus_virus	38.1	5.2e-74
AUJ12605.1|2161160_2161487_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ12606.1|2161483_2161891_-	fluoride ion transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	7.5e-21
AUJ12607.1|2161922_2162273_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ12608.1|2162269_2163601_-	voltage-gated chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.2	4.3e-41
AUJ12609.1|2163921_2165127_-	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
AUJ12610.1|2165291_2167664_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUJ12611.1|2167688_2168321_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ12612.1|2168539_2168965_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
AUJ12613.1|2168983_2170189_+	23S rRNA (adenine(2503)-C(2))-methyltransferase	NA	NA	NA	NA	NA
AUJ12614.1|2170199_2170988_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
AUJ12615.1|2170984_2171845_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ12616.1|2171915_2172554_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ12617.1|2172550_2173771_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
AUJ12618.1|2173781_2175179_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
AUJ12619.1|2175493_2176714_+	molybdopterin molybdenumtransferase MoeA	NA	NA	NA	NA	NA
AUJ12620.1|2177205_2178366_-	molybdopterin biosynthesis protein MoeB	NA	NA	NA	NA	NA
AUJ14534.1|2179490_2180231_-	outer membrane or secreted lipoprotein	NA	NA	NA	NA	NA
AUJ12621.1|2180415_2181384_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
AUJ12622.1|2181575_2182544_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
AUJ12623.1|2182735_2183704_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	2.1e-98
AUJ12624.1|2183852_2184242_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ12625.1|2184180_2184558_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ12626.1|2184763_2186017_+	molybdopterin molybdenumtransferase MoeA	NA	NA	NA	NA	NA
AUJ12627.1|2186054_2186624_+	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
AUJ12628.1|2186607_2186970_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ12629.1|2188373_2188568_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUJ12630.1|2189346_2190324_-	siroheme synthase	NA	NA	NA	NA	NA
AUJ12631.1|2191662_2191851_+	nitrate transport ATP-binding protein	NA	NA	NA	NA	NA
AUJ12632.1|2191863_2192139_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ12633.1|2192783_2193041_+	stress-induced protein	NA	NA	NA	NA	NA
AUJ12634.1|2192971_2193190_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ12635.1|2194798_2195284_+	YciE/YciF family protein	NA	NA	NA	NA	NA
AUJ12636.1|2195390_2196311_+	peptidase	NA	NA	NA	NA	NA
AUJ12637.1|2197557_2198526_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.3e-98
>prophage 17
CP019091	Xanthomonas oryzae pv. oryzae strain MAI134 chromosome, complete genome	4730142	2223815	2342387	4730142	capsid,coat,transposase	Stenotrophomonas_phage(31.43%)	64	NA	NA
AUJ12647.1|2223815_2224802_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.0	2.2e-42
AUJ12648.1|2224654_2224924_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ12649.1|2225709_2230011_+	avirulence protein	NA	NA	NA	NA	NA
AUJ12650.1|2230142_2233229_+	avirulence protein	NA	NA	NA	NA	NA
AUJ12651.1|2233360_2237155_+	avirulence protein	NA	NA	NA	NA	NA
AUJ14535.1|2239086_2239980_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUJ12652.1|2240233_2241886_-	hypothetical protein	NA	A0A2K9KZV5	Tupanvirus	26.0	2.4e-41
AUJ12653.1|2242012_2242501_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ12654.1|2242989_2243874_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ12655.1|2243874_2244678_-	hypothetical protein	NA	A0A2K9L3I8	Tupanvirus	26.8	1.2e-14
AUJ12656.1|2244674_2246774_-	hypothetical protein	NA	A0A2K9KZV5	Tupanvirus	27.6	4.9e-39
AUJ12657.1|2246481_2250018_-	hypothetical protein	NA	A0A2K9KZV5	Tupanvirus	25.1	2.2e-68
AUJ12658.1|2249945_2250653_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ12659.1|2250883_2270293_-	hypothetical protein	NA	A0A2K9KZV5	Tupanvirus	25.0	3.8e-130
AUJ12660.1|2270370_2279988_-	hypothetical protein	NA	A0A2K9KZV5	Tupanvirus	23.7	3.1e-125
AUJ12661.1|2279678_2292782_-	hypothetical protein	NA	A0A2K9KZV5	Tupanvirus	24.8	1.5e-133
AUJ12662.1|2292778_2297995_-	hypothetical protein	NA	A0A2K9KZV5	Tupanvirus	32.5	3.1e-74
AUJ12663.1|2297892_2301087_-	hypothetical protein	NA	A0A2K9KZV5	Tupanvirus	24.5	1.8e-64
AUJ12664.1|2301068_2307263_-	hypothetical protein	NA	A0A2K9KZV5	Tupanvirus	24.7	2.6e-120
AUJ12665.1|2307552_2307750_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ12666.1|2307794_2308889_+	type III polyketide synthase	NA	NA	NA	NA	NA
AUJ12667.1|2308928_2309672_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUJ12668.1|2309668_2310946_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUJ12669.1|2310933_2312289_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ12670.1|2312285_2313083_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUJ12671.1|2313159_2314866_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	22.4	2.0e-06
AUJ12672.1|2314964_2315183_+	antibiotic synthesis protein MbtH	NA	NA	NA	NA	NA
AUJ12673.1|2315546_2317130_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AUJ12674.1|2318272_2318767_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	39.7	2.4e-29
AUJ14536.1|2319989_2321006_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.6e-48
AUJ12675.1|2321718_2322180_-	hypothetical protein	NA	A0A1D6ZIU9	Xanthomonas_phage	69.2	1.3e-53
AUJ12676.1|2322628_2323699_+	replication protein	NA	S0F3F7	Stenotrophomonas_phage	40.1	1.4e-61
AUJ12677.1|2323807_2324098_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ12678.1|2324107_2324308_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ12679.1|2324336_2324561_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ12680.1|2324683_2326078_+	hypothetical protein	NA	B1NI80	Stenotrophomonas_phage	47.5	1.2e-81
AUJ14537.1|2326085_2326370_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ12681.1|2326369_2327512_+	zonular occludens toxin	NA	B1NI81	Stenotrophomonas_phage	59.1	6.4e-126
AUJ12682.1|2327600_2327876_+	hypothetical protein	NA	A0A1W6DXU7	Xanthomonas_phage	51.0	2.9e-16
AUJ12683.1|2328068_2328392_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	98.1	1.8e-54
AUJ12684.1|2328388_2328850_-	hypothetical protein	NA	A0A1D6ZIU9	Xanthomonas_phage	68.6	6.4e-53
AUJ12685.1|2329298_2330369_+	replication protein	NA	S0F3F7	Stenotrophomonas_phage	40.1	1.4e-61
AUJ12686.1|2330477_2330768_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ12687.1|2330777_2330978_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ12688.1|2331006_2331231_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ12689.1|2331353_2332748_+	hypothetical protein	NA	B1NI80	Stenotrophomonas_phage	47.5	1.2e-81
AUJ14538.1|2332755_2333040_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ12690.1|2333039_2334182_+	zonular occludens toxin	NA	B1NI81	Stenotrophomonas_phage	59.1	6.4e-126
AUJ12691.1|2334270_2334546_+	hypothetical protein	NA	A0A1W6DXU7	Xanthomonas_phage	51.0	2.9e-16
AUJ12692.1|2334679_2335063_-	hypothetical protein	NA	A0A1D6ZIV0	Xanthomonas_phage	95.3	1.0e-64
AUJ12693.1|2335245_2335572_+	hypothetical protein	NA	S0F2N2	Stenotrophomonas_phage	44.7	1.7e-15
AUJ12694.1|2335637_2335949_+	chloride channel protein	NA	A0A1W6DXV7	Xanthomonas_phage	98.1	5.1e-54
AUJ14539.1|2336014_2336263_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ12695.1|2336469_2336862_-	hypothetical protein	NA	A0A077JCA3	Xanthomonas_phage	47.0	4.7e-20
AUJ12696.1|2336891_2338214_-	hypothetical protein	NA	Q4LAU4	Stenotrophomonas_phage	56.1	3.4e-131
AUJ12697.1|2338215_2338536_-|coat	phage coat protein	coat	Q4LAU3	Stenotrophomonas_phage	44.2	7.7e-21
AUJ12698.1|2338670_2338910_-	hypothetical protein	NA	Q94MX3	Xanthomonas_phage	93.7	1.6e-34
AUJ14540.1|2338903_2339230_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ12699.1|2339840_2339969_-|capsid	capsid protein	capsid	NA	NA	NA	NA
AUJ12700.1|2339998_2340115_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ12701.1|2340060_2340222_-|coat	coat protein	coat	NA	NA	NA	NA
AUJ12702.1|2340253_2340550_-	single-stranded DNA-binding protein	NA	B1NI78	Stenotrophomonas_phage	65.3	4.3e-26
AUJ12703.1|2340546_2341653_-	replication protein	NA	S0F3I3	Stenotrophomonas_phage	71.2	1.7e-152
AUJ12704.1|2342162_2342387_-	hypothetical protein	NA	A0A1D6ZIV2	Xanthomonas_phage	95.4	1.0e-24
>prophage 18
CP019091	Xanthomonas oryzae pv. oryzae strain MAI134 chromosome, complete genome	4730142	2649518	2729852	4730142	tRNA,transposase	Ralstonia_phage(27.27%)	44	NA	NA
AUJ12928.1|2649518_2650973_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
AUJ12929.1|2651396_2652383_+	PhoH family protein	NA	A0A1B2ICF6	Erwinia_phage	47.7	4.8e-45
AUJ12930.1|2653510_2653996_+	endoribonuclease YbeY	NA	NA	NA	NA	NA
AUJ12931.1|2653995_2654514_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ12932.1|2654608_2655487_+	magnesium/cobalt efflux protein	NA	NA	NA	NA	NA
AUJ14565.1|2655501_2656764_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ12933.1|2656779_2657781_+	magnesium transporter CorA	NA	NA	NA	NA	NA
AUJ14566.1|2657932_2659297_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUJ12934.1|2659771_2660620_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AUJ12935.1|2660616_2661528_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AUJ12936.1|2661656_2662790_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	7.4e-26
AUJ12937.1|2662935_2664447_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ12938.1|2664433_2666020_-	MFS transporter	NA	NA	NA	NA	NA
AUJ12939.1|2666016_2667219_-	multidrug ABC transporter permease	NA	NA	NA	NA	NA
AUJ12940.1|2668600_2669587_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.0	1.7e-42
AUJ12941.1|2669439_2669703_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ12942.1|2669742_2670243_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.4	2.0e-44
AUJ12943.1|2673729_2675115_-	glutamine synthetase	NA	NA	NA	NA	NA
AUJ14567.1|2675761_2677141_+	glutamine synthetase	NA	NA	NA	NA	NA
AUJ12944.1|2677140_2678457_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AUJ12945.1|2678593_2679838_+	diguanylate cyclase response regulator	NA	A0A127AWB9	Bacillus_phage	36.4	1.9e-19
AUJ12946.1|2680143_2681424_-	MFS transporter	NA	NA	NA	NA	NA
AUJ14568.1|2681725_2682034_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ12947.1|2681993_2684342_-	CbbBc protein	NA	NA	NA	NA	NA
AUJ12948.1|2684338_2685184_-	sufurtransferase FdhD	NA	NA	NA	NA	NA
AUJ12949.1|2685190_2686870_-	MFS transporter	NA	NA	NA	NA	NA
AUJ12950.1|2688810_2691942_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ12951.1|2692117_2693086_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
AUJ12952.1|2693266_2694121_+	plasmid replication/partition related protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	38.7	3.2e-13
AUJ12953.1|2694291_2695596_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ12954.1|2699864_2700851_+	two-component system response regulator	NA	W8CYM9	Bacillus_phage	26.8	4.8e-05
AUJ12955.1|2700923_2701892_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
AUJ12956.1|2702378_2707388_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
AUJ12957.1|2707665_2708325_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ12958.1|2708339_2709647_+	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUJ12959.1|2709659_2712830_+	multidrug efflux RND transporter permease	NA	NA	NA	NA	NA
AUJ12960.1|2715498_2716494_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUJ12961.1|2716654_2719171_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	6.3e-09
AUJ12962.1|2719167_2720124_+	1-phosphofructokinase	NA	NA	NA	NA	NA
AUJ12963.1|2720282_2722025_+	PTS fructose transporter subunit EIIBC	NA	NA	NA	NA	NA
AUJ14569.1|2722343_2723480_+	carbohydrate porin	NA	NA	NA	NA	NA
AUJ12964.1|2723871_2726634_+	type IV secretion protein Rhs	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.7	4.3e-43
AUJ12965.1|2728023_2728233_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ12966.1|2729582_2729852_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 19
CP019091	Xanthomonas oryzae pv. oryzae strain MAI134 chromosome, complete genome	4730142	2906449	2976567	4730142	transposase	Bacillus_phage(15.0%)	57	NA	NA
AUJ13094.1|2906449_2907418_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	4.3e-99
AUJ13095.1|2907826_2910355_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	34.9	1.6e-65
AUJ13096.1|2910917_2912363_-	acetylhydrolase	NA	M1HKG7	Acanthocystis_turfacea_Chlorella_virus	25.8	1.8e-08
AUJ14586.1|2912316_2912583_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14587.1|2912873_2914022_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUJ13097.1|2914086_2915139_+	ArsR family transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.9	3.0e-05
AUJ13098.1|2915135_2916275_+	5-methyltetrahydrofolate--homocysteine methyltransferase	NA	A0A140XBC7	Dickeya_phage	66.7	9.8e-18
AUJ13099.1|2916417_2919171_+	methionine synthase	NA	NA	NA	NA	NA
AUJ13100.1|2919556_2920762_-	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
AUJ13101.1|2920758_2921817_-	carbohydrate kinase	NA	NA	NA	NA	NA
AUJ13102.1|2921741_2923052_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
AUJ14588.1|2923065_2924130_-	transcriptional regulator	NA	NA	NA	NA	NA
AUJ13103.1|2924381_2925227_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ13104.1|2925559_2926312_-	nucleoprotein/polynucleotide-associated enzyme	NA	NA	NA	NA	NA
AUJ13105.1|2926312_2926549_-	protein SlyX	NA	NA	NA	NA	NA
AUJ13106.1|2926541_2927891_-	UDP-glucose 6-dehydrogenase	NA	A0A127AXI2	Bacillus_phage	40.2	6.9e-79
AUJ14589.1|2927915_2928812_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AUJ13107.1|2928971_2929529_-	glutathione peroxidase	NA	NA	NA	NA	NA
AUJ13108.1|2929914_2930277_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ13109.1|2930273_2931149_+	multidrug ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	1.6e-12
AUJ13110.1|2931145_2932132_+	ABC transporter permease	NA	NA	NA	NA	NA
AUJ13111.1|2932141_2932915_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ13112.1|2932946_2933477_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ13113.1|2933835_2934285_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ13114.1|2934406_2935810_-	class II fumarate hydratase	NA	NA	NA	NA	NA
AUJ13115.1|2936161_2937130_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
AUJ14590.1|2938521_2939538_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
AUJ13116.1|2939710_2940613_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ13117.1|2940810_2942178_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	47.9	1.6e-112
AUJ13118.1|2942429_2942942_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ13119.1|2942871_2943111_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ13120.1|2943453_2944953_+	transcriptional regulator	NA	NA	NA	NA	NA
AUJ13121.1|2944949_2945882_+	N-acetyltransferase	NA	NA	NA	NA	NA
AUJ13122.1|2946062_2948891_+	2-oxoglutarate dehydrogenase subunit E1	NA	NA	NA	NA	NA
AUJ13123.1|2948933_2950136_+	dihydrolipoamide succinyltransferase	NA	NA	NA	NA	NA
AUJ13124.1|2950377_2951814_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.8	4.8e-38
AUJ13125.1|2952012_2952606_+	Rossman fold protein, TIGR00730 family	NA	A0A2I2L3F0	Orpheovirus	27.5	2.1e-11
AUJ14591.1|2952870_2953464_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	8.1e-16
AUJ13126.1|2953460_2955230_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.5	5.2e-58
AUJ13127.1|2956323_2957727_+	multidrug transporter	NA	NA	NA	NA	NA
AUJ13128.1|2957959_2958946_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.4	9.9e-43
AUJ13129.1|2958798_2959068_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ13130.1|2959324_2959519_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ13131.1|2959798_2960920_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
AUJ13132.1|2960916_2961834_-	pyridoxal kinase	NA	NA	NA	NA	NA
AUJ13133.1|2962361_2963492_-	molecular chaperone DnaJ	NA	Q8QNB4	Ectocarpus_siliculosus_virus	30.0	1.4e-24
AUJ13134.1|2963651_2965577_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.6	2.2e-147
AUJ13135.1|2965718_2966237_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AUJ13136.1|2966337_2967390_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
AUJ13137.1|2967506_2969171_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AUJ13138.1|2969613_2970039_-	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
AUJ13139.1|2970128_2970524_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ13140.1|2970870_2971146_-	RnfH family protein	NA	NA	NA	NA	NA
AUJ13141.1|2971159_2971591_-	ubiquinone-binding protein	NA	NA	NA	NA	NA
AUJ13142.1|2971651_2972155_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	41.9	5.8e-23
AUJ13143.1|2972298_2974746_-	serine peptidase	NA	A0A218KC60	Bacillus_phage	26.1	8.3e-14
AUJ13144.1|2975580_2976567_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.0	2.9e-42
>prophage 20
CP019091	Xanthomonas oryzae pv. oryzae strain MAI134 chromosome, complete genome	4730142	2985519	3034325	4730142	tRNA,protease,transposase	Ralstonia_phage(18.75%)	43	NA	NA
AUJ13152.1|2985519_2985789_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ13153.1|2985641_2986628_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.0	2.2e-42
AUJ13154.1|2986637_2987858_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	2.0e-77
AUJ13155.1|2988306_2989281_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.0	2.6e-19
AUJ13156.1|2991084_2992053_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
AUJ13157.1|2992300_2993020_-	cell envelope biogenesis protein OmpA	NA	G3M9Z0	Bacillus_virus	33.9	1.4e-09
AUJ14593.1|2993029_2993209_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ13158.1|2993436_2994891_-	deoxyribodipyrimidine photolyase	NA	A0A1V0S949	Catovirus	31.7	2.6e-47
AUJ13159.1|2994957_2996388_-	replicative DNA helicase	NA	O80281	Escherichia_phage	53.4	8.5e-120
AUJ13160.1|2996609_2997164_-	NADPH-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	34.1	1.2e-18
AUJ13161.1|2997380_2999321_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	29.2	4.4e-26
AUJ14594.1|2999496_3000126_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUJ13162.1|3004201_3004993_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ13163.1|3005138_3005354_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ13164.1|3005353_3006121_+	DNAase	NA	NA	NA	NA	NA
AUJ13165.1|3006211_3007042_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
AUJ13166.1|3007114_3007543_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ13167.1|3007674_3008154_+	peptidoglycan-associated outer membrane lipoprotein precursor	NA	NA	NA	NA	NA
AUJ13168.1|3008404_3008620_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
AUJ13169.1|3008586_3008820_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ13170.1|3008847_3009333_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14595.1|3009534_3010017_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.2	1.1e-42
AUJ13171.1|3011952_3014184_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	59.7	1.5e-09
AUJ13172.1|3014333_3014558_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ13173.1|3014668_3015637_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
AUJ14596.1|3015946_3017080_+	phospholipase	NA	NA	NA	NA	NA
AUJ13174.1|3017356_3018415_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	6.8e-74
AUJ13175.1|3018599_3019235_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUJ13176.1|3019370_3020888_-	fumarate hydratase	NA	NA	NA	NA	NA
AUJ13177.1|3020927_3021188_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ13178.1|3021222_3023103_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	38.9	5.2e-24
AUJ13179.1|3023305_3024085_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AUJ13180.1|3024166_3024652_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	36.2	2.8e-14
AUJ14597.1|3027109_3027349_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ13181.1|3027598_3028312_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14599.1|3028414_3029515_-	peptidase S8	NA	NA	NA	NA	NA
AUJ14598.1|3029844_3030333_+	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
AUJ14600.1|3030494_3031088_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ13182.1|3031179_3031680_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ13183.1|3031746_3032580_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ13184.1|3032630_3032894_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUJ13185.1|3033113_3033302_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ13186.1|3033716_3034325_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 21
CP019091	Xanthomonas oryzae pv. oryzae strain MAI134 chromosome, complete genome	4730142	3355002	3393819	4730142	terminase,portal,head,tail,capsid,transposase	Burkholderia_phage(21.05%)	44	NA	NA
AUJ14630.1|3355002_3356019_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	3.3e-49
AUJ13397.1|3356012_3356201_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
AUJ13398.1|3357417_3357777_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ13399.1|3359216_3359891_+	7-cyano-7-deazaguanine synthase	NA	A0A088F6S9	Vibrio_phage	34.7	8.3e-25
AUJ14631.1|3360076_3360241_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ13400.1|3360549_3361374_-	hypothetical protein	NA	A0A1W6JTB0	Pseudomonas_phage	52.5	2.4e-34
AUJ14632.1|3361459_3361648_-	carbon storage regulator	NA	NA	NA	NA	NA
AUJ14633.1|3361714_3362092_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ13401.1|3362353_3363046_-	peptidase S24	NA	NA	NA	NA	NA
AUJ13402.1|3363137_3363425_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ13403.1|3363574_3363826_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ13404.1|3363822_3364104_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AUJ14634.1|3364670_3364970_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ13405.1|3364966_3366322_+	DNA helicase	NA	O80281	Escherichia_phage	35.6	3.2e-52
AUJ14635.1|3366425_3366614_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ13406.1|3366606_3367161_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14636.1|3367282_3367717_+	lysozyme	NA	D5LH07	Escherichia_phage	68.3	8.2e-50
AUJ13407.1|3367713_3368058_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ13408.1|3368054_3368276_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ13409.1|3368358_3368775_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ13410.1|3368771_3369047_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14637.1|3369069_3369480_+	HNH endonuclease	NA	NA	NA	NA	NA
AUJ13411.1|3369580_3369961_+	hypothetical protein	NA	A0A0U4JIP6	Pseudomonas_phage	54.0	6.7e-32
AUJ13412.1|3369963_3371640_+|terminase	terminase	terminase	A0A0U4B0C7	Pseudomonas_phage	71.3	1.4e-233
AUJ13413.1|3371639_3372959_+|portal	phage portal protein	portal	C7BGG8	Burkholderia_phage	37.5	1.1e-60
AUJ13414.1|3372921_3373650_+	peptidase S14	NA	C7BGG9	Burkholderia_phage	53.9	2.4e-49
AUJ13415.1|3373715_3374960_+|capsid	capsid protein	capsid	C7BGH0	Burkholderia_phage	45.9	3.3e-91
AUJ13416.1|3375019_3375244_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ13417.1|3375247_3375664_+	hypothetical protein	NA	A0A286S294	Klebsiella_phage	37.7	4.5e-05
AUJ13418.1|3375660_3375993_+|head,tail	head-tail adaptor protein	head,tail	C7BGH2	Burkholderia_phage	38.9	2.5e-06
AUJ13419.1|3375985_3376387_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ13420.1|3376383_3376719_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14638.1|3376784_3377237_+|tail	phage tail protein	tail	NA	NA	NA	NA
AUJ13421.1|3377240_3377591_+	hypothetical protein	NA	G9FHI3	Rhodococcus_phage	50.4	1.5e-22
AUJ14639.1|3377692_3377911_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ13422.1|3378155_3379301_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ13423.1|3379456_3383002_+|tail	phage tail tape measure protein	tail	A5H1M1	Xanthomonas_virus	39.4	2.6e-32
AUJ13424.1|3383601_3384477_+	hypothetical protein	NA	A0A1I9L2F1	Xanthomonas_phage	51.0	1.3e-81
AUJ13425.1|3384455_3384821_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ13426.1|3384901_3388762_+	hypothetical protein	NA	A0A1I9L2F3	Xanthomonas_phage	53.9	0.0e+00
AUJ13427.1|3388763_3389495_+	hypothetical protein	NA	A0A1V0DY81	Dinoroseobacter_phage	39.1	2.8e-34
AUJ13428.1|3389611_3390406_+	restriction endonuclease subunit M	NA	B7SYF3	Stenotrophomonas_phage	79.9	3.7e-125
AUJ13429.1|3390500_3390701_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ13430.1|3391095_3393819_+	type VI secretion protein	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.3	2.6e-69
>prophage 22
CP019091	Xanthomonas oryzae pv. oryzae strain MAI134 chromosome, complete genome	4730142	3534982	3605666	4730142	tRNA,transposase	Ralstonia_phage(20.0%)	53	NA	NA
AUJ13522.1|3534982_3537814_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SGW1	Hokovirus	22.2	1.4e-41
AUJ13523.1|3539035_3540640_-	lipid II flippase MurJ	NA	NA	NA	NA	NA
AUJ13524.1|3540756_3541026_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
AUJ13525.1|3541117_3542170_-	Obg family GTPase CgtA	NA	NA	NA	NA	NA
AUJ13526.1|3542405_3542666_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
AUJ13527.1|3542678_3542999_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
AUJ13528.1|3543291_3546249_+	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	4.3e-307
AUJ13529.1|3546245_3546653_+	thioesterase	NA	NA	NA	NA	NA
AUJ13530.1|3546766_3547231_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ13531.1|3547254_3548025_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUJ13532.1|3548095_3549001_+	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
AUJ13533.1|3549228_3549732_+	pathogenicity-like protein	NA	NA	NA	NA	NA
AUJ13534.1|3549843_3550608_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AUJ14653.1|3550857_3551313_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ13535.1|3552234_3552990_+	arginyltransferase	NA	NA	NA	NA	NA
AUJ13536.1|3552943_3554275_+	endonuclease	NA	NA	NA	NA	NA
AUJ13537.1|3554626_3555046_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ13538.1|3555247_3556849_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ13539.1|3557295_3558372_+	DUF4432 domain-containing protein	NA	NA	NA	NA	NA
AUJ13540.1|3558468_3558942_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ13541.1|3559178_3561614_+	ligand-gated channel	NA	A0A0P0I887	Acinetobacter_phage	21.9	5.9e-12
AUJ14654.1|3562145_3562685_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ13542.1|3562890_3563649_+	trehalose-phosphatase	NA	NA	NA	NA	NA
AUJ13543.1|3563693_3565472_+	glucoamylase	NA	NA	NA	NA	NA
AUJ13544.1|3565468_3566836_+	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
AUJ13545.1|3567439_3569917_+	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
AUJ14656.1|3572325_3572832_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14655.1|3572852_3573659_-	multi-copper polyphenol oxidoreductase	NA	NA	NA	NA	NA
AUJ13546.1|3573666_3574662_-	23S rRNA pseudouridine(1911/1915/1917) synthase	NA	NA	NA	NA	NA
AUJ13547.1|3574782_3575664_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AUJ13548.1|3575821_3577480_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.4	7.1e-94
AUJ14657.1|3577710_3578727_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	4.3e-49
AUJ13549.1|3579373_3580249_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
AUJ13550.1|3580273_3581443_-	succinyl-CoA ligase subunit beta	NA	NA	NA	NA	NA
AUJ13551.1|3581676_3583290_+	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
AUJ13552.1|3583611_3585015_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AUJ13553.1|3585872_3587606_-	type IV-A pilus assembly ATPase PilB	NA	NA	NA	NA	NA
AUJ13554.1|3587640_3589167_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ13555.1|3589136_3589814_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ13556.1|3589794_3591384_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ13557.1|3591518_3591944_-	pilin	NA	NA	NA	NA	NA
AUJ14658.1|3592299_3593559_+	type II secretory pathway protein	NA	NA	NA	NA	NA
AUJ13558.1|3593565_3594429_+	prepilin peptidase	NA	NA	NA	NA	NA
AUJ13559.1|3594442_3595048_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
AUJ14659.1|3595274_3596441_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AUJ13560.1|3597054_3597732_-	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
AUJ14660.1|3597809_3598199_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14661.1|3598411_3599299_-	ribosomal protein S6 modification protein	NA	A0A1D7SR78	Cyanophage	32.0	1.1e-29
AUJ13561.1|3599803_3601936_+	glycogen debranching enzyme GlgX	NA	NA	NA	NA	NA
AUJ13562.1|3602330_3603299_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
AUJ13563.1|3603571_3604558_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.0	2.9e-42
AUJ13564.1|3604410_3604674_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ13565.1|3604718_3605666_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	2.6e-96
>prophage 23
CP019091	Xanthomonas oryzae pv. oryzae strain MAI134 chromosome, complete genome	4730142	3751988	3872256	4730142	protease,transposase	Klosneuvirus(11.76%)	94	NA	NA
AUJ13670.1|3751988_3752957_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.3e-97
AUJ13671.1|3756290_3756908_+	hydrolase	NA	NA	NA	NA	NA
AUJ13672.1|3757153_3758380_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	24.4	4.4e-16
AUJ13673.1|3758452_3759319_+	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	31.3	4.2e-05
AUJ13674.1|3759604_3759943_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ13675.1|3759955_3760360_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ13676.1|3760378_3760558_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ13677.1|3760613_3760970_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ13678.1|3760935_3761412_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ13679.1|3761458_3762118_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
AUJ13680.1|3762269_3764357_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ13681.1|3764470_3764740_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ13682.1|3765079_3765964_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ13683.1|3766110_3766707_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AUJ14676.1|3766706_3768065_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
AUJ13684.1|3768431_3768995_-	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	31.4	2.1e-13
AUJ13685.1|3769154_3770411_+	6-phosphofructokinase	NA	NA	NA	NA	NA
AUJ13686.1|3770791_3771316_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ13687.1|3771564_3773592_+	sodium-translocating pyrophosphatase	NA	NA	NA	NA	NA
AUJ13688.1|3773884_3774367_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ13689.1|3774563_3775100_+	inorganic pyrophosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	53.6	6.1e-47
AUJ13690.1|3775246_3776362_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ13691.1|3776974_3779944_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.6	1.3e-40
AUJ13692.1|3779989_3780883_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUJ13693.1|3780993_3783345_-	biopolymer transporter Tol	NA	NA	NA	NA	NA
AUJ13694.1|3783769_3785647_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
AUJ13695.1|3786928_3787930_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
AUJ13696.1|3787970_3789692_+	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	8.0e-64
AUJ13697.1|3789675_3789933_+	acetolactate synthase	NA	NA	NA	NA	NA
AUJ13698.1|3790008_3791133_+	serine/threonine dehydratase	NA	NA	NA	NA	NA
AUJ13699.1|3791129_3792692_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.4	4.3e-08
AUJ13700.1|3793015_3794089_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
AUJ14677.1|3794125_3794875_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUJ13701.1|3794907_3795555_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
AUJ13702.1|3795622_3797071_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
AUJ13703.1|3797191_3798076_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ13704.1|3798320_3799103_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AUJ13705.1|3799864_3800518_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ14678.1|3800647_3801304_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
AUJ13706.1|3801324_3802704_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ13707.1|3802978_3804295_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
AUJ13708.1|3804371_3805292_+	lipid A biosynthesis lauroyl acyltransferase	NA	NA	NA	NA	NA
AUJ13709.1|3805524_3806859_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ13710.1|3806839_3807952_-	glycosyl transferase	NA	NA	NA	NA	NA
AUJ13711.1|3807962_3808160_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
AUJ14679.1|3808983_3810000_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	3.3e-49
AUJ14680.1|3812617_3813880_-	hemolysin D	NA	NA	NA	NA	NA
AUJ14681.1|3814366_3815383_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.2e-48
AUJ13712.1|3815298_3815601_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ13713.1|3815636_3815906_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ13714.1|3815758_3816745_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.7e-42
AUJ13715.1|3817121_3818108_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.0	2.9e-42
AUJ13716.1|3817960_3818230_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ14682.1|3818272_3818581_-	transcriptional regulator	NA	NA	NA	NA	NA
AUJ13717.1|3819601_3820021_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ13718.1|3820490_3820634_+	alpha-mannosidase	NA	NA	NA	NA	NA
AUJ13719.1|3820809_3823119_-	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
AUJ13720.1|3823316_3824690_-	C4-dicarboxylate transporter DctA	NA	NA	NA	NA	NA
AUJ13721.1|3824982_3826155_+	porin	NA	NA	NA	NA	NA
AUJ13722.1|3826476_3829122_+	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L5I4	Tupanvirus	25.1	1.7e-12
AUJ13723.1|3829437_3830787_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.3	1.3e-61
AUJ13724.1|3830783_3831563_+	molybdenum ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUJ13725.1|3831554_3832457_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ13726.1|3832767_3833373_+	rhizopine catabolism protein mocA	NA	NA	NA	NA	NA
AUJ13727.1|3834089_3834476_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14683.1|3834444_3835083_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUJ13728.1|3836171_3837557_-	histidine kinase	NA	W8CYF6	Bacillus_phage	23.7	2.4e-10
AUJ13729.1|3837549_3838251_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUJ14684.1|3838506_3839700_+	porin	NA	NA	NA	NA	NA
AUJ13730.1|3839699_3839933_+	magnesium transporter	NA	NA	NA	NA	NA
AUJ13731.1|3839926_3841255_+	citrate transporter	NA	NA	NA	NA	NA
AUJ13732.1|3841369_3842110_+	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
AUJ13733.1|3842130_3842328_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ13734.1|3842369_3843401_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUJ13735.1|3843627_3844959_-	MFS transporter	NA	NA	NA	NA	NA
AUJ14685.1|3845208_3847671_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUJ13736.1|3847705_3849622_+	amylosucrase	NA	NA	NA	NA	NA
AUJ13737.1|3849788_3850469_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
AUJ13738.1|3850621_3851884_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ13739.1|3851883_3852975_-	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
AUJ13740.1|3853128_3854400_+	aminotransferase	NA	NA	NA	NA	NA
AUJ13741.1|3854399_3855050_+	lysophospholipase	NA	NA	NA	NA	NA
AUJ13742.1|3855372_3856044_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUJ13743.1|3856347_3857124_-	acetyl xylan esterase	NA	NA	NA	NA	NA
AUJ13744.1|3857184_3858111_+	monothiol glutaredoxin, Grx4 family	NA	NA	NA	NA	NA
AUJ13745.1|3859335_3859896_-	hypothetical protein	NA	A0A1V0SIY0	Klosneuvirus	37.3	3.4e-16
AUJ13746.1|3861453_3862734_+	amidohydrolase	NA	NA	NA	NA	NA
AUJ14686.1|3863037_3863364_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ13747.1|3863724_3865326_+	rhamnogalacturonase B	NA	NA	NA	NA	NA
AUJ14687.1|3865942_3866689_-	cellulase	NA	NA	NA	NA	NA
AUJ13748.1|3868407_3868923_-	peptide deformylase	NA	NA	NA	NA	NA
AUJ13749.1|3869245_3869668_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	62.2	1.0e-41
AUJ13750.1|3870221_3870593_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ13751.1|3870603_3872256_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 24
CP019091	Xanthomonas oryzae pv. oryzae strain MAI134 chromosome, complete genome	4730142	3950934	3957304	4730142		Enterobacteria_phage(50.0%)	6	NA	NA
AUJ13801.1|3950934_3952281_+	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	27.1	6.7e-34
AUJ13802.1|3952326_3953730_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	28.8	1.6e-41
AUJ13803.1|3953846_3954755_-	NAD(P)-dependent oxidoreductase	NA	A0A1D7XFA3	Escherichia_phage	33.8	5.4e-27
AUJ13804.1|3954751_3955309_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	48.1	1.7e-44
AUJ13805.1|3955305_3956193_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
AUJ13806.1|3956248_3957304_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
>prophage 25
CP019091	Xanthomonas oryzae pv. oryzae strain MAI134 chromosome, complete genome	4730142	3960734	4016825	4730142	transposase	Ralstonia_phage(37.5%)	49	NA	NA
AUJ13810.1|3960734_3961703_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
AUJ13811.1|3961837_3963028_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ13812.1|3963027_3964329_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AUJ13813.1|3964331_3965060_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUJ13814.1|3965089_3965761_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUJ13815.1|3965791_3966736_+	NAD-dependent dehydratase	NA	NA	NA	NA	NA
AUJ13816.1|3966776_3968069_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ13817.1|3968133_3969990_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ13818.1|3969986_3970397_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14696.1|3970441_3972115_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ13819.1|3972643_3973897_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14697.1|3973893_3975540_-	glycosyl transferase family 2	NA	NA	NA	NA	NA
AUJ14698.1|3975781_3976804_-	wsae	NA	NA	NA	NA	NA
AUJ13820.1|3976955_3978188_-	teichoic acid ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	26.4	3.9e-12
AUJ13821.1|3978184_3978967_-	ABC transporter permease	NA	NA	NA	NA	NA
AUJ13822.1|3978970_3980167_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
AUJ14699.1|3980257_3981628_-	cystathionine beta-synthase	NA	A0A1X9I5F1	Streptococcus_phage	38.8	2.6e-49
AUJ13823.1|3981868_3982087_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ13824.1|3982428_3983319_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ13825.1|3983315_3983699_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ13826.1|3983797_3984931_+	type IV pili twitching motility protein PilT	NA	NA	NA	NA	NA
AUJ13827.1|3985270_3985933_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
AUJ14700.1|3985976_3986966_-	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
AUJ13828.1|3987127_3987253_-	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
AUJ13829.1|3987345_3988728_+	RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.3	6.4e-56
AUJ14701.1|3989152_3989506_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
AUJ14702.1|3989698_3990034_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ13830.1|3990148_3990823_-	dethiobiotin synthase	NA	NA	NA	NA	NA
AUJ13831.1|3991147_3991630_+	diguanylate cyclase	NA	NA	NA	NA	NA
AUJ13832.1|3991626_3992025_+	transcriptional regulator	NA	NA	NA	NA	NA
AUJ13833.1|3992155_3993124_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	4.3e-99
AUJ13834.1|3993315_3994284_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.1e-99
AUJ13835.1|3994656_3995307_-	phosphoglycolate phosphatase, bacterial	NA	NA	NA	NA	NA
AUJ13836.1|3995449_3996529_-	DNA polymerase IV	NA	NA	NA	NA	NA
AUJ13837.1|3996528_3996876_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ13838.1|3996874_3997390_+	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
AUJ13839.1|3997389_3998598_+	beta-ketoacyl-[acyl-carrier-protein] synthase I	NA	NA	NA	NA	NA
AUJ13840.1|3998711_3999533_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ13841.1|3999706_4001731_-	oligopeptidase A	NA	NA	NA	NA	NA
AUJ13842.1|4001774_4002878_-	cysteine synthase	NA	NA	NA	NA	NA
AUJ13843.1|4003013_4003430_+	copper homeostasis protein	NA	NA	NA	NA	NA
AUJ14703.1|4003537_4005334_+	copper resistance protein CopA	NA	NA	NA	NA	NA
AUJ13844.1|4005330_4006377_+	copper resistance protein CopB	NA	NA	NA	NA	NA
AUJ14704.1|4006533_4007058_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
AUJ13845.1|4007266_4007743_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ13846.1|4009571_4010045_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ13847.1|4010426_4012256_-	glutamine--fructose-6-phosphate aminotransferase	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.7	3.5e-134
AUJ13848.1|4015722_4016709_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.4	9.9e-43
AUJ13849.1|4016561_4016825_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 26
CP019091	Xanthomonas oryzae pv. oryzae strain MAI134 chromosome, complete genome	4730142	4169059	4242502	4730142	tRNA,protease,transposase	Xanthomonas_phage(12.5%)	59	NA	NA
AUJ13961.1|4169059_4170124_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.4	5.1e-101
AUJ13962.1|4170403_4170619_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AUJ14726.1|4171106_4171553_+|tRNA	glutamyl-tRNA amidotransferase	tRNA	A0A292GL36	Xanthomonas_phage	45.2	1.0e-23
AUJ13963.1|4173082_4174045_+	BrkB protein	NA	NA	NA	NA	NA
AUJ13964.1|4174133_4175882_+	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	34.8	1.1e-44
AUJ14727.1|4176724_4177726_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
AUJ14728.1|4177909_4179490_+	thiol reductase thioredoxin	NA	NA	NA	NA	NA
AUJ13965.1|4179879_4180776_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
AUJ13966.1|4180778_4181942_-	heme A synthase	NA	NA	NA	NA	NA
AUJ13967.1|4181952_4182528_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ13968.1|4183334_4183553_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ13969.1|4183645_4184521_-	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
AUJ13970.1|4184559_4185156_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
AUJ13971.1|4185152_4185326_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ13972.1|4185306_4186911_-	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
AUJ13973.1|4186949_4187903_-	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
AUJ14729.1|4187919_4188351_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ13974.1|4188672_4191873_+	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUJ13975.1|4191820_4192060_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ13976.1|4192028_4192292_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ13977.1|4192144_4193131_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.0	2.9e-42
AUJ14730.1|4199268_4200480_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
AUJ13978.1|4200650_4202069_+	hypothetical protein	NA	A0A0K2CNY2	Brevibacillus_phage	36.9	2.0e-12
AUJ13979.1|4202439_4203573_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
AUJ13980.1|4203610_4203838_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14731.1|4203896_4205117_-	MFS transporter	NA	NA	NA	NA	NA
AUJ13981.1|4205511_4206312_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	29.0	3.1e-26
AUJ13982.1|4206439_4207099_+	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
AUJ13983.1|4207121_4207880_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ13984.1|4207917_4208715_+	chromosome partitioning protein	NA	Q8JL10	Natrialba_phage	30.3	9.5e-20
AUJ13985.1|4208714_4209644_+	chromosome partitioning protein ParB	NA	I3NLC2	Bifidobacterium_phage	34.9	1.0e-12
AUJ13986.1|4209679_4209988_+	mitomycin resistance protein	NA	NA	NA	NA	NA
AUJ13987.1|4210192_4211158_+	protein CapI	NA	A0A1V0SKV4	Klosneuvirus	30.5	1.6e-29
AUJ13988.1|4211524_4212247_+	dolichol-phosphate mannosyltransferase	NA	NA	NA	NA	NA
AUJ13989.1|4212246_4212588_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ13990.1|4213005_4213554_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14732.1|4213661_4215056_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	29.5	2.6e-49
AUJ13991.1|4216023_4216491_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	Q2NP83	Xanthomonas_phage	96.1	1.1e-79
AUJ13992.1|4216487_4217762_-	bifunctional 4'-phosphopantothenoylcysteine decarboxylase/phosphopantothenoylcysteine synthetase	NA	Q9HH70	Methanothermobacter_phage	31.2	5.8e-35
AUJ14733.1|4217858_4218536_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ13993.1|4218623_4220312_+|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
AUJ13994.1|4220491_4221373_+	sporulation protein	NA	NA	NA	NA	NA
AUJ13995.1|4221379_4221859_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ13996.1|4221950_4222706_+	NADP-dependent 3-hydroxy acid dehydrogenase	NA	NA	NA	NA	NA
AUJ13997.1|4222986_4223877_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	42.0	1.9e-37
AUJ13998.1|4223729_4223999_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ13999.1|4224085_4227988_-	avirulence protein	NA	NA	NA	NA	NA
AUJ14734.1|4228567_4229275_-	hypothetical protein	NA	U5P429	Shigella_phage	59.1	3.4e-69
AUJ14000.1|4229965_4230280_-	hypothetical protein	NA	A0A077K814	Ralstonia_phage	64.1	1.2e-21
AUJ14001.1|4230424_4232311_-	arginine decarboxylase	NA	NA	NA	NA	NA
AUJ14002.1|4232549_4233407_+	spermidine synthase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	32.5	2.2e-14
AUJ14003.1|4233845_4234457_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14004.1|4234649_4235213_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14735.1|4236117_4236654_+	kinase	NA	NA	NA	NA	NA
AUJ14005.1|4237002_4238988_-	beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
AUJ14736.1|4239601_4239940_-	transcriptional regulator	NA	NA	NA	NA	NA
AUJ14006.1|4240129_4240408_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14007.1|4240424_4241945_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AUJ14008.1|4242025_4242502_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 27
CP019091	Xanthomonas oryzae pv. oryzae strain MAI134 chromosome, complete genome	4730142	4295914	4373410	4730142	tRNA,transposase	Staphylococcus_phage(23.08%)	53	NA	NA
AUJ14048.1|4295914_4296925_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AUJ14049.1|4298578_4302070_-	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
AUJ14050.1|4302663_4302843_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14746.1|4303059_4304076_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.1e-48
AUJ14051.1|4304144_4305131_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	39.7	1.1e-41
AUJ14747.1|4305325_4305520_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14052.1|4306271_4306847_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14053.1|4306905_4308429_-	catalase	NA	A0A2K9L0T1	Tupanvirus	48.0	4.4e-98
AUJ14748.1|4309124_4309595_-	hemolysin D	NA	NA	NA	NA	NA
AUJ14749.1|4309556_4309745_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14054.1|4310279_4312412_-	ATP-dependent DNA helicase DinG	NA	NA	NA	NA	NA
AUJ14055.1|4312897_4313272_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14056.1|4313261_4314113_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
AUJ14057.1|4315714_4318258_-	iron-uptake factor	NA	NA	NA	NA	NA
AUJ14058.1|4318490_4319243_+	endonuclease	NA	H6X497	Enterobacteria_phage	33.3	1.3e-21
AUJ14059.1|4319370_4320285_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ14060.1|4320398_4321355_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14061.1|4321542_4322535_-	delta-aminolevulinic acid dehydratase	NA	NA	NA	NA	NA
AUJ14750.1|4322755_4322974_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14751.1|4323223_4323679_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14062.1|4323779_4325609_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14063.1|4325774_4328012_-	S9 family peptidase	NA	NA	NA	NA	NA
AUJ14752.1|4330647_4331664_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	3.3e-49
AUJ14064.1|4334099_4335122_+	energy transducer TonB	NA	NA	NA	NA	NA
AUJ14065.1|4335522_4336716_-	sodium ABC transporter permease	NA	NA	NA	NA	NA
AUJ14066.1|4336712_4337459_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	5.2e-20
AUJ14067.1|4337490_4339092_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUJ14068.1|4339152_4339353_-	transcriptional regulator	NA	NA	NA	NA	NA
AUJ14753.1|4339349_4339757_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14069.1|4340385_4340658_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14070.1|4340723_4341707_+	cation transporter	NA	NA	NA	NA	NA
AUJ14071.1|4341791_4342553_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AUJ14072.1|4342655_4343651_+	ABC transporter	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.2	8.5e-26
AUJ14073.1|4343668_4344460_+	ABC transporter permease	NA	NA	NA	NA	NA
AUJ14074.1|4344535_4345504_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
AUJ14075.1|4346223_4347162_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AUJ14076.1|4347161_4347344_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14077.1|4347275_4347635_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14078.1|4349484_4350150_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14079.1|4350520_4350805_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14080.1|4351389_4352688_+	murein transglycosylase	NA	NA	NA	NA	NA
AUJ14081.1|4353271_4354648_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	6.0e-78
AUJ14082.1|4356623_4356950_-	thiol reductase thioredoxin	NA	NA	NA	NA	NA
AUJ14083.1|4356921_4357416_-	flavodoxin	NA	A0A068CFW0	Listeria_phage	35.4	2.7e-17
AUJ14084.1|4357432_4358887_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14085.1|4358925_4359969_-	ribonucleotide-diphosphate reductase subunit beta	NA	A8ASV9	Listeria_phage	75.1	1.1e-151
AUJ14086.1|4360165_4362664_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A088FNW1	Listeria_phage	67.1	6.4e-304
AUJ14087.1|4363279_4364323_-	hypothetical protein	NA	A0A172Q0Y5	Acinetobacter_phage	51.8	4.8e-80
AUJ14088.1|4364429_4367138_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUJ14089.1|4367424_4368039_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14090.1|4368110_4369478_-	magnesium transporter	NA	NA	NA	NA	NA
AUJ14091.1|4370155_4371979_+	glutathione-regulated potassium-efflux system protein KefB	NA	NA	NA	NA	NA
AUJ14092.1|4372990_4373410_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 28
CP019091	Xanthomonas oryzae pv. oryzae strain MAI134 chromosome, complete genome	4730142	4453753	4622539	4730142	tRNA,transposase	Ralstonia_phage(20.69%)	110	NA	NA
AUJ14142.1|4453753_4454722_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	4.3e-99
AUJ14765.1|4454847_4455213_-	L-fucose mutarotase	NA	NA	NA	NA	NA
AUJ14143.1|4455209_4456511_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
AUJ14144.1|4456691_4457468_+	transcriptional regulator	NA	NA	NA	NA	NA
AUJ14145.1|4457944_4458529_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14766.1|4458721_4462171_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
AUJ14146.1|4462920_4465563_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14767.1|4465666_4468066_-	NdvB protein	NA	NA	NA	NA	NA
AUJ14147.1|4468068_4469451_-	MFS transporter	NA	NA	NA	NA	NA
AUJ14768.1|4469665_4470193_+	gluconokinase	NA	NA	NA	NA	NA
AUJ14769.1|4471111_4472773_+	polyvinylalcohol dehydrogenase	NA	A0A0M4JT37	Mollivirus	36.1	1.3e-82
AUJ14148.1|4473104_4473410_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14770.1|4473312_4473753_-	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AUJ14149.1|4473772_4474201_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14150.1|4475492_4475732_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14151.1|4475826_4476795_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
AUJ14771.1|4476709_4477675_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	3.0e-36
AUJ14152.1|4477802_4478771_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
AUJ14153.1|4480520_4484378_-	pathogenicity protein	NA	NA	NA	NA	NA
AUJ14154.1|4484374_4486156_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14155.1|4486332_4489092_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.8	9.3e-147
AUJ14156.1|4489344_4490934_-	sulfotransferase family protein	NA	NA	NA	NA	NA
AUJ14157.1|4490933_4493192_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AUJ14158.1|4493349_4494258_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
AUJ14159.1|4494347_4496162_+	type II secretion system protein E	NA	NA	NA	NA	NA
AUJ14160.1|4496555_4505015_-	hypothetical protein	NA	A0A1S5SDF1	Streptococcus_phage	32.0	1.3e-10
AUJ14772.1|4505591_4505837_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14161.1|4505966_4506719_+	GMP synthase	NA	NA	NA	NA	NA
AUJ14162.1|4506778_4507678_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14163.1|4507830_4508586_-	twin arginine-targeting protein translocase TatC	NA	NA	NA	NA	NA
AUJ14164.1|4508582_4509203_-	twin arginine-targeting protein translocase TatB	NA	NA	NA	NA	NA
AUJ14165.1|4509218_4509446_-	protein translocase TatA	NA	NA	NA	NA	NA
AUJ14166.1|4509518_4510424_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14167.1|4510577_4511543_+	ferrochelatase	NA	NA	NA	NA	NA
AUJ14168.1|4511539_4512397_+	alpha/beta hydrolase	NA	R4JP33	Mycobacterium_phage	31.3	1.3e-06
AUJ14169.1|4512477_4512936_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14773.1|4513206_4513998_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14170.1|4514607_4515513_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.9	1.4e-43
AUJ14774.1|4515604_4516621_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.6e-48
AUJ14171.1|4516654_4517572_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.9	4.8e-84
AUJ14172.1|4517662_4518202_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14173.1|4518205_4519543_+	xylose isomerase	NA	NA	NA	NA	NA
AUJ14174.1|4519768_4520851_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUJ14175.1|4520990_4523186_+	alpha-glucuronidase	NA	NA	NA	NA	NA
AUJ14176.1|4523182_4525147_+	9-O-acetylesterase	NA	NA	NA	NA	NA
AUJ14177.1|4525158_4526418_+	bifunctional D-altronate/D-mannonate dehydratase	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
AUJ14178.1|4526417_4528124_+	glycoside hydrolase 43 family protein	NA	NA	NA	NA	NA
AUJ14179.1|4528126_4530841_+	glucan 1,4-alpha-glucosidase	NA	NA	NA	NA	NA
AUJ14180.1|4531063_4532527_+	mannitol dehydrogenase	NA	G8DCZ3	Micromonas_pusilla_virus	31.6	2.9e-46
AUJ14181.1|4532578_4533637_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	3.4e-73
AUJ14182.1|4534082_4534199_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14183.1|4534250_4535219_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
AUJ14184.1|4536203_4536995_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14185.1|4537834_4538821_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.0	2.9e-42
AUJ14186.1|4538673_4538937_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ14187.1|4540329_4541706_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	1.0e-77
AUJ14188.1|4542076_4543132_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14189.1|4543358_4544777_-	uronate isomerase	NA	NA	NA	NA	NA
AUJ14190.1|4544817_4545795_-	1,4-beta-xylanase	NA	NA	NA	NA	NA
AUJ14191.1|4547199_4548681_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14775.1|4549022_4551896_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUJ14192.1|4551994_4553482_+	MFS transporter	NA	NA	NA	NA	NA
AUJ14193.1|4553513_4554548_+	alpha-N-arabinofuranosidase	NA	NA	NA	NA	NA
AUJ14194.1|4554940_4555909_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
AUJ14195.1|4556003_4556225_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14776.1|4556293_4556866_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14196.1|4557004_4557223_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14197.1|4557368_4557623_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14198.1|4557859_4558840_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AUJ14199.1|4559035_4561699_-	glycerol-3-phosphate 1-O-acyltransferase	NA	NA	NA	NA	NA
AUJ14200.1|4561698_4562679_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14201.1|4562671_4562917_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14202.1|4563085_4564138_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUJ14203.1|4564302_4567341_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14204.1|4567657_4570690_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14205.1|4570799_4572329_+	tryptophan halogenase	NA	M4T1E3	Cyanophage	28.5	1.3e-46
AUJ14206.1|4572636_4573416_-	orotidine 5'-phosphate decarboxylase	NA	NA	NA	NA	NA
AUJ14777.1|4573412_4574378_-	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
AUJ14207.1|4574701_4575367_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14208.1|4576765_4578742_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.2	6.3e-113
AUJ14209.1|4578948_4579578_+	thymidine kinase	NA	A0A023W530	Serratia_phage	55.0	1.1e-52
AUJ14210.1|4579850_4580819_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
AUJ14211.1|4581196_4582435_+	histidine kinase	NA	NA	NA	NA	NA
AUJ14778.1|4582577_4584176_-	glucan biosynthesis protein D	NA	NA	NA	NA	NA
AUJ14212.1|4584244_4585336_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14213.1|4585445_4586432_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.0	2.9e-42
AUJ14214.1|4586284_4586548_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ14779.1|4586775_4587591_-	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	27.0	1.1e-18
AUJ14215.1|4587784_4589149_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	53.7	1.0e-74
AUJ14216.1|4595822_4597727_-	phytochrome	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	3.0e-19
AUJ14217.1|4597723_4598326_-	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
AUJ14218.1|4599982_4602145_-	epimerase	NA	NA	NA	NA	NA
AUJ14219.1|4602297_4602504_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14220.1|4602711_4603101_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14221.1|4603130_4603940_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14222.1|4604052_4605234_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14223.1|4605331_4608763_-	ATP-binding protein	NA	NA	NA	NA	NA
AUJ14224.1|4608910_4609609_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14225.1|4609592_4611065_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14226.1|4611061_4611649_-	cytoplasmic protein	NA	NA	NA	NA	NA
AUJ14227.1|4611648_4612845_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
AUJ14228.1|4612918_4613548_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	49.5	5.5e-47
AUJ14780.1|4614255_4614399_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14229.1|4616322_4617684_-	alpha-ketoglutarate transporter	NA	Q6JIH2	Burkholderia_virus	27.1	5.8e-33
AUJ14781.1|4618409_4619123_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14230.1|4619153_4619660_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14231.1|4619933_4620140_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14232.1|4620126_4621239_+	plasmid stabilization protein ParE	NA	NA	NA	NA	NA
AUJ14233.1|4621436_4622423_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	40.5	2.9e-42
AUJ14234.1|4622275_4622539_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 29
CP019091	Xanthomonas oryzae pv. oryzae strain MAI134 chromosome, complete genome	4730142	4635666	4677550	4730142	transposase	Ralstonia_phage(53.85%)	38	NA	NA
AUJ14783.1|4635666_4636152_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	40.9	8.1e-30
AUJ14246.1|4636215_4636611_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ14247.1|4636576_4636933_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ14248.1|4638244_4639213_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
AUJ14249.1|4639281_4639524_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14250.1|4639587_4640916_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AUJ14251.1|4641202_4642225_+	2-keto-3-deoxygluconate kinase	NA	NA	NA	NA	NA
AUJ14784.1|4642838_4644047_-	trans-2-enoyl-CoA reductase	NA	NA	NA	NA	NA
AUJ14252.1|4645155_4645464_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14253.1|4646016_4647183_+	alpha-hydroxy-acid oxidizing enzyme	NA	NA	NA	NA	NA
AUJ14254.1|4647244_4648225_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	55.7	1.7e-87
AUJ14255.1|4648997_4649294_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14256.1|4649504_4651700_-	ligand-gated channel	NA	A0A1B0VCF0	Salmonella_phage	40.9	3.2e-65
AUJ14257.1|4651798_4653001_+	aromatic amino acid aminotransferase	NA	NA	NA	NA	NA
AUJ14258.1|4653271_4654282_+	fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	7.3e-49
AUJ14259.1|4654556_4655024_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14785.1|4655680_4656697_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.1e-48
AUJ14260.1|4656856_4657825_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
AUJ14261.1|4657827_4658556_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14262.1|4658566_4659343_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14263.1|4659409_4660660_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14264.1|4660676_4660919_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14265.1|4660970_4661939_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
AUJ14266.1|4663630_4664599_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	4.3e-99
AUJ14267.1|4664763_4665126_+	hypothetical protein	NA	W8CYL7	Bacillus_phage	47.7	1.9e-07
AUJ14268.1|4665093_4665384_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14269.1|4665382_4666759_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	6.0e-78
AUJ14786.1|4666880_4667858_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14270.1|4667790_4667988_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14271.1|4668081_4668969_-	pseudouridylate synthase	NA	NA	NA	NA	NA
AUJ14272.1|4669302_4670880_+	chlamydia polymorphic membrane family protein	NA	NA	NA	NA	NA
AUJ14273.1|4671374_4672202_+	restriction endonuclease	NA	NA	NA	NA	NA
AUJ14274.1|4672630_4672927_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14275.1|4672925_4673894_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.1e-99
AUJ14276.1|4674235_4674568_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14277.1|4674816_4674915_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14278.1|4675017_4676412_-	nucleoside hydrolase	NA	NA	NA	NA	NA
AUJ14279.1|4677295_4677550_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	71.4	5.9e-16
