The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP019089	Xanthomonas oryzae pv. oryzae strain MAI106 chromosome, complete genome	4705454	7509	60932	4705454	protease,transposase	Leptospira_phage(28.57%)	41	NA	NA
AUJ03716.1|7509_8346_+|protease	CAAX protease family protein	protease	NA	NA	NA	NA
AUJ03717.1|8530_9337_+	peptidase	NA	NA	NA	NA	NA
AUJ03718.1|9613_10807_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03719.1|10960_11629_+	energy transducer TonB	NA	NA	NA	NA	NA
AUJ03720.1|11713_12475_+	biopolymer transporter ExbB	NA	NA	NA	NA	NA
AUJ03721.1|12521_12944_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AUJ03722.1|12947_13361_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AUJ03723.1|13656_14424_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AUJ03724.1|14434_14704_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03725.1|14778_16239_-	cardiolipin synthase	NA	NA	NA	NA	NA
AUJ03726.1|17384_18761_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	4.1e-63
AUJ06935.1|18989_19874_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	2.0e-87
AUJ03727.1|20006_20993_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	40.6	9.9e-43
AUJ06936.1|21252_22311_-	radical SAM protein	NA	NA	NA	NA	NA
AUJ03728.1|23450_24791_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03729.1|25008_25701_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AUJ03730.1|25817_26138_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03731.1|27435_28959_-	peptidase S41	NA	A0A0R6PIZ1	Moraxella_phage	29.2	1.0e-25
AUJ06937.1|29063_30281_-	peptidase M23	NA	NA	NA	NA	NA
AUJ03732.1|30459_31116_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03733.1|31278_33090_+	aminopeptidase	NA	NA	NA	NA	NA
AUJ03734.1|33237_33588_-	peptidase propeptide and ypeb domain-containing protein	NA	NA	NA	NA	NA
AUJ03735.1|33894_35025_-	cellulase	NA	NA	NA	NA	NA
AUJ03736.1|35807_36860_-	cellulase	NA	NA	NA	NA	NA
AUJ03737.1|37560_38634_-	cellulase	NA	NA	NA	NA	NA
AUJ03738.1|38750_38957_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03739.1|38942_40001_+	hydroxyacid dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.7	3.9e-77
AUJ03740.1|41043_41307_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ03741.1|42408_43038_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03742.1|43060_44119_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.2e-75
AUJ03743.1|44200_45682_-	glutamate synthase small subunit	NA	NA	NA	NA	NA
AUJ03744.1|45876_50349_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
AUJ03745.1|50550_50931_-	Elastase inhibitor AFLEI Flags: Precursor	NA	NA	NA	NA	NA
AUJ03746.1|50987_52265_+	DNA topoisomerase	NA	A0A0U2TSJ7	Niemeyer_virus	35.3	1.4e-41
AUJ03747.1|52467_52773_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06938.1|53262_53430_+	amino acid transporter	NA	NA	NA	NA	NA
AUJ06939.1|53959_55099_+	saccharopine dehydrogenase	NA	NA	NA	NA	NA
AUJ03748.1|55412_56198_-	Tat pathway signal protein	NA	NA	NA	NA	NA
AUJ06940.1|56208_58773_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AUJ03749.1|60168_60588_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ06941.1|60506_60932_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP019089	Xanthomonas oryzae pv. oryzae strain MAI106 chromosome, complete genome	4705454	206558	330712	4705454	tRNA,transposase,integrase	Leptospira_phage(21.43%)	101	249217:249233	276103:276119
AUJ06957.1|206558_206984_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ03852.1|207292_210685_-	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
AUJ03853.1|212462_212678_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03854.1|214658_214961_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03855.1|215116_215881_-	2,5-didehydrogluconate reductase B	NA	A0A2H4PQR8	Staphylococcus_phage	33.9	4.2e-33
AUJ03856.1|215903_216962_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.8e-74
AUJ03857.1|217064_218093_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
AUJ03858.1|218231_219203_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AUJ03859.1|219435_220290_+	methyltransferase	NA	NA	NA	NA	NA
AUJ06958.1|220382_220955_+	pseudouridine synthase	NA	NA	NA	NA	NA
AUJ03860.1|220976_221171_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03861.1|221277_221718_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03862.1|222019_224521_-	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	25.7	4.6e-20
AUJ03863.1|224674_225313_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03864.1|225905_226379_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	48.7	2.1e-35
AUJ06959.1|226564_227269_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AUJ03865.1|227818_228232_-	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AUJ03866.1|229119_230376_-	aminotransferase V	NA	NA	NA	NA	NA
AUJ03867.1|231512_231905_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUJ03868.1|232016_234524_+	peptidase	NA	NA	NA	NA	NA
AUJ03869.1|234701_235160_-	gas vesicle protein	NA	NA	NA	NA	NA
AUJ03870.1|236293_237262_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
AUJ03871.1|237466_237718_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03872.1|238154_238340_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03873.1|239095_239404_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03874.1|239400_239832_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03875.1|240912_241725_+	hydrolase TatD	NA	NA	NA	NA	NA
AUJ03876.1|242421_242619_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03877.1|242594_243482_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ03878.1|243497_244859_+	MFS transporter	NA	NA	NA	NA	NA
AUJ03879.1|245298_246180_+	NAD-dependent deacetylase	NA	A0A068EPD4	Bacillus_phage	23.3	6.6e-14
AUJ06960.1|246259_247357_+	oxidoreductase	NA	NA	NA	NA	NA
AUJ03880.1|247394_248273_+	oxidoreductase	NA	NA	NA	NA	NA
AUJ06961.1|248615_249008_+	hypothetical protein	NA	NA	NA	NA	NA
249217:249233	attL	CATTGCGCCGATGCGCT	NA	NA	NA	NA
AUJ03881.1|249226_250078_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
AUJ03882.1|250161_250839_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUJ03883.1|250871_251279_-	ATP-binding protein	NA	W8CYF6	Bacillus_phage	32.5	4.7e-15
AUJ03884.1|251275_251521_-	histidine kinase	NA	NA	NA	NA	NA
AUJ06962.1|251537_252434_-	5,10-methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
AUJ03885.1|252691_253357_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03886.1|253356_254271_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ03887.1|254461_255055_+	FMN reductase	NA	NA	NA	NA	NA
AUJ03888.1|255197_256181_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03889.1|256208_257237_+	5-methyltetrahydropteroyltriglutamate-- homocysteine methyltransferase	NA	NA	NA	NA	NA
AUJ06963.1|257444_258401_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
AUJ03890.1|260829_261708_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUJ03891.1|261844_262276_+	transcriptional regulator	NA	NA	NA	NA	NA
AUJ06964.1|262493_262736_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03892.1|263624_263888_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ03893.1|263856_264156_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03894.1|264258_264531_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03895.1|264808_265075_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03896.1|265145_265355_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03897.1|265353_266322_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
AUJ06965.1|266768_266978_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03898.1|267187_267433_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03899.1|267676_270964_-	avirulence protein	NA	NA	NA	NA	NA
AUJ03900.1|271888_272857_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	44.0	5.9e-56
AUJ03901.1|273056_274433_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
AUJ03902.1|274610_276449_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
276103:276119	attR	AGCGCATCGGCGCAATG	NA	NA	NA	NA
AUJ06966.1|276623_276890_+	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
AUJ03903.1|276915_277461_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AUJ03904.1|277936_279247_+	MFS transporter	NA	NA	NA	NA	NA
AUJ03905.1|279385_280645_+	phosphodiesterase	NA	NA	NA	NA	NA
AUJ03906.1|281129_281630_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ06967.1|281601_281988_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ03907.1|283624_285523_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03908.1|286097_286985_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUJ03909.1|287082_288273_+	4-hydroxybenzoate 3-monooxygenase	NA	NA	NA	NA	NA
AUJ03910.1|288684_289197_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03911.1|290753_291737_-	oxidoreductase	NA	NA	NA	NA	NA
AUJ03912.1|291837_292914_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
AUJ06968.1|293165_294029_+	3-oxoadipate--succinyl-CoA transferase	NA	NA	NA	NA	NA
AUJ03913.1|294812_296021_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
AUJ03914.1|296099_296837_+	protocatechuate 3,4-dioxygenase subunit beta	NA	NA	NA	NA	NA
AUJ03915.1|296841_297405_+	protocatechuate 3,4-dioxygenase subunit alpha	NA	NA	NA	NA	NA
AUJ03916.1|297902_299255_+	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
AUJ03917.1|299265_300048_+	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
AUJ03918.1|300073_300478_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AUJ03919.1|301957_302818_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ03920.1|302965_303826_+	serine protein kinase RIO	NA	NA	NA	NA	NA
AUJ03921.1|307120_309025_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
AUJ03922.1|309285_309465_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03923.1|309598_310066_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03924.1|310223_311183_+	serine/threonine dehydratase	NA	NA	NA	NA	NA
AUJ03925.1|311167_311782_+	protein sanA-like protein	NA	NA	NA	NA	NA
AUJ03926.1|311824_312244_+	isopropylmalate/homocitrate/citramalate synthase	NA	NA	NA	NA	NA
AUJ03927.1|312496_313402_-	aspartyl beta-hydroxylase	NA	S4VR59	Pandoravirus	39.1	9.8e-37
AUJ03928.1|313650_314535_-	malonyl-[acyl-carrier protein] O-methyltransferase BioC	NA	NA	NA	NA	NA
AUJ06969.1|315424_316186_-	pimeloyl-[acyl-carrier protein] methyl ester esterase	NA	NA	NA	NA	NA
AUJ03929.1|316349_316724_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03930.1|316915_318121_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
AUJ03931.1|318212_319247_-	biotin synthase BioB	NA	NA	NA	NA	NA
AUJ03932.1|319290_320022_+	amidophosphoribosyltransferase	NA	NA	NA	NA	NA
AUJ03933.1|320277_321183_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
AUJ03934.1|322130_323189_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.2e-75
AUJ03935.1|323224_325165_-	HpaF protein	NA	NA	NA	NA	NA
AUJ03936.1|325728_328137_-	serine kinase	NA	NA	NA	NA	NA
AUJ06970.1|328344_329199_-|transposase	transposase	transposase	U5P429	Shigella_phage	57.3	1.1e-85
AUJ03937.1|329603_330590_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	40.6	3.4e-43
AUJ03938.1|330442_330712_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
CP019089	Xanthomonas oryzae pv. oryzae strain MAI106 chromosome, complete genome	4705454	359877	394005	4705454	transposase	Acidithiobacillus_phage(37.5%)	25	NA	NA
AUJ03964.1|359877_360846_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.6e-98
AUJ03965.1|360971_362696_-	ABC transporter substrate-binding protein	NA	A0A0P0CRE2	Ostreococcus_lucimarinus_virus	28.7	3.0e-34
AUJ03966.1|362706_362919_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03967.1|362936_363878_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03968.1|365434_366493_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.2e-75
AUJ03969.1|366513_368148_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AUJ06973.1|368757_370215_+	starch synthase	NA	NA	NA	NA	NA
AUJ03970.1|370211_372443_+	glycogen-branching enzyme	NA	NA	NA	NA	NA
AUJ03971.1|372445_374203_+	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
AUJ06974.1|374259_376149_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
AUJ03972.1|376145_378749_+	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
AUJ03973.1|378770_378956_+	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
AUJ03974.1|379069_381232_+	glycogen debranching enzyme	NA	NA	NA	NA	NA
AUJ06975.1|381248_381881_+	NAD-dependent dehydratase	NA	NA	NA	NA	NA
AUJ03975.1|382246_383623_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.5	2.0e-78
AUJ03976.1|383704_384460_-	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AUJ03977.1|384423_384729_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03978.1|384810_386247_+	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
AUJ03979.1|386595_387027_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03980.1|387497_388874_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	3.2e-63
AUJ03981.1|389066_390443_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
AUJ03982.1|390479_390674_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ03983.1|391113_392403_-	RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	6.0e-40
AUJ03984.1|392410_392662_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ03985.1|393024_394005_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	56.7	1.4e-89
>prophage 4
CP019089	Xanthomonas oryzae pv. oryzae strain MAI106 chromosome, complete genome	4705454	492761	620152	4705454	head,portal,tail,tRNA,terminase,capsid,transposase,plate,integrase	Stenotrophomonas_phage(39.62%)	106	518388:518432	561370:561414
AUJ04059.1|492761_493325_-|tRNA	tRNA threonylcarbamoyladenosine biosynthesis protein RimN	tRNA	NA	NA	NA	NA
AUJ04060.1|493335_495828_-	DNA topoisomerase I	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	35.3	1.9e-114
AUJ04061.1|496010_497285_-	RDD family protein	NA	NA	NA	NA	NA
AUJ04062.1|497326_498049_-	pilus assembly protein PilA	NA	NA	NA	NA	NA
AUJ04063.1|498089_498563_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04064.1|498605_499748_-	DNA protecting protein DprA	NA	NA	NA	NA	NA
AUJ04065.1|499819_500956_-	peptidoglycan-binding protein LysM	NA	G3MBQ1	Bacillus_virus	57.1	1.7e-09
AUJ04066.1|501088_501601_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	2.6e-18
AUJ04067.1|502001_502925_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
AUJ04068.1|502924_504238_+	16S rRNA (cytosine(967)-C(5))-methyltransferase	NA	NA	NA	NA	NA
AUJ04069.1|506188_507466_+	polymerase	NA	NA	NA	NA	NA
AUJ04070.1|507663_508488_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AUJ04071.1|508488_509547_+	CDP-glycerol glycerophosphotransferase	NA	NA	NA	NA	NA
AUJ04072.1|509713_511219_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06989.1|511215_511725_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04073.1|511834_512968_-	GTP cyclohydrolase	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.1e-28
AUJ04074.1|513210_513732_+	N-acetyltransferase	NA	NA	NA	NA	NA
AUJ04075.1|513930_514845_-	lipid A biosynthesis lauroyl acyltransferase	NA	NA	NA	NA	NA
AUJ04076.1|514945_515386_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
AUJ04077.1|515494_517369_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
AUJ04078.1|517561_517882_+	hypothetical protein	NA	NA	NA	NA	NA
518388:518432	attL	CTCATAATCCTTTGGTTGAAGGTTCGAATCCTTCTGGGCCCACCA	NA	NA	NA	NA
AUJ04079.1|518501_519689_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	50.5	6.0e-111
AUJ04080.1|519688_519913_-	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	71.4	6.1e-17
AUJ04081.1|519909_520116_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04082.1|520112_520385_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06991.1|520381_520531_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04083.1|520623_520899_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06990.1|520891_521047_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04084.1|521060_521471_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04085.1|521696_521975_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06992.1|521971_522190_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06993.1|522498_525171_-	bifunctional DNA primase/helicase	NA	V9IQW5	Stenotrophomonas_phage	69.7	0.0e+00
AUJ04086.1|525204_525417_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04087.1|525413_525692_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04088.1|525702_526023_-	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	56.5	6.3e-23
AUJ04089.1|526025_526283_-	DNA-binding protein	NA	A0A2H4JE67	uncultured_Caudovirales_phage	46.4	6.6e-07
AUJ04090.1|526354_526792_+	transcriptional regulator	NA	E5E3P4	Burkholderia_phage	32.0	5.4e-09
AUJ06994.1|527152_527437_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04091.1|527452_528439_-	late control protein	NA	V9IQM7	Stenotrophomonas_phage	54.8	2.5e-94
AUJ04092.1|528435_528837_-	oxidoreductase	NA	V9IQX3	Stenotrophomonas_phage	62.3	6.0e-39
AUJ04093.1|528849_531720_-|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	47.5	6.2e-194
AUJ04094.1|531752_531866_-	hypothetical protein	NA	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
AUJ04095.1|531874_532177_-|tail	phage tail protein	tail	A4PE51	Ralstonia_virus	62.6	6.3e-25
AUJ04096.1|532222_532732_-|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	79.9	1.8e-72
AUJ04097.1|532762_533929_-|tail	phage tail protein	tail	E5FFG9	Burkholderia_phage	62.4	4.6e-132
AUJ04098.1|533940_534300_-|plate	baseplate assembly protein	plate	V9IQW0	Stenotrophomonas_phage	66.1	4.3e-36
AUJ04099.1|534296_534860_-|plate	baseplate assembly protein	plate	Q9ZXL0	Pseudomonas_virus	43.7	3.1e-25
AUJ04100.1|534920_535499_-|tail	phage tail protein	tail	NA	NA	NA	NA
AUJ04101.1|535506_537012_-	hypothetical protein	NA	V9IQX0	Stenotrophomonas_phage	47.0	2.1e-52
AUJ04102.1|537021_537567_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	54.7	3.5e-50
AUJ04103.1|537559_538450_-|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	53.7	7.2e-85
AUJ04104.1|538531_538981_-	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	54.7	1.8e-36
AUJ04105.1|538968_539388_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	65.2	2.0e-40
AUJ04106.1|539861_540503_-	lysozyme	NA	V9IQK6	Stenotrophomonas_phage	60.9	7.9e-49
AUJ04107.1|540499_540775_-	hypothetical protein	NA	V9IQV8	Stenotrophomonas_phage	59.8	3.0e-21
AUJ04108.1|540767_541124_-	hypothetical protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	4.5e-22
AUJ04109.1|541128_541338_-|tail	phage tail protein	tail	K4PAW7	Burkholderia_phage	59.4	5.4e-15
AUJ04110.1|541337_541805_-|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	49.7	9.2e-31
AUJ04111.1|541904_542624_-|terminase	terminase	terminase	Q9ZXM2	Pseudomonas_virus	63.4	2.0e-69
AUJ04112.1|542627_543647_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	70.9	2.1e-136
AUJ04113.1|543693_544536_-|capsid	phage capsid protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	52.6	1.7e-67
AUJ04114.1|544657_546442_+|terminase	terminase	terminase	V9IQL5	Stenotrophomonas_phage	75.1	1.2e-267
AUJ04115.1|546441_547461_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	72.5	4.1e-140
AUJ04116.1|547481_547712_+	hypothetical protein	NA	V9IQK2	Stenotrophomonas_phage	54.8	1.9e-13
AUJ04117.1|547644_548349_+	DNA modification methylase	NA	V9IQV5	Stenotrophomonas_phage	77.8	3.3e-109
AUJ04118.1|548380_548848_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04119.1|548847_550026_-	DNA-binding protein	NA	NA	NA	NA	NA
AUJ04120.1|550756_553516_+	type IV secretion protein Rhs	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.3	1.8e-41
AUJ04121.1|553524_554451_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04122.1|554447_557282_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04123.1|557309_558041_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04124.1|558067_560410_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04125.1|561481_561715_-	hypothetical protein	NA	V9IQN0	Stenotrophomonas_phage	53.1	4.1e-16
561370:561414	attR	CTCATAATCCTTTGGTTGAAGGTTCGAATCCTTCTGGGCCCACCA	NA	NA	NA	NA
AUJ04126.1|562071_562926_+|transposase	transposase	transposase	U5P429	Shigella_phage	57.7	6.3e-86
AUJ06995.1|563591_564872_-	transcription termination factor Rho	NA	NA	NA	NA	NA
AUJ04127.1|565697_566039_-	thiol reductase thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	44.4	2.3e-15
AUJ04128.1|566237_567962_+	ATP-dependent RNA helicase RhlB	NA	A0A1V0SBR7	Catovirus	29.4	1.1e-47
AUJ04129.1|568037_568724_+	cell division ATP-binding protein FtsE	NA	NA	NA	NA	NA
AUJ04130.1|568720_569671_+	ABC transporter permease	NA	NA	NA	NA	NA
AUJ06996.1|569727_570522_+	histidine kinase	NA	NA	NA	NA	NA
AUJ04131.1|570518_571244_+	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	44.3	4.7e-50
AUJ04132.1|571460_572336_+	RNA polymerase factor sigma-32	NA	A0A248SJA5	Salicola_phage	39.5	3.6e-44
AUJ04133.1|572414_573029_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04134.1|573081_574374_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AUJ04135.1|576664_576952_+	co-chaperone GroES	NA	A0A221S331	uncultured_virus	40.0	5.1e-16
AUJ04136.1|577095_578736_+	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	63.5	5.1e-177
AUJ04137.1|579036_581313_-	type III secretion system effector protein	NA	NA	NA	NA	NA
AUJ04138.1|582420_583389_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
AUJ04139.1|585774_586743_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
AUJ04140.1|587674_588748_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	47.9	4.3e-84
AUJ04141.1|589234_591442_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04142.1|591535_593953_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04143.1|594216_595137_-	gluconolactonase	NA	NA	NA	NA	NA
AUJ04144.1|595136_595655_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04145.1|595816_598642_+	bifunctional glutamine synthetase adenylyltransferase/deadenyltransferase	NA	NA	NA	NA	NA
AUJ04146.1|598737_599298_-	hypothetical protein	NA	A0A2I7SAW6	Vibrio_phage	30.2	1.4e-12
AUJ04147.1|601004_602381_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
AUJ04148.1|603365_603968_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04149.1|606473_606974_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04150.1|607874_608822_-	nucleoside-diphosphate sugar epimerase	NA	NA	NA	NA	NA
AUJ04151.1|608958_609549_+	nitroreductase family protein	NA	NA	NA	NA	NA
AUJ04152.1|609759_610503_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
AUJ04153.1|612818_615506_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
AUJ04154.1|615592_616330_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04155.1|616340_617717_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	7.1e-63
AUJ04156.1|618775_620152_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	7.1e-63
>prophage 5
CP019089	Xanthomonas oryzae pv. oryzae strain MAI106 chromosome, complete genome	4705454	628080	710905	4705454	protease,transposase,tRNA	Ralstonia_phage(18.75%)	56	NA	NA
AUJ04161.1|628080_629043_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
AUJ04162.1|629330_630707_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
AUJ04163.1|630955_631201_-	hypothetical protein	NA	A0A077K814	Ralstonia_phage	70.2	2.2e-15
AUJ04164.1|631182_631590_-	hypothetical protein	NA	A0A077K814	Ralstonia_phage	60.9	2.0e-37
AUJ04165.1|631711_635536_+	avirulence protein	NA	NA	NA	NA	NA
AUJ06997.1|635628_636021_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ04166.1|635914_636439_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	42.9	8.7e-22
AUJ04167.1|636605_638189_-	oxidoreductase	NA	M1NLX1	Moumouvirus	27.5	6.5e-36
AUJ04168.1|638579_638771_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06998.1|641271_643584_-	S9 family peptidase	NA	NA	NA	NA	NA
AUJ04169.1|645499_646591_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06999.1|647555_648464_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUJ04170.1|648631_649507_+	EamA family transporter	NA	NA	NA	NA	NA
AUJ04171.1|649784_651557_-	cellulase	NA	NA	NA	NA	NA
AUJ04172.1|651954_653655_-	1,4-beta-cellobiosidase	NA	NA	NA	NA	NA
AUJ07000.1|654809_656186_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
AUJ04173.1|656272_657268_-	type III secretion system effector protein	NA	NA	NA	NA	NA
AUJ04174.1|657513_658425_+	magnesium transporter	NA	NA	NA	NA	NA
AUJ04175.1|658959_659244_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04176.1|659573_660020_+	autotransporter	NA	NA	NA	NA	NA
AUJ04177.1|660331_660595_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ04178.1|660447_661434_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-43
AUJ04179.1|662141_663518_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
AUJ07001.1|663555_664215_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	62.0	6.6e-67
AUJ04180.1|664690_666382_-	alpha,alpha-trehalase	NA	NA	NA	NA	NA
AUJ04181.1|666634_667420_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04182.1|668663_669668_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07002.1|669706_670648_-	histidine kinase	NA	NA	NA	NA	NA
AUJ04183.1|671171_674060_-	peptidase M16	NA	NA	NA	NA	NA
AUJ04184.1|674312_676895_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	29.2	3.2e-08
AUJ04185.1|677472_677949_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ04186.1|680874_682329_-	endoglucanase	NA	H2DE45	Erwinia_phage	32.6	5.2e-48
AUJ04187.1|682536_684024_+	sodium-independent anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	57.1	2.4e-125
AUJ07003.1|684303_685257_+	hypothetical protein	NA	A0A127AWB9	Bacillus_phage	38.0	1.7e-15
AUJ04188.1|685425_687075_+	peptidase M20	NA	NA	NA	NA	NA
AUJ04189.1|688066_690004_+	glucan biosynthesis glucosyltransferase H	NA	NA	NA	NA	NA
AUJ04190.1|690155_690824_+	carboxylesterase	NA	NA	NA	NA	NA
AUJ04191.1|690828_691881_+	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.6	1.4e-18
AUJ04192.1|691911_692649_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUJ04193.1|692679_693594_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
AUJ04194.1|694156_694957_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04195.1|695518_696484_+	transcriptional regulator	NA	NA	NA	NA	NA
AUJ04196.1|696592_697162_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04197.1|697546_697858_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04198.1|697925_700019_+	S9 family peptidase	NA	NA	NA	NA	NA
AUJ04199.1|700613_701798_-	aminotransferase	NA	NA	NA	NA	NA
AUJ04200.1|701823_702006_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07004.1|701943_704043_+	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	26.1	1.7e-28
AUJ07005.1|704386_704785_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04201.1|704842_705085_+	sugar transporter	NA	NA	NA	NA	NA
AUJ04202.1|705074_705929_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
AUJ04203.1|705916_706597_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07006.1|706754_707708_+	tyrosine recombinase XerC	NA	A0A142F2H8	Mycobacterium_phage	28.1	1.8e-12
AUJ04204.1|708223_708775_+	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
AUJ04205.1|708879_710247_+|protease	ATP-dependent protease ATP-binding subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	29.5	4.7e-43
AUJ04206.1|710449_710905_-|tRNA	tRNA-specific adenosine deaminase	tRNA	NA	NA	NA	NA
>prophage 6
CP019089	Xanthomonas oryzae pv. oryzae strain MAI106 chromosome, complete genome	4705454	728082	803861	4705454	protease,tail,transposase,tRNA	Tupanvirus(11.76%)	54	NA	NA
AUJ04220.1|728082_729114_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	7.9e-75
AUJ04221.1|730415_731807_+	endopolygalacturonase	NA	NA	NA	NA	NA
AUJ04222.1|732075_733215_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
AUJ04223.1|733211_734627_+	hypothetical protein	NA	F5B3X9	Synechococcus_phage	50.6	4.3e-15
AUJ04224.1|735128_736334_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	40.9	1.6e-66
AUJ04225.1|736633_737287_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04226.1|737413_737692_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04227.1|737679_738378_+	octanoyltransferase	NA	NA	NA	NA	NA
AUJ04228.1|738392_739406_+	lipoyl synthase	NA	NA	NA	NA	NA
AUJ04229.1|739804_741988_+|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	31.4	3.7e-82
AUJ04230.1|742279_743146_-	endonuclease	NA	NA	NA	NA	NA
AUJ04231.1|743307_744363_+	ADP-ribose pyrophosphatase	NA	A0A1B0V161	Roseobacter_phage	47.1	3.7e-80
AUJ04232.1|744485_745889_+	nicotinate phosphoribosyltransferase	NA	A0A218M332	Acidovorax_phage	52.6	6.6e-133
AUJ07008.1|748072_748870_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04233.1|748994_749375_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04234.1|749546_750884_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04235.1|750904_751846_+	6-phosphogluconate dehydrogenase (decarboxylating)	NA	M4SJX8	Cyanophage	44.6	8.5e-68
AUJ04236.1|752185_753244_-	oxidoreductase	NA	NA	NA	NA	NA
AUJ07009.1|753403_753766_+	BON domain-containing protein	NA	NA	NA	NA	NA
AUJ04237.1|754050_755862_+	histidine kinase	NA	A0A2K9L0Z8	Tupanvirus	27.8	3.5e-09
AUJ04238.1|755858_756299_+	response regulator	NA	NA	NA	NA	NA
AUJ04239.1|756302_757805_+	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L5I4	Tupanvirus	26.9	4.9e-09
AUJ04240.1|757896_758412_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AUJ04241.1|758580_759318_-	pteridine reductase	NA	NA	NA	NA	NA
AUJ07010.1|759385_760570_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUJ04242.1|761665_761860_-	hypothetical protein	NA	U5P4I9	Shigella_phage	51.0	2.2e-07
AUJ04243.1|761970_762939_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	2.3e-100
AUJ04244.1|763967_766676_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUJ04245.1|766826_769721_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	25.2	2.0e-22
AUJ04246.1|769717_772114_+	alpha-N-acetylglucosaminidase	NA	NA	NA	NA	NA
AUJ04247.1|772247_773414_+	DUF5009 domain-containing protein	NA	NA	NA	NA	NA
AUJ04248.1|773628_774396_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ04249.1|774440_775718_+	glucose/galactose MFS transporter	NA	NA	NA	NA	NA
AUJ04250.1|775758_776835_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUJ04251.1|776831_777860_+	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AUJ04252.1|777862_779017_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
AUJ04253.1|779521_780127_-	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
AUJ04254.1|780123_781377_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
AUJ04255.1|781378_783277_-	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
AUJ04256.1|783278_785321_-	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
AUJ04257.1|785878_786502_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	42.0	2.8e-35
AUJ04258.1|786534_787767_-|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	K4IEX3	Salmonella_phage	41.5	2.3e-73
AUJ04259.1|787987_788956_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
AUJ07011.1|791137_791494_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04260.1|791533_792226_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04261.1|794320_795058_-	endonuclease	NA	NA	NA	NA	NA
AUJ04262.1|795107_795923_-	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AUJ04263.1|796014_796665_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AUJ07012.1|796758_797499_-	cytochrome C	NA	NA	NA	NA	NA
AUJ04264.1|797700_798324_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
AUJ07013.1|798417_799113_-	nodulin 21	NA	NA	NA	NA	NA
AUJ04265.1|799328_800693_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AUJ04266.1|800879_801809_-	two-component system sensor protein	NA	W8CYF6	Bacillus_phage	25.2	1.7e-15
AUJ04267.1|802484_803861_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
>prophage 7
CP019089	Xanthomonas oryzae pv. oryzae strain MAI106 chromosome, complete genome	4705454	832408	902185	4705454	protease,transposase	Streptococcus_phage(25.0%)	56	NA	NA
AUJ04293.1|832408_832885_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ04294.1|834834_836187_+	type III secretion system effector protein	NA	NA	NA	NA	NA
AUJ04295.1|836636_836729_+	K+-transporting ATPase subunit F	NA	NA	NA	NA	NA
AUJ04296.1|836744_838538_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AUJ04297.1|838550_840599_+	potassium-transporting ATPase subunit B	NA	E4ZFI9	Streptococcus_phage	28.2	1.7e-36
AUJ04298.1|840639_841269_+	potassium-transporting ATPase C chain	NA	NA	NA	NA	NA
AUJ04299.1|841319_843980_+	two-component sensor histidine kinase	NA	B5LWN0	Feldmannia_species_virus	28.1	1.6e-10
AUJ04300.1|843969_844686_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUJ04301.1|846536_846800_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ04302.1|846652_847639_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-43
AUJ04303.1|848193_849579_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AUJ07016.1|849575_850115_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04304.1|850144_850513_-	YraN family protein	NA	NA	NA	NA	NA
AUJ04305.1|850517_852248_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
AUJ04306.1|852329_853151_+	rRNA (cytidine-2'-O-)-methyltransferase	NA	M1PLC5	Streptococcus_phage	38.3	9.5e-39
AUJ07017.1|854567_854792_-	plasmid maintenance protein CcdB	NA	NA	NA	NA	NA
AUJ04307.1|854867_855635_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04308.1|855949_856405_+	cell division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
AUJ07018.1|856449_857463_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase	NA	NA	NA	NA	NA
AUJ04309.1|857459_857723_+	cell division protein FtsL	NA	NA	NA	NA	NA
AUJ04310.1|857856_859734_+	cell division protein	NA	NA	NA	NA	NA
AUJ04311.1|859730_861218_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
AUJ04312.1|861214_862726_+	UDP-N-acetylmuramoylalanyl-D-glutamyl-2, 6-diaminopimelate--D-alanyl-D-alanine ligase	NA	NA	NA	NA	NA
AUJ04313.1|862715_863801_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
AUJ04314.1|863800_865174_+	cell division protein FtsW	NA	NA	NA	NA	NA
AUJ04315.1|865170_866496_+	UDP-N-acetylglucosamine--N-acetylmuramyl- (pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase	NA	NA	NA	NA	NA
AUJ04316.1|866492_867926_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
AUJ04317.1|867922_868879_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
AUJ04318.1|869003_869825_+	cell division protein FtsQ	NA	NA	NA	NA	NA
AUJ04319.1|869821_871057_+	cell division protein FtsA	NA	NA	NA	NA	NA
AUJ04320.1|871365_872610_+	cell division protein FtsZ	NA	NA	NA	NA	NA
AUJ04321.1|872837_873749_+	UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
AUJ04322.1|873935_874388_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04323.1|874388_875330_+	peptidase M23	NA	A0A292GJG6	Xanthomonas_phage	46.4	2.0e-29
AUJ04324.1|875486_878225_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
AUJ04325.1|878690_879059_+	glyoxalase	NA	NA	NA	NA	NA
AUJ04326.1|879199_880147_+	DNA mismatch repair protein MutT	NA	NA	NA	NA	NA
AUJ04327.1|880332_880962_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04328.1|881329_882157_-	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
AUJ04329.1|882196_883576_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04330.1|884071_885049_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
AUJ07019.1|885285_887043_+|protease	protease	protease	NA	NA	NA	NA
AUJ04331.1|887122_887305_-	glyoxalase	NA	NA	NA	NA	NA
AUJ04332.1|887905_888841_+	D-galactose 1-dehydrogenase	NA	NA	NA	NA	NA
AUJ04333.1|889379_889802_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04334.1|889988_890534_+	nucleoprotein/polynucleotide-associated enzyme	NA	NA	NA	NA	NA
AUJ04335.1|890763_891321_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04336.1|891471_892158_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04337.1|892650_893583_+	sulfotransferase	NA	A0A1X9T5H0	Ranid_herpesvirus	36.4	1.2e-05
AUJ07020.1|893614_894397_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUJ04338.1|894626_896069_-	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	30.9	1.1e-47
AUJ04339.1|896381_896927_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04340.1|897120_899835_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
AUJ04341.1|899894_900530_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ04342.1|901082_902069_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-43
AUJ04343.1|901921_902185_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
CP019089	Xanthomonas oryzae pv. oryzae strain MAI106 chromosome, complete genome	4705454	1073187	1134198	4705454	protease,transposase	Leptospira_phage(20.0%)	45	NA	NA
AUJ04487.1|1073187_1074246_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.8e-74
AUJ04488.1|1075279_1076248_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	2.8e-98
AUJ04489.1|1078150_1079524_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04490.1|1079622_1081662_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
AUJ04491.1|1081869_1082892_-	NADPH:quinone reductase	NA	NA	NA	NA	NA
AUJ07036.1|1082865_1083060_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04492.1|1083307_1084405_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04493.1|1084597_1085107_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04494.1|1085126_1085987_+	pseudouridylate synthase	NA	NA	NA	NA	NA
AUJ04495.1|1085937_1086330_-	HNH endonuclease	NA	NA	NA	NA	NA
AUJ04496.1|1086332_1087541_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.5	2.9e-20
AUJ07037.1|1087712_1088729_+	sulfate transporter subunit	NA	NA	NA	NA	NA
AUJ04497.1|1088732_1089593_+	sulfate ABC transporter permease subunit CysT	NA	NA	NA	NA	NA
AUJ04498.1|1089589_1090543_+	sulfate ABC transporter permease subunit CysW	NA	NA	NA	NA	NA
AUJ07038.1|1090550_1091585_+	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	2.0e-25
AUJ04499.1|1091944_1092658_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07039.1|1092727_1093750_-	L-threonine 3-dehydrogenase	NA	NA	NA	NA	NA
AUJ04500.1|1094265_1096599_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AUJ07040.1|1099013_1101164_+	dipeptidyl-peptidase 7	NA	NA	NA	NA	NA
AUJ04501.1|1101256_1101901_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
AUJ04502.1|1102178_1102433_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04503.1|1102871_1104170_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AUJ04504.1|1104237_1105320_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
AUJ04505.1|1105534_1106275_+	colicin V synthesis protein	NA	NA	NA	NA	NA
AUJ07041.1|1107915_1108740_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04506.1|1109458_1109935_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ04507.1|1110719_1111139_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04508.1|1111318_1112062_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
AUJ04509.1|1112214_1112565_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04510.1|1112696_1113239_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AUJ04511.1|1114559_1116086_-	exopolyphosphatase	NA	NA	NA	NA	NA
AUJ04512.1|1116257_1118360_-	RNA degradosome polyphosphate kinase	NA	NA	NA	NA	NA
AUJ04513.1|1118463_1119807_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	33.8	5.0e-29
AUJ04514.1|1119864_1120554_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.7	5.9e-34
AUJ07042.1|1120728_1122375_-	peptidase	NA	NA	NA	NA	NA
AUJ04515.1|1122524_1122833_+	glutaredoxin 3	NA	A0A2L0UZG6	Agrobacterium_phage	43.2	4.7e-07
AUJ04516.1|1122829_1123225_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AUJ04517.1|1123439_1124447_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
AUJ04518.1|1124587_1125349_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04519.1|1126555_1127614_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.6e-73
AUJ04520.1|1127770_1127953_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04521.1|1128930_1129899_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
AUJ04522.1|1131174_1131648_-	histidine kinase	NA	NA	NA	NA	NA
AUJ04523.1|1132186_1133479_+	trigger factor	NA	NA	NA	NA	NA
AUJ04524.1|1133571_1134198_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
>prophage 9
CP019089	Xanthomonas oryzae pv. oryzae strain MAI106 chromosome, complete genome	4705454	1243109	1320014	4705454	protease,transposase	Bacillus_phage(15.38%)	55	NA	NA
AUJ04602.1|1243109_1244507_-|protease	serine protease	protease	NA	NA	NA	NA
AUJ04603.1|1244934_1246905_+	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
AUJ04604.1|1246819_1247494_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04605.1|1247749_1248595_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07054.1|1248883_1251004_+	peptidase S9	NA	NA	NA	NA	NA
AUJ04606.1|1251280_1251742_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04607.1|1251873_1252599_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUJ04608.1|1253416_1255558_+	outer protein P	NA	NA	NA	NA	NA
AUJ04609.1|1255674_1257810_+	outer protein P	NA	NA	NA	NA	NA
AUJ04610.1|1258774_1258969_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04611.1|1259880_1261119_-	type III secretion system effector protein	NA	NA	NA	NA	NA
AUJ04612.1|1261944_1264050_-	catalase HPII	NA	A0A2K9L0T1	Tupanvirus	47.7	1.9e-136
AUJ04613.1|1264267_1264441_-	oxidoreductase	NA	NA	NA	NA	NA
AUJ04614.1|1265699_1266347_-	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	45.5	6.5e-35
AUJ04615.1|1266343_1266895_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04616.1|1267018_1267201_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07055.1|1267260_1270194_-	glycine dehydrogenase (aminomethyl-transferring)	NA	M4QFZ1	Prochlorococcus_phage	49.9	8.9e-257
AUJ04617.1|1270661_1270853_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07056.1|1271283_1272087_+	sulfotransferase	NA	M4QPS9	Synechococcus_phage	27.7	9.0e-26
AUJ07057.1|1272175_1273387_+	hemolysin D	NA	NA	NA	NA	NA
AUJ04618.1|1273383_1275543_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.0	2.2e-34
AUJ04619.1|1276351_1276756_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04620.1|1276837_1278856_-	peptidase M20	NA	NA	NA	NA	NA
AUJ04621.1|1278967_1280638_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
AUJ07058.1|1280634_1281399_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07059.1|1281498_1283169_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04622.1|1283451_1284168_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	2.8e-23
AUJ04623.1|1284160_1285453_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AUJ04624.1|1285604_1286096_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04625.1|1286164_1286422_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
AUJ04626.1|1286424_1287234_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
AUJ04627.1|1287269_1288010_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
AUJ04628.1|1288014_1288614_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUJ04629.1|1288858_1290055_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AUJ04630.1|1290054_1290696_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUJ04631.1|1291046_1292243_+	polyketide cyclase	NA	NA	NA	NA	NA
AUJ04632.1|1292324_1292711_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04633.1|1292713_1293388_+	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
AUJ07060.1|1293451_1294078_-	peptidase	NA	NA	NA	NA	NA
AUJ04634.1|1294379_1294559_-	Arc family DNA binding domain-containing protein	NA	NA	NA	NA	NA
AUJ04635.1|1294555_1294840_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04636.1|1295455_1296658_+	phosphoribosylglycinamide formyltransferase 2	NA	NA	NA	NA	NA
AUJ04637.1|1297634_1298366_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04638.1|1298565_1299444_+	hypothetical protein	NA	A8ATW4	Listeria_phage	34.5	3.9e-06
AUJ04639.1|1299551_1299812_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04640.1|1299871_1301353_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04641.1|1305101_1306085_+	type VI secretion-associated protein	NA	NA	NA	NA	NA
AUJ04642.1|1306081_1306876_+	cell envelope biogenesis protein OmpA	NA	NA	NA	NA	NA
AUJ04643.1|1306928_1307999_-	type VI secretion protein	NA	NA	NA	NA	NA
AUJ04644.1|1308902_1309961_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.8e-74
AUJ04645.1|1310032_1312855_+	type IV secretion protein Rhs	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.4	1.0e-52
AUJ07061.1|1313360_1314377_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.3	7.3e-49
AUJ04646.1|1315484_1316861_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	3.0e-77
AUJ04647.1|1317004_1318381_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.6	5.1e-61
AUJ04648.1|1319045_1320014_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
>prophage 10
CP019089	Xanthomonas oryzae pv. oryzae strain MAI106 chromosome, complete genome	4705454	1342425	1395064	4705454	transposase	Ralstonia_phage(27.27%)	43	NA	NA
AUJ04663.1|1342425_1343412_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.6e-43
AUJ04664.1|1343264_1343528_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ04665.1|1343572_1344349_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	53.1	4.1e-52
AUJ04666.1|1346036_1347101_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
AUJ04667.1|1347115_1347367_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07064.1|1347666_1348779_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
AUJ04668.1|1348775_1349318_-	shikimate kinase	NA	NA	NA	NA	NA
AUJ04669.1|1349484_1350084_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
AUJ04670.1|1350264_1350681_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04671.1|1350693_1351467_+	PspA-IM30 family protein	NA	NA	NA	NA	NA
AUJ04672.1|1351492_1352575_+	potassium channel protein	NA	NA	NA	NA	NA
AUJ04673.1|1352577_1353249_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04674.1|1353286_1353691_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
AUJ04675.1|1353703_1354276_+	hypothetical protein	NA	A0A191ZBZ0	Erwinia_phage	28.1	6.4e-10
AUJ04676.1|1354277_1355444_+	hypothetical protein	NA	B2ZXR7	Ralstonia_phage	41.6	6.4e-73
AUJ07065.1|1358389_1360072_+	peptidase M1	NA	NA	NA	NA	NA
AUJ04677.1|1361121_1364268_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUJ04678.1|1364287_1364524_-	transcriptional regulator	NA	NA	NA	NA	NA
AUJ04679.1|1364599_1365352_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AUJ04680.1|1365362_1366409_+	cupin	NA	NA	NA	NA	NA
AUJ04681.1|1366449_1367967_+	tryptophan halogenase	NA	A0A1D7SF58	Cyanophage	31.8	5.8e-50
AUJ04682.1|1368004_1369009_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AUJ07066.1|1369153_1369552_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04683.1|1369683_1371060_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	6.0e-78
AUJ04684.1|1371202_1371388_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07067.1|1371648_1372602_-	endoproteinase ArgC	NA	NA	NA	NA	NA
AUJ04685.1|1373487_1374870_-	porin	NA	NA	NA	NA	NA
AUJ04686.1|1375062_1375827_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ04687.1|1376140_1377082_+	amino acid amidase	NA	NA	NA	NA	NA
AUJ04688.1|1377837_1379226_+	amino acid transporter	NA	NA	NA	NA	NA
AUJ07068.1|1381175_1382594_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	41.0	8.8e-93
AUJ04689.1|1382586_1383489_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04690.1|1383488_1384730_-	DNA (cytosine-5-)-methyltransferase	NA	M1PSQ0	Streptococcus_phage	34.7	3.2e-54
AUJ04691.1|1384962_1385931_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.6e-98
AUJ04692.1|1387051_1388068_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AUJ07069.1|1388128_1388923_-	phospholipase	NA	NA	NA	NA	NA
AUJ04693.1|1389082_1390444_-	magnesium transporter	NA	NA	NA	NA	NA
AUJ04694.1|1390506_1390731_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04695.1|1390731_1392462_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	24.1	1.0e-10
AUJ04696.1|1392520_1392790_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AUJ04697.1|1392782_1393175_-	PTS fructose IIA subunit family protein	NA	NA	NA	NA	NA
AUJ04698.1|1393568_1394537_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
AUJ04699.1|1394662_1395064_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 11
CP019089	Xanthomonas oryzae pv. oryzae strain MAI106 chromosome, complete genome	4705454	1419933	1482858	4705454	transposase	Ralstonia_phage(27.27%)	55	NA	NA
AUJ04728.1|1419933_1420992_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.2e-75
AUJ04729.1|1421058_1422027_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
AUJ04730.1|1422330_1422660_-	benzene 1,2-dioxygenase	NA	NA	NA	NA	NA
AUJ04731.1|1422656_1423196_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUJ04732.1|1423405_1424374_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
AUJ04733.1|1424487_1425732_-	cysteine sulfinate desulfinase	NA	Q2XUY6	environmental_halophage	41.7	5.0e-92
AUJ04734.1|1425728_1426991_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
AUJ04735.1|1426990_1427755_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.5	2.0e-11
AUJ04736.1|1428012_1429470_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
AUJ04737.1|1429485_1429944_-	transcriptional regulator	NA	NA	NA	NA	NA
AUJ04738.1|1430115_1430583_+	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
AUJ04739.1|1430687_1430906_+	peptidase	NA	NA	NA	NA	NA
AUJ04740.1|1431512_1432109_-	DUF1439 domain-containing protein	NA	NA	NA	NA	NA
AUJ04741.1|1432164_1432707_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04742.1|1432764_1433106_-	DUF3861 domain-containing protein	NA	NA	NA	NA	NA
AUJ07072.1|1433163_1433778_-	peptidase	NA	NA	NA	NA	NA
AUJ04743.1|1433909_1434335_-	DNA-binding protein	NA	NA	NA	NA	NA
AUJ04744.1|1434890_1435889_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
AUJ04745.1|1435794_1436487_-	YggS family pyridoxal phosphate enzyme	NA	NA	NA	NA	NA
AUJ04746.1|1437668_1438706_+	twitching motility protein PilT	NA	NA	NA	NA	NA
AUJ04747.1|1438819_1439950_+	type IV pili twitching motility protein PilT	NA	NA	NA	NA	NA
AUJ07073.1|1440239_1440896_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04748.1|1441998_1442571_-	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
AUJ04749.1|1442567_1443002_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04750.1|1443847_1444414_+	DUF179 domain-containing protein	NA	NA	NA	NA	NA
AUJ04751.1|1444886_1445834_+	aspartate carbamoyltransferase	NA	NA	NA	NA	NA
AUJ04752.1|1446270_1446705_+	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AUJ04753.1|1446887_1447457_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04754.1|1447754_1448636_-	phenazine biosynthesis protein PhzF family	NA	NA	NA	NA	NA
AUJ04755.1|1449728_1452338_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
AUJ04756.1|1452321_1452780_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04757.1|1452776_1454132_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04758.1|1454112_1455519_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
AUJ04759.1|1455565_1455739_+	AsmA family protein	NA	NA	NA	NA	NA
AUJ07074.1|1455874_1456657_+	dienelactone hydrolase	NA	NA	NA	NA	NA
AUJ04760.1|1456751_1457720_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.5e-99
AUJ04761.1|1457974_1458973_-	octaprenyl-diphosphate synthase	NA	NA	NA	NA	NA
AUJ04762.1|1459248_1459782_+	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	60.9	1.9e-32
AUJ04763.1|1460064_1461549_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.5	5.0e-14
AUJ04764.1|1465061_1465739_+	HAD family hydrolase	NA	NA	NA	NA	NA
AUJ04765.1|1465974_1466181_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04766.1|1466275_1466500_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04767.1|1466499_1468572_-	carbon starvation protein A	NA	NA	NA	NA	NA
AUJ07075.1|1468855_1469662_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04768.1|1469832_1470120_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04769.1|1470523_1473340_+	type IV secretion protein Rhs	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.6	4.7e-53
AUJ04770.1|1473339_1474236_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04771.1|1474232_1474697_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04772.1|1474717_1475200_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07076.1|1475349_1475829_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04773.1|1475915_1477652_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04774.1|1478122_1478317_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04775.1|1478432_1479809_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
AUJ04776.1|1480459_1481056_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04777.1|1481481_1482858_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.0e-77
>prophage 12
CP019089	Xanthomonas oryzae pv. oryzae strain MAI106 chromosome, complete genome	4705454	1490484	1527268	4705454	tRNA,transposase	Shigella_phage(42.86%)	30	NA	NA
AUJ07079.1|1490484_1491339_+|transposase	transposase	transposase	U5P429	Shigella_phage	57.3	4.1e-85
AUJ07080.1|1491470_1492592_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
AUJ04781.1|1492606_1493434_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUJ04782.1|1493417_1494701_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AUJ04783.1|1494727_1495243_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07081.1|1495253_1497266_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.5	1.3e-09
AUJ07082.1|1497321_1497504_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04784.1|1497478_1499482_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
AUJ04785.1|1499500_1499830_-	anti-anti-sigma factor	NA	NA	NA	NA	NA
AUJ04786.1|1500319_1503784_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
AUJ04787.1|1503897_1504089_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04788.1|1504177_1504720_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUJ07083.1|1505144_1506053_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
AUJ04789.1|1507583_1508396_-	peptidase C1	NA	NA	NA	NA	NA
AUJ04790.1|1509341_1509953_+	N-acetyltransferase	NA	NA	NA	NA	NA
AUJ04791.1|1510071_1510956_+	nitrilase	NA	NA	NA	NA	NA
AUJ04792.1|1510977_1512069_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04793.1|1512137_1513541_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
AUJ04794.1|1513554_1514061_+	Fur family transcriptional regulator	NA	NA	NA	NA	NA
AUJ04795.1|1514463_1514922_+	cupin	NA	NA	NA	NA	NA
AUJ04796.1|1515699_1515903_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04797.1|1516066_1516339_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	58.8	1.2e-19
AUJ04798.1|1516356_1517211_+|transposase	transposase	transposase	U5P429	Shigella_phage	56.9	9.1e-85
AUJ04799.1|1517319_1518336_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
AUJ04800.1|1518621_1519998_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	53.7	8.9e-74
AUJ07084.1|1520025_1520916_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04801.1|1521602_1522199_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07085.1|1524738_1525011_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04802.1|1525682_1526213_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04803.1|1526209_1527268_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	8.9e-74
>prophage 13
CP019089	Xanthomonas oryzae pv. oryzae strain MAI106 chromosome, complete genome	4705454	1569931	1633604	4705454	tRNA,protease,transposase	Ralstonia_phage(30.0%)	52	NA	NA
AUJ04830.1|1569931_1570900_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
AUJ04831.1|1571223_1571517_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07091.1|1571595_1572009_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07092.1|1572700_1573609_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AUJ04832.1|1573737_1573971_-	DUF378 domain-containing protein	NA	NA	NA	NA	NA
AUJ04833.1|1574444_1574738_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04834.1|1575630_1576080_-	tetrameric acyl-CoA thioesterase	NA	NA	NA	NA	NA
AUJ04835.1|1576345_1577203_-	co-chaperone YbbN	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.0e-11
AUJ04836.1|1577407_1578019_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04837.1|1578117_1580760_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	40.0	4.7e-172
AUJ04838.1|1581273_1581909_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04839.1|1581931_1582960_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
AUJ04840.1|1582956_1583856_+	nicotinic acid mononucleotide adenylyltransferase	NA	NA	NA	NA	NA
AUJ04841.1|1583912_1584329_+	ribosome silencing factor RsfS	NA	NA	NA	NA	NA
AUJ04842.1|1584340_1585456_+	molecular chaperone DnaJ	NA	NA	NA	NA	NA
AUJ04843.1|1585781_1585991_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04844.1|1586545_1587016_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
AUJ04845.1|1587453_1588128_-	energy transducer TonB	NA	NA	NA	NA	NA
AUJ04846.1|1588438_1591549_-	Oar protein	NA	NA	NA	NA	NA
AUJ04847.1|1592015_1592750_-	SIMPL domain-containing protein	NA	NA	NA	NA	NA
AUJ04848.1|1592888_1593461_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AUJ04849.1|1593460_1594960_+	ribonuclease E/G	NA	NA	NA	NA	NA
AUJ04850.1|1595100_1599021_+	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
AUJ07093.1|1599026_1599779_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04851.1|1599877_1601323_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AUJ04852.1|1601579_1602161_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07094.1|1602306_1603674_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
AUJ07095.1|1603748_1604153_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07096.1|1604279_1604666_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04853.1|1604735_1605833_-|protease	protease	protease	NA	NA	NA	NA
AUJ04854.1|1606561_1607038_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ04855.1|1607149_1608025_-	(2E,6E)-farnesyl diphosphate synthase	NA	NA	NA	NA	NA
AUJ04856.1|1608026_1608287_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
AUJ04857.1|1608318_1609623_-|tRNA	tRNA(Ile)-lysidine synthase	tRNA	NA	NA	NA	NA
AUJ04858.1|1609656_1611363_-	alkaline phosphatase	NA	NA	NA	NA	NA
AUJ04859.1|1611505_1612846_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
AUJ07097.1|1613017_1613692_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUJ04860.1|1613938_1614430_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AUJ04861.1|1614637_1615387_-	hypothetical protein	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
AUJ07098.1|1615496_1616069_-	glycoside hydrolase	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.4e-19
AUJ04862.1|1616143_1616623_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AUJ04863.1|1616851_1618096_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04864.1|1618103_1619354_+	amino acid dehydrogenase	NA	NA	NA	NA	NA
AUJ04865.1|1619350_1620721_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.8	2.4e-34
AUJ04866.1|1621107_1621377_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ04867.1|1622233_1622575_+	cysteine methyltransferase	NA	NA	NA	NA	NA
AUJ04868.1|1622615_1623314_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AUJ04869.1|1623564_1624533_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
AUJ04870.1|1625116_1626142_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.9e-49
AUJ04871.1|1628537_1630553_-	peptidase M13	NA	NA	NA	NA	NA
AUJ07099.1|1631222_1632239_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	9.6e-49
AUJ04872.1|1632635_1633604_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
>prophage 14
CP019089	Xanthomonas oryzae pv. oryzae strain MAI106 chromosome, complete genome	4705454	1698530	1757267	4705454	tRNA,transposase,integrase	Tetraselmis_virus(12.5%)	50	1696921:1696937	1771704:1771720
1696921:1696937	attL	TGGCCGAAGGCCGCGCC	NA	NA	NA	NA
AUJ04927.1|1698530_1699457_+|tRNA	tRNA pseudouridine(55) synthase	tRNA	NA	NA	NA	NA
AUJ04928.1|1699613_1699874_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
AUJ04929.1|1700040_1702155_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
AUJ04930.1|1702528_1703569_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04931.1|1703632_1704508_-	nicotinate-nucleotide diphosphorylase (carboxylating)	NA	NA	NA	NA	NA
AUJ04932.1|1704504_1704774_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04933.1|1704832_1705336_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	38.7	3.6e-17
AUJ04934.1|1705332_1706478_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AUJ04935.1|1706619_1707198_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	39.6	8.4e-34
AUJ04936.1|1707319_1707640_+	monothiol glutaredoxin, Grx4 family	NA	NA	NA	NA	NA
AUJ04937.1|1707636_1708380_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUJ04938.1|1708376_1708976_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04939.1|1709745_1712940_+	Oar protein	NA	NA	NA	NA	NA
AUJ04940.1|1713046_1714432_+	LOG family protein	NA	NA	NA	NA	NA
AUJ04941.1|1714601_1715117_+	pre-pilin like leader sequence	NA	A0A1W6JT76	Pseudomonas_phage	42.5	1.1e-05
AUJ04942.1|1715113_1715590_+	type IV pilus modification protein PilV	NA	NA	NA	NA	NA
AUJ04943.1|1715586_1716753_+	pilus assembly protein PilW	NA	NA	NA	NA	NA
AUJ04944.1|1716756_1717266_+	pilus assembly protein	NA	NA	NA	NA	NA
AUJ07107.1|1717222_1721224_+	pilus assembly protein	NA	NA	NA	NA	NA
AUJ04945.1|1721236_1721686_+	pilus assembly protein PilE	NA	NA	NA	NA	NA
AUJ04946.1|1721862_1722405_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
AUJ04947.1|1722543_1724565_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AUJ04948.1|1725779_1726049_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ07108.1|1726359_1726794_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04949.1|1727217_1728312_-	acyltransferase	NA	NA	NA	NA	NA
AUJ04950.1|1728739_1730407_-	urocanate hydratase	NA	NA	NA	NA	NA
AUJ04951.1|1730423_1731281_-	N-formylglutamate deformylase	NA	NA	NA	NA	NA
AUJ04952.1|1731465_1733007_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	42.8	2.7e-79
AUJ04953.1|1733020_1734226_-	imidazolonepropionase	NA	NA	NA	NA	NA
AUJ04954.1|1734301_1735657_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
AUJ04955.1|1736011_1736716_+	histidine utilization repressor	NA	NA	NA	NA	NA
AUJ04956.1|1736872_1737877_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ04957.1|1738449_1739013_-	poly(hydroxyalcanoate) granule associated protein	NA	NA	NA	NA	NA
AUJ04958.1|1739174_1739450_-	polyhydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
AUJ07109.1|1739690_1740500_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ04959.1|1740441_1741098_-	sulfoxide reductase heme-binding subunit YedZ	NA	NA	NA	NA	NA
AUJ04960.1|1741399_1742368_-	mononuclear molybdenum enzyme YedY	NA	NA	NA	NA	NA
AUJ04961.1|1742542_1743628_+	phosphoserine transaminase	NA	M1Q1P2	Streptococcus_phage	43.6	1.7e-75
AUJ04962.1|1743710_1744919_+	chorismate mutase	NA	NA	NA	NA	NA
AUJ04963.1|1745040_1746354_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AUJ04964.1|1746717_1747194_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ04965.1|1747382_1747652_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ04966.1|1747504_1748491_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.6e-43
AUJ07110.1|1748910_1749378_-	energy transducer TonB	NA	NA	NA	NA	NA
AUJ04967.1|1749808_1750777_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
AUJ04968.1|1750898_1751666_-	energy transducer TonB	NA	NA	NA	NA	NA
AUJ04969.1|1751672_1753064_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	49.6	1.0e-93
AUJ04970.1|1753524_1754109_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AUJ04971.1|1754208_1755225_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ07111.1|1755848_1757267_+|integrase	integrase	integrase	NA	NA	NA	NA
1771704:1771720	attR	TGGCCGAAGGCCGCGCC	NA	NA	NA	NA
>prophage 15
CP019089	Xanthomonas oryzae pv. oryzae strain MAI106 chromosome, complete genome	4705454	1839141	1849029	4705454	tRNA	Escherichia_phage(28.57%)	9	NA	NA
AUJ07125.1|1839141_1840818_+	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.3	2.1e-37
AUJ05033.1|1840906_1841548_+	LexA repressor 2	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
AUJ05034.1|1841720_1842755_+	DNA recombination/repair protein RecA	NA	A0A0S2MVG1	Bacillus_phage	61.0	1.6e-112
AUJ05035.1|1843056_1843545_+	recombination regulator RecX	NA	NA	NA	NA	NA
AUJ05036.1|1843646_1846295_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.8	2.4e-83
AUJ05037.1|1846434_1846647_+	carbon storage regulator	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
AUJ05038.1|1847174_1847357_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ05039.1|1848368_1848623_+	hypothetical protein	NA	A0A0N7C1X7	Escherichia_phage	59.6	4.5e-08
AUJ05040.1|1848537_1849029_+	lysozyme	NA	D5LH07	Escherichia_phage	67.7	4.6e-57
>prophage 16
CP019089	Xanthomonas oryzae pv. oryzae strain MAI106 chromosome, complete genome	4705454	1974630	2059402	4705454	tRNA,transposase	uncultured_Caudovirales_phage(36.36%)	53	NA	NA
AUJ05144.1|1974630_1976148_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.5	8.6e-86
AUJ05145.1|1976289_1977426_+	two-component system response regulator	NA	NA	NA	NA	NA
AUJ05146.1|1977427_1977766_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ05147.1|1977790_1979968_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	33.1	1.3e-47
AUJ05148.1|1979979_1980849_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUJ05149.1|1981025_1982708_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.2	2.1e-32
AUJ05150.1|1983357_1986126_-	aconitate hydratase	NA	NA	NA	NA	NA
AUJ05151.1|1986273_1986522_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
AUJ05152.1|1986518_1986929_+	VapC toxin family PIN domain ribonuclease	NA	NA	NA	NA	NA
AUJ05153.1|1986994_1989586_+	aconitate hydratase B	NA	NA	NA	NA	NA
AUJ05154.1|1989939_1990755_+	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
AUJ05155.1|1991410_1993597_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	NA	NA	NA	NA
AUJ05156.1|1993762_1994839_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
AUJ05157.1|1994835_1995432_-	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
AUJ05158.1|1995428_1996295_-	chemotaxis protein CheR	NA	NA	NA	NA	NA
AUJ05159.1|1996540_1998931_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	58.3	3.9e-08
AUJ05160.1|1999009_1999393_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ05161.1|1999708_2000191_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
AUJ05162.1|2000326_2001124_-	pilus assembly protein PilZ	NA	NA	NA	NA	NA
AUJ05163.1|2002165_2004427_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.5	1.3e-10
AUJ05164.1|2004838_2007100_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.7	2.5e-12
AUJ07134.1|2007691_2009656_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	47.4	1.5e-10
AUJ05165.1|2010211_2011270_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.2e-75
AUJ05166.1|2014270_2016514_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.8	3.4e-14
AUJ05167.1|2016772_2018149_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
AUJ05168.1|2018430_2020644_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.2	1.9e-09
AUJ05169.1|2020841_2023211_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.7	2.7e-09
AUJ05170.1|2023224_2023986_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ05171.1|2029492_2031754_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.4	2.8e-08
AUJ05172.1|2032652_2034662_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
AUJ05173.1|2034695_2035061_-	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.7e-14
AUJ05174.1|2035057_2035366_-	anti-anti-sigma factor	NA	NA	NA	NA	NA
AUJ05175.1|2035466_2036489_-	chemotaxis protein	NA	NA	NA	NA	NA
AUJ05176.1|2036485_2037268_-	chromosome partitioning protein ParA	NA	Q8JL10	Natrialba_phage	35.7	1.7e-13
AUJ05177.1|2037269_2038244_-	flagellar motor protein MotD	NA	NA	NA	NA	NA
AUJ05178.1|2038250_2038991_-	flagellar motor protein	NA	NA	NA	NA	NA
AUJ05179.1|2039079_2039433_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ05180.1|2041719_2042427_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	51.2	1.4e-51
AUJ05181.1|2042429_2043374_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ05182.1|2043943_2046163_-	TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	28.6	3.7e-05
AUJ05183.1|2046417_2046870_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07135.1|2047761_2050803_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUJ05184.1|2051481_2052450_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
AUJ05185.1|2052448_2052886_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ05186.1|2052933_2053368_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ05187.1|2054762_2055086_+	hypothetical protein	NA	Q6H9S4	Enterobacteria_phage	57.9	2.0e-24
AUJ05188.1|2055082_2055985_+|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	67.7	1.6e-103
AUJ05189.1|2056080_2056482_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ05190.1|2056478_2056988_+	hypothetical protein	NA	A4PE24	Ralstonia_virus	36.0	1.3e-09
AUJ07136.1|2056968_2057310_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ05191.1|2057323_2057920_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ05192.1|2057817_2058027_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ05193.1|2058025_2059402_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
>prophage 17
CP019089	Xanthomonas oryzae pv. oryzae strain MAI106 chromosome, complete genome	4705454	2139472	2201913	4705454	tRNA,protease,transposase	Ralstonia_phage(25.0%)	47	NA	NA
AUJ05258.1|2139472_2140609_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AUJ05259.1|2140605_2141064_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AUJ05260.1|2141314_2141635_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.3e-12
AUJ05261.1|2141777_2144060_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.6	5.1e-175
AUJ05262.1|2144267_2144486_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AUJ07141.1|2144566_2145319_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AUJ05263.1|2145452_2146082_-	cinnamoyl-CoA reductase	NA	NA	NA	NA	NA
AUJ05264.1|2146757_2147879_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUJ05265.1|2147936_2148905_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	2.0e-64
AUJ05266.1|2149188_2151546_+	cell division protein FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
AUJ05267.1|2151708_2153637_+	transglutaminase	NA	NA	NA	NA	NA
AUJ07142.1|2153743_2154373_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AUJ05268.1|2154485_2158652_-	type III effector	NA	NA	NA	NA	NA
AUJ07143.1|2158888_2160265_+	recombination factor protein RarA	NA	G3MBE0	Bacillus_virus	38.3	4.0e-74
AUJ05269.1|2160296_2160623_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ05270.1|2160619_2161027_-	fluoride ion transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	7.5e-21
AUJ05271.1|2161058_2161409_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ05272.1|2161405_2162737_-	voltage-gated chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.5	8.7e-42
AUJ05273.1|2163057_2164263_-	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
AUJ05274.1|2164427_2166800_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUJ05275.1|2166824_2167457_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ05276.1|2167675_2168101_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
AUJ05277.1|2168119_2169325_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
AUJ05278.1|2169335_2170124_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
AUJ05279.1|2170120_2170981_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ05280.1|2171051_2171690_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ05281.1|2171686_2172907_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
AUJ05282.1|2172917_2174315_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
AUJ05283.1|2174629_2175850_+	molybdopterin molybdenumtransferase MoeA	NA	NA	NA	NA	NA
AUJ05284.1|2176341_2177502_-	molybdopterin biosynthesis protein MoeB	NA	NA	NA	NA	NA
AUJ07144.1|2178350_2179367_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.3	3.3e-49
AUJ05285.1|2180449_2181418_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	2.8e-98
AUJ05286.1|2181566_2181956_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ05287.1|2181894_2182272_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ05288.1|2182477_2183731_+	molybdopterin molybdenumtransferase MoeA	NA	NA	NA	NA	NA
AUJ05289.1|2183768_2184338_+	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
AUJ05290.1|2184321_2184684_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ05291.1|2187058_2188036_-	siroheme synthase	NA	NA	NA	NA	NA
AUJ05292.1|2189357_2189546_+	nitrate transport ATP-binding protein	NA	NA	NA	NA	NA
AUJ05293.1|2189558_2189834_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ05294.1|2190478_2190736_+	stress-induced protein	NA	NA	NA	NA	NA
AUJ05295.1|2190961_2191930_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.1e-99
AUJ05296.1|2192571_2193057_+	YciE/YciF family protein	NA	NA	NA	NA	NA
AUJ05297.1|2193163_2194084_+	peptidase	NA	NA	NA	NA	NA
AUJ05298.1|2195273_2197085_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AUJ05299.1|2197835_2200934_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ05300.1|2200944_2201913_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	5.6e-99
>prophage 18
CP019089	Xanthomonas oryzae pv. oryzae strain MAI106 chromosome, complete genome	4705454	2315433	2374295	4705454	transposase	Leptospira_phage(25.0%)	40	NA	NA
AUJ05326.1|2315433_2315928_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	39.7	3.1e-29
AUJ05327.1|2317906_2321032_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
AUJ05328.1|2321083_2322196_-	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUJ05329.1|2322319_2322898_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ05330.1|2324075_2324633_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ05331.1|2325452_2327540_+	type III effector	NA	NA	NA	NA	NA
AUJ07147.1|2329477_2332567_+	histidine kinase	NA	NA	NA	NA	NA
AUJ05332.1|2332952_2333738_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	47.6	2.8e-48
AUJ05333.1|2334544_2334850_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ05334.1|2334851_2335559_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUJ05335.1|2335555_2336548_+	cytochrome-c peroxidase	NA	NA	NA	NA	NA
AUJ05336.1|2336544_2339004_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AUJ05337.1|2339117_2340098_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ05338.1|2340106_2341135_+	type VI secretion system protein ImpA	NA	NA	NA	NA	NA
AUJ05339.1|2341307_2341634_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ05340.1|2341630_2344534_-	serine/threonine protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	25.0	1.9e-09
AUJ05341.1|2344530_2345253_-	phosphoprotein phosphatase	NA	NA	NA	NA	NA
AUJ05342.1|2345249_2345897_-	type VI secretion-associated protein	NA	NA	NA	NA	NA
AUJ05343.1|2345893_2349352_-	type VI secretion protein	NA	NA	NA	NA	NA
AUJ05344.1|2349355_2350672_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ05345.1|2350673_2352011_-	type VI secretion system-associated protein	NA	NA	NA	NA	NA
AUJ05346.1|2352007_2353396_-	peptide-binding protein	NA	NA	NA	NA	NA
AUJ05347.1|2353392_2353932_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ05348.1|2353940_2355878_-	type IV secretion protein Rhs	NA	A0A077K8Q4	Ralstonia_phage	28.6	7.7e-39
AUJ05349.1|2356141_2356603_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ05350.1|2356705_2356909_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ05351.1|2357953_2359330_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	4.6e-78
AUJ05352.1|2359492_2360461_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
AUJ05353.1|2360555_2360906_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ05354.1|2360902_2363674_-	ClpV1 family T6SS ATPase	NA	H6X3M6	Enterobacteria_phage	29.3	1.2e-77
AUJ05355.1|2363706_2364717_-	type VI secretion protein	NA	NA	NA	NA	NA
AUJ05356.1|2364680_2366558_-	type VI secretion system protein ImpG	NA	NA	NA	NA	NA
AUJ05357.1|2366561_2367065_-	type VI secretion system lysozyme	NA	NA	NA	NA	NA
AUJ05358.1|2367052_2367886_-	ImpE protein	NA	NA	NA	NA	NA
AUJ05359.1|2367921_2368425_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ05360.1|2368524_2370039_-	EvpB family type VI secretion protein	NA	NA	NA	NA	NA
AUJ07148.1|2370031_2370538_-	type VI secretion system-associated protein	NA	NA	NA	NA	NA
AUJ05361.1|2371204_2371681_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ07149.1|2373041_2373245_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ05362.1|2373281_2374295_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.0	6.6e-42
>prophage 19
CP019089	Xanthomonas oryzae pv. oryzae strain MAI106 chromosome, complete genome	4705454	2624852	2708006	4705454	tRNA,transposase	Ralstonia_phage(18.18%)	45	NA	NA
AUJ05549.1|2624852_2626307_+|tRNA	tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase	tRNA	NA	NA	NA	NA
AUJ05550.1|2626730_2627717_+	PhoH family protein	NA	A0A1B2ICF6	Erwinia_phage	47.7	4.8e-45
AUJ07172.1|2628101_2628791_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ05551.1|2628845_2629331_+	endoribonuclease YbeY	NA	NA	NA	NA	NA
AUJ05552.1|2629330_2629849_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ05553.1|2629943_2630822_+	magnesium/cobalt efflux protein	NA	NA	NA	NA	NA
AUJ07173.1|2630836_2632099_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ05554.1|2632114_2633116_+	magnesium transporter CorA	NA	NA	NA	NA	NA
AUJ07174.1|2633267_2634632_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUJ05555.1|2635106_2635955_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AUJ05556.1|2635951_2636863_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AUJ05557.1|2636991_2638125_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	7.4e-26
AUJ05558.1|2638270_2639782_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ05559.1|2639768_2641355_-	MFS transporter	NA	NA	NA	NA	NA
AUJ05560.1|2641351_2642554_-	multidrug ABC transporter permease	NA	NA	NA	NA	NA
AUJ05561.1|2643402_2644371_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	3.6e-98
AUJ05562.1|2646990_2648376_-	glutamine synthetase	NA	NA	NA	NA	NA
AUJ07175.1|2649022_2650402_+	glutamine synthetase	NA	NA	NA	NA	NA
AUJ05563.1|2650401_2651718_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AUJ05564.1|2651854_2653099_+	diguanylate cyclase response regulator	NA	A0A127AWB9	Bacillus_phage	36.4	1.9e-19
AUJ05565.1|2653404_2654685_-	MFS transporter	NA	NA	NA	NA	NA
AUJ05566.1|2654986_2655295_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ05567.1|2655254_2657603_-	CbbBc protein	NA	NA	NA	NA	NA
AUJ05568.1|2657599_2658445_-	sulfurtransferase FdhD	NA	NA	NA	NA	NA
AUJ05569.1|2658451_2660131_-	MFS transporter	NA	NA	NA	NA	NA
AUJ05570.1|2660659_2662012_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AUJ05571.1|2662072_2665204_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ05572.1|2665368_2666223_+	plasmid replication/partition related protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	38.7	3.2e-13
AUJ05573.1|2666393_2667698_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ05574.1|2673025_2673994_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
AUJ05575.1|2674480_2679490_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
AUJ05576.1|2679767_2680427_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ05577.1|2680441_2681749_+	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUJ05578.1|2687622_2688618_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUJ05579.1|2688778_2691295_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	6.3e-09
AUJ05580.1|2691291_2692248_+	1-phosphofructokinase	NA	NA	NA	NA	NA
AUJ05581.1|2692406_2694149_+	PTS fructose transporter subunit EIIBC	NA	NA	NA	NA	NA
AUJ07176.1|2694467_2695604_+	carbohydrate porin	NA	NA	NA	NA	NA
AUJ05582.1|2695998_2698761_+	type IV secretion protein Rhs	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.4	3.6e-42
AUJ05583.1|2699031_2699757_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07177.1|2700235_2701252_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
AUJ05584.1|2703827_2704571_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ05585.1|2705187_2706564_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
AUJ05586.1|2706903_2707167_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ05587.1|2707019_2708006_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-43
>prophage 20
CP019089	Xanthomonas oryzae pv. oryzae strain MAI106 chromosome, complete genome	4705454	2901995	2946925	4705454	transposase	Ralstonia_phage(13.33%)	36	NA	NA
AUJ05725.1|2901995_2902964_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
AUJ07201.1|2904355_2905372_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
AUJ05726.1|2905544_2906447_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ05727.1|2906644_2908012_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	47.9	1.6e-112
AUJ05728.1|2908263_2908776_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ05729.1|2908705_2908945_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ05730.1|2909287_2910787_+	transcriptional regulator	NA	NA	NA	NA	NA
AUJ05731.1|2910783_2911716_+	N-acetyltransferase	NA	NA	NA	NA	NA
AUJ05732.1|2911896_2914725_+	2-oxoglutarate dehydrogenase subunit E1	NA	NA	NA	NA	NA
AUJ05733.1|2914767_2915970_+	dihydrolipoamide succinyltransferase	NA	NA	NA	NA	NA
AUJ05734.1|2916211_2917648_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.8	3.7e-38
AUJ05735.1|2917846_2918440_+	Rossman fold protein, TIGR00730 family	NA	A0A2I2L3F0	Orpheovirus	27.5	2.1e-11
AUJ07202.1|2918704_2919298_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	8.1e-16
AUJ05736.1|2919294_2921064_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.5	5.2e-58
AUJ05737.1|2921306_2922161_+	RND transporter	NA	NA	NA	NA	NA
AUJ05738.1|2922157_2923561_+	multidrug transporter	NA	NA	NA	NA	NA
AUJ05739.1|2923912_2924107_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ05740.1|2924386_2925508_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
AUJ05741.1|2925504_2926422_-	pyridoxal kinase	NA	NA	NA	NA	NA
AUJ05742.1|2926949_2928080_-	molecular chaperone DnaJ	NA	Q8QNB4	Ectocarpus_siliculosus_virus	30.0	1.4e-24
AUJ05743.1|2928239_2930165_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.6	2.2e-147
AUJ05744.1|2930306_2930825_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AUJ05745.1|2930925_2931978_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
AUJ05746.1|2932094_2933759_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AUJ05747.1|2934201_2934627_-	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
AUJ05748.1|2934716_2935112_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ05749.1|2935458_2935734_-	RnfH family protein	NA	NA	NA	NA	NA
AUJ05750.1|2935747_2936179_-	ubiquinone-binding protein	NA	NA	NA	NA	NA
AUJ05751.1|2936239_2936743_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	41.9	5.8e-23
AUJ05752.1|2936907_2939355_-	serine peptidase	NA	A0A218KC60	Bacillus_phage	26.7	2.6e-15
AUJ05753.1|2940475_2940856_-	hypothetical protein	NA	Q6H9S4	Enterobacteria_phage	56.2	2.3e-19
AUJ05754.1|2941103_2942072_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
AUJ05755.1|2942293_2943670_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.3	7.3e-60
AUJ07203.1|2944438_2945131_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ05756.1|2945822_2946086_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ05757.1|2945938_2946925_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-43
>prophage 21
CP019089	Xanthomonas oryzae pv. oryzae strain MAI106 chromosome, complete genome	4705454	2956453	3018503	4705454	tRNA,protease,transposase	Acidithiobacillus_phage(17.65%)	47	NA	NA
AUJ05764.1|2956453_2957830_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
AUJ05765.1|2957880_2958924_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.1	1.5e-76
AUJ05766.1|2958972_2959236_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ05767.1|2959088_2960075_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-43
AUJ05768.1|2961454_2961679_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07206.1|2961712_2962828_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AUJ05769.1|2963424_2964399_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.0	2.6e-19
AUJ05770.1|2966261_2966987_-	OmpA family lipoprotein	NA	G3M9Z0	Bacillus_virus	33.9	1.8e-09
AUJ07207.1|2966996_2967176_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ05771.1|2967771_2968248_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ05772.1|2968255_2969710_-	deoxyribodipyrimidine photolyase	NA	A0A1V0S949	Catovirus	31.5	4.4e-47
AUJ05773.1|2969776_2971207_-	replicative DNA helicase	NA	O80281	Escherichia_phage	53.6	3.8e-120
AUJ05774.1|2971428_2971983_-	NADPH-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	34.1	1.2e-18
AUJ05775.1|2972199_2974140_-	asparagine synthetase B	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.8	2.6e-26
AUJ07208.1|2974315_2974945_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUJ05776.1|2979020_2979812_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ05777.1|2979957_2980173_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ05778.1|2980172_2980940_+	DNAase	NA	NA	NA	NA	NA
AUJ05779.1|2981001_2981832_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
AUJ05780.1|2981904_2982333_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ05781.1|2982464_2982944_+	peptidoglycan-associated outer membrane lipoprotein precursor	NA	NA	NA	NA	NA
AUJ05782.1|2983194_2983410_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
AUJ05783.1|2983376_2983610_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ05784.1|2983637_2984123_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07209.1|2984324_2984807_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	58.6	4.1e-42
AUJ05785.1|2986741_2988973_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	59.7	1.5e-09
AUJ05786.1|2989116_2990493_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	4.6e-78
AUJ05787.1|2991611_2992580_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	5.6e-99
AUJ05788.1|2992901_2993951_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ05789.1|2994147_2995116_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
AUJ05790.1|2996206_2996842_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUJ05791.1|2996977_2998495_-	fumarate hydratase	NA	NA	NA	NA	NA
AUJ05792.1|2998534_2998795_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ05793.1|2998829_3000710_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	38.9	5.2e-24
AUJ05794.1|3000898_3001678_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AUJ05795.1|3001759_3002245_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	36.2	2.8e-14
AUJ07210.1|3004702_3004942_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ05796.1|3005191_3005905_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07211.1|3007436_3007925_+	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
AUJ07212.1|3008086_3008665_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ05797.1|3008756_3009257_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ05798.1|3009323_3010169_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ05799.1|3010219_3010498_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUJ05800.1|3010717_3010906_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ05801.1|3011319_3011928_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AUJ05802.1|3013124_3014942_+	peptidase M14	NA	NA	NA	NA	NA
AUJ05803.1|3018026_3018503_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 22
CP019089	Xanthomonas oryzae pv. oryzae strain MAI106 chromosome, complete genome	4705454	3177899	3264894	4705454	protease,transposase	Hokovirus(26.67%)	53	NA	NA
AUJ05922.1|3177899_3179276_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.3e-61
AUJ07228.1|3180190_3180520_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ05923.1|3180710_3182642_-	alpha-L-fucosidase	NA	NA	NA	NA	NA
AUJ05924.1|3183087_3183942_+|transposase	transposase	transposase	U5P429	Shigella_phage	57.7	2.8e-86
AUJ07229.1|3183977_3187517_-	histidine kinase	NA	A0A1V0SGX0	Hokovirus	33.3	2.6e-45
AUJ05925.1|3188019_3191586_-	histidine kinase	NA	A0A1V0SGX0	Hokovirus	33.3	7.7e-45
AUJ05926.1|3191651_3195215_-	histidine kinase	NA	A0A1V0SGX0	Hokovirus	30.7	8.3e-39
AUJ05927.1|3195508_3199084_-	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	32.2	4.6e-37
AUJ05928.1|3199180_3199843_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
AUJ05929.1|3199839_3200403_+	cytochrome b	NA	NA	NA	NA	NA
AUJ05930.1|3200412_3200982_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
AUJ07230.1|3201298_3201688_+	cold-shock protein	NA	NA	NA	NA	NA
AUJ05931.1|3201773_3202007_-	thioredoxin family protein	NA	NA	NA	NA	NA
AUJ05932.1|3202094_3203477_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AUJ05933.1|3205244_3206462_-	O-succinylhomoserine (thiol)-lyase	NA	NA	NA	NA	NA
AUJ05934.1|3206458_3207490_-	homoserine acetyltransferase	NA	NA	NA	NA	NA
AUJ05935.1|3207808_3208708_+	peptidase	NA	S5M424	Bacillus_phage	30.6	3.0e-06
AUJ05936.1|3208840_3210445_+	peptide chain release factor 3	NA	NA	NA	NA	NA
AUJ05937.1|3210520_3211165_+	hemolysin III	NA	NA	NA	NA	NA
AUJ05938.1|3213085_3214462_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	7.1e-63
AUJ05939.1|3216093_3216522_-	histidine kinase	NA	NA	NA	NA	NA
AUJ05940.1|3216481_3217522_-	glycosyl transferase family 2	NA	F1C5B0	Cronobacter_phage	42.6	1.3e-72
AUJ05941.1|3217530_3218268_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AUJ05942.1|3218342_3219233_+	heat-shock protein Hsp33	NA	NA	NA	NA	NA
AUJ05943.1|3219353_3220223_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ05944.1|3220618_3223528_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.4	6.6e-26
AUJ05945.1|3223636_3224245_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ05946.1|3224447_3225305_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUJ05947.1|3225301_3227776_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUJ07231.1|3228170_3228524_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ05948.1|3230503_3231883_+	serine hydrolase	NA	NA	NA	NA	NA
AUJ05949.1|3232569_3233013_-	histidine biosynthesis protein HisIE	NA	NA	NA	NA	NA
AUJ05950.1|3233430_3233646_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ05951.1|3234028_3234424_-	glycine cleavage system protein H	NA	NA	NA	NA	NA
AUJ05952.1|3234560_3235670_-	glycine cleavage system protein T	NA	NA	NA	NA	NA
AUJ05953.1|3235842_3236277_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ05954.1|3236280_3237246_-	hypothetical protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	33.5	1.5e-22
AUJ05955.1|3237543_3237879_-	hypothetical protein	NA	A0A218MNG8	uncultured_virus	56.4	9.2e-25
AUJ05956.1|3237875_3238895_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
AUJ05957.1|3239139_3239940_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
AUJ05958.1|3239936_3240494_-	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
AUJ05959.1|3240526_3241945_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AUJ05960.1|3241935_3242670_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AUJ05961.1|3242971_3243988_-	glucokinase	NA	NA	NA	NA	NA
AUJ05962.1|3244688_3247397_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUJ05963.1|3247605_3249291_+	alpha-L-fucosidase	NA	NA	NA	NA	NA
AUJ07232.1|3249306_3250362_+	glycosyl hydrolase	NA	A0A2P1CFB9	Microbacterium_phage	24.3	2.9e-08
AUJ05964.1|3253291_3255913_+	beta-mannosidase	NA	NA	NA	NA	NA
AUJ05965.1|3256121_3258791_+	beta-glucosidase	NA	NA	NA	NA	NA
AUJ05966.1|3258935_3261050_-	ABC transporter	NA	W8CYL7	Bacillus_phage	26.5	1.4e-33
AUJ05967.1|3261053_3261500_-|protease	protease	protease	NA	NA	NA	NA
AUJ05968.1|3262412_3262676_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ05969.1|3263517_3264894_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
>prophage 23
CP019089	Xanthomonas oryzae pv. oryzae strain MAI106 chromosome, complete genome	4705454	3409709	3521454	4705454	tRNA,transposase	Acidithiobacillus_phage(20.0%)	83	NA	NA
AUJ06065.1|3409709_3410696_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.0	1.7e-42
AUJ06066.1|3410548_3410812_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ06067.1|3410780_3411185_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06068.1|3411122_3412034_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06069.1|3412158_3414744_-	ATP-dependent chaperone ClpB	NA	A0A1C3S747	Escherichia_phage	35.4	3.8e-126
AUJ06070.1|3415189_3415495_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06071.1|3415875_3418491_+	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.5	2.8e-28
AUJ06072.1|3418791_3419406_+	calcium-binding protein	NA	NA	NA	NA	NA
AUJ06073.1|3419838_3422085_+	catalase-peroxidase	NA	NA	NA	NA	NA
AUJ07242.1|3422208_3422616_-	RNA-binding protein	NA	NA	NA	NA	NA
AUJ06074.1|3422956_3424447_+	MATE family efflux transporter	NA	NA	NA	NA	NA
AUJ06075.1|3425065_3425473_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AUJ06076.1|3425617_3426376_-|tRNA	tRNA (guanine(37)-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
AUJ06077.1|3426440_3426953_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AUJ07243.1|3426996_3427254_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AUJ06078.1|3427363_3428161_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06079.1|3429400_3430636_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06080.1|3430784_3432161_-	signal recognition particle protein	NA	NA	NA	NA	NA
AUJ06081.1|3432195_3432531_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06082.1|3432545_3433337_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06083.1|3433623_3434673_-	galactose mutarotase	NA	NA	NA	NA	NA
AUJ07244.1|3434912_3436496_+	alpha-N-arabinofuranosidase	NA	NA	NA	NA	NA
AUJ06084.1|3436683_3437160_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ06085.1|3437125_3437482_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ06086.1|3438576_3440538_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
AUJ06087.1|3440521_3441409_-	histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	33.0	9.3e-24
AUJ06088.1|3441405_3442416_-	ATP-binding protein	NA	NA	NA	NA	NA
AUJ06089.1|3442406_3442802_-	anti-sigma regulatory factor	NA	NA	NA	NA	NA
AUJ06090.1|3442798_3443161_-	anti-anti-sigma factor	NA	NA	NA	NA	NA
AUJ07245.1|3443162_3444005_-	polyvinylalcohol dehydrogenase	NA	NA	NA	NA	NA
AUJ06091.1|3444679_3447004_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06092.1|3447028_3448999_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	21.2	3.5e-15
AUJ06093.1|3449110_3450541_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUJ06094.1|3451301_3452093_+	transcriptional regulator	NA	NA	NA	NA	NA
AUJ06095.1|3452310_3452592_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06096.1|3453399_3454794_-	DNA repair protein RadA	NA	NA	NA	NA	NA
AUJ06097.1|3455101_3456088_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.9	3.4e-43
AUJ06098.1|3455940_3456210_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ06099.1|3456381_3457758_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
AUJ06100.1|3457873_3459091_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06101.1|3459979_3460189_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06102.1|3460598_3461975_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
AUJ06103.1|3464543_3465512_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
AUJ06104.1|3466188_3466584_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06105.1|3466746_3468123_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.7e-62
AUJ06106.1|3468143_3468533_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06107.1|3468534_3473274_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	43.3	1.8e-20
AUJ06108.1|3473417_3475037_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06109.1|3475060_3477307_-	type IV secretion protein Rhs	NA	A0A077K8Q4	Ralstonia_phage	31.5	6.8e-55
AUJ07246.1|3477531_3479229_-	peptidase M61	NA	NA	NA	NA	NA
AUJ06110.1|3479580_3479916_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
AUJ07247.1|3479915_3480542_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
AUJ06111.1|3480544_3482545_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AUJ06112.1|3483993_3484944_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
AUJ06113.1|3485016_3485535_-	signal peptidase II	NA	NA	NA	NA	NA
AUJ06114.1|3485849_3488681_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SGW1	Hokovirus	22.2	1.4e-41
AUJ06115.1|3489902_3491507_-	lipid II flippase MurJ	NA	NA	NA	NA	NA
AUJ06116.1|3491623_3491893_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
AUJ06117.1|3491984_3493037_-	Obg family GTPase CgtA	NA	NA	NA	NA	NA
AUJ06118.1|3493272_3493533_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
AUJ06119.1|3493545_3493866_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
AUJ06120.1|3494158_3497116_+	ABC-ATPase UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	2.5e-307
AUJ06121.1|3497112_3497520_+	thioesterase	NA	NA	NA	NA	NA
AUJ06122.1|3497633_3498098_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06123.1|3498121_3498892_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUJ06124.1|3498962_3499868_+	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
AUJ06125.1|3500095_3500599_+	pathogenicity-like protein	NA	NA	NA	NA	NA
AUJ06126.1|3500710_3501475_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AUJ07248.1|3501716_3502172_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07249.1|3502305_3502887_-	calcium-binding protein	NA	NA	NA	NA	NA
AUJ06127.1|3503086_3503842_+	arginyltransferase	NA	NA	NA	NA	NA
AUJ06128.1|3503795_3505127_+	endonuclease	NA	NA	NA	NA	NA
AUJ06129.1|3505478_3505898_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ06130.1|3506099_3507701_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06131.1|3508147_3509224_+	DUF4432 domain-containing protein	NA	NA	NA	NA	NA
AUJ06132.1|3509320_3509794_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06133.1|3510030_3512466_+	ligand-gated channel	NA	A0A0P0I887	Acinetobacter_phage	22.6	1.0e-11
AUJ07250.1|3512998_3513538_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06134.1|3513743_3514502_+	trehalose-phosphatase	NA	NA	NA	NA	NA
AUJ06135.1|3514546_3516325_+	glucoamylase	NA	NA	NA	NA	NA
AUJ06136.1|3516321_3517689_+	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
AUJ06137.1|3518291_3520769_+	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
AUJ07251.1|3521190_3521454_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 24
CP019089	Xanthomonas oryzae pv. oryzae strain MAI106 chromosome, complete genome	4705454	3553132	3576788	4705454	tRNA,transposase	Leptospira_phage(42.86%)	19	NA	NA
AUJ06156.1|3553132_3554101_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.6e-98
AUJ06157.1|3554459_3554852_-	histone-like nucleoid-structuring protein	NA	NA	NA	NA	NA
AUJ07256.1|3555187_3556042_-|transposase	transposase	transposase	U5P429	Shigella_phage	58.1	2.2e-86
AUJ06158.1|3557995_3558964_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
AUJ06159.1|3559208_3560585_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
AUJ06160.1|3560849_3561569_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.3	1.8e-41
AUJ06161.1|3561587_3562574_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	40.6	9.9e-43
AUJ06162.1|3562426_3562696_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ06163.1|3567635_3567836_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
AUJ06164.1|3568198_3568993_+	thiazole synthase	NA	NA	NA	NA	NA
AUJ06165.1|3569294_3570053_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AUJ06166.1|3570128_3571991_+	SLC13 family permease	NA	NA	NA	NA	NA
AUJ06167.1|3572048_3572390_-	ferredoxin	NA	NA	NA	NA	NA
AUJ06168.1|3572648_3572924_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06169.1|3573097_3573574_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ06170.1|3573539_3574004_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ06171.1|3574516_3575230_+	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
AUJ06172.1|3575290_3575722_+	large-conductance mechanosensitive channel	NA	NA	NA	NA	NA
AUJ06173.1|3575729_3576788_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.2e-75
>prophage 25
CP019089	Xanthomonas oryzae pv. oryzae strain MAI106 chromosome, complete genome	4705454	3709382	3765859	4705454	protease,transposase	Tenacibaculum_phage(12.5%)	44	NA	NA
AUJ06267.1|3709382_3709739_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ06268.1|3709704_3710181_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ06269.1|3710227_3710887_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
AUJ06270.1|3711038_3713126_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06271.1|3713239_3713509_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06272.1|3713848_3714733_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06273.1|3714879_3715476_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AUJ07267.1|3715475_3716834_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
AUJ06274.1|3717198_3717762_-	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	31.4	2.1e-13
AUJ06275.1|3717921_3719178_+	6-phosphofructokinase	NA	NA	NA	NA	NA
AUJ06276.1|3719477_3720446_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.6e-98
AUJ06277.1|3721821_3722346_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06278.1|3722594_3724622_+	sodium-translocating pyrophosphatase	NA	NA	NA	NA	NA
AUJ06279.1|3724914_3725397_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06280.1|3725593_3726130_+	inorganic pyrophosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	53.6	6.1e-47
AUJ06281.1|3726276_3727392_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06282.1|3728005_3730975_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.6	1.6e-40
AUJ06283.1|3731020_3731914_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUJ06284.1|3732024_3734376_-	biopolymer transporter Tol	NA	NA	NA	NA	NA
AUJ06285.1|3734800_3736678_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
AUJ06286.1|3737959_3738961_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
AUJ06287.1|3739001_3740723_+	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	8.0e-64
AUJ06288.1|3740706_3740964_+	acetolactate synthase	NA	NA	NA	NA	NA
AUJ06289.1|3741039_3742164_+	serine/threonine dehydratase	NA	NA	NA	NA	NA
AUJ06290.1|3742160_3743723_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.4	4.3e-08
AUJ06291.1|3744046_3745120_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
AUJ07268.1|3745156_3745906_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUJ06292.1|3745938_3746586_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
AUJ06293.1|3746653_3748102_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
AUJ07269.1|3748222_3749107_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ06294.1|3749351_3750134_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AUJ06295.1|3750895_3751549_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ07270.1|3751678_3752335_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
AUJ06296.1|3752355_3753735_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06297.1|3754009_3755326_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
AUJ06298.1|3755402_3756323_+	lipid A biosynthesis lauroyl acyltransferase	NA	NA	NA	NA	NA
AUJ06299.1|3756555_3757890_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06300.1|3757870_3758983_-	glycosyl transferase	NA	NA	NA	NA	NA
AUJ06301.1|3758993_3759191_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
AUJ06302.1|3759522_3761649_-	ABC transporter	NA	W8CYL7	Bacillus_phage	26.4	9.0e-33
AUJ07271.1|3762570_3763833_-	hemolysin D	NA	NA	NA	NA	NA
AUJ07272.1|3764319_3765336_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.3	5.6e-49
AUJ06303.1|3765251_3765554_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06304.1|3765589_3765859_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 26
CP019089	Xanthomonas oryzae pv. oryzae strain MAI106 chromosome, complete genome	4705454	3819042	3944529	4705454	protease,transposase,tRNA	Enterobacteria_phage(12.5%)	104	NA	NA
AUJ06336.1|3819042_3820011_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
AUJ06337.1|3820212_3820635_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	62.2	1.0e-41
AUJ06338.1|3821227_3821617_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06339.1|3821609_3823262_+|protease	serine protease	protease	NA	NA	NA	NA
AUJ06340.1|3823713_3824520_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	37.1	9.1e-10
AUJ06341.1|3824572_3825751_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	33.3	6.9e-51
AUJ06342.1|3826137_3827103_-	glycosidase-like protein	NA	NA	NA	NA	NA
AUJ07279.1|3827231_3828530_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06343.1|3828579_3830487_-	glycosyltransferase	NA	NA	NA	NA	NA
AUJ07280.1|3830499_3831402_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06344.1|3831651_3832491_-	glycosyl transferase	NA	NA	NA	NA	NA
AUJ06345.1|3833101_3834259_+	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
AUJ06346.1|3834294_3836457_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AUJ06347.1|3836831_3837407_+	aminotransferase	NA	NA	NA	NA	NA
AUJ06348.1|3837512_3838241_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ06349.1|3838671_3839511_-	glycosyltransferase	NA	NA	NA	NA	NA
AUJ06350.1|3839507_3841811_-	type II secretion system protein GspD	NA	A7BJX1	Enterobacteria_phage	24.4	1.5e-09
AUJ06351.1|3841807_3842638_-	general secretion pathway protein GspN	NA	NA	NA	NA	NA
AUJ06352.1|3842627_3843281_-	general secretion pathway protein GspM	NA	NA	NA	NA	NA
AUJ06353.1|3843264_3844386_-	general secretion pathway protein GspL	NA	NA	NA	NA	NA
AUJ06354.1|3844382_3845234_-	general secretion pathway protein GspK	NA	NA	NA	NA	NA
AUJ06355.1|3845230_3845866_-	general secretion pathway protein GspJ	NA	NA	NA	NA	NA
AUJ06356.1|3845862_3846279_-	general secretion pathway protein GspI	NA	NA	NA	NA	NA
AUJ06357.1|3846275_3846785_-	type II secretion system protein GspH	NA	NA	NA	NA	NA
AUJ06358.1|3846794_3847226_-	type II secretion system protein GspG	NA	NA	NA	NA	NA
AUJ06359.1|3847493_3848711_-	type II secretion system protein GspF	NA	NA	NA	NA	NA
AUJ06360.1|3848710_3848890_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06361.1|3848886_3850626_-	type II secretion system protein GspE	NA	NA	NA	NA	NA
AUJ06362.1|3850743_3852627_-|protease	protease	protease	A0A1B0T6A2	Bacillus_phage	30.7	7.0e-21
AUJ06363.1|3852847_3858928_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06364.1|3859905_3863958_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	56.9	5.8e-121
AUJ07281.1|3863850_3864117_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06365.1|3864373_3865171_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07282.1|3865654_3866626_-	site-specific tyrosine recombinase XerD	NA	A0A0K0N6I5	Gordonia_phage	30.3	1.9e-14
AUJ06366.1|3867051_3867519_+	RDD family protein	NA	NA	NA	NA	NA
AUJ06367.1|3867616_3867928_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07283.1|3867932_3869039_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AUJ06368.1|3869035_3870118_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AUJ06369.1|3870225_3871698_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.5	9.0e-48
AUJ06370.1|3871697_3872054_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06371.1|3872053_3872479_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AUJ06372.1|3872489_3873722_+	ATPase	NA	NA	NA	NA	NA
AUJ06373.1|3873724_3874372_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06374.1|3874500_3877443_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	34.2	2.2e-130
AUJ07284.1|3878102_3880139_+	lytic murein transglycosylase	NA	A0A0H3V0Q1	Geobacillus_virus	36.7	1.4e-14
AUJ06375.1|3880595_3881972_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	9.2e-63
AUJ07285.1|3882325_3883342_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
AUJ07286.1|3884695_3885712_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
AUJ06376.1|3885911_3886898_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.0	1.3e-42
AUJ06377.1|3886750_3887020_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ07287.1|3887572_3888046_-	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
AUJ06378.1|3888051_3888519_-	alanine acetyltransferase	NA	NA	NA	NA	NA
AUJ06379.1|3888529_3889303_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AUJ07288.1|3889467_3889839_+	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
AUJ06380.1|3889950_3891645_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AUJ06381.1|3891787_3892249_+	DNA-binding protein	NA	NA	NA	NA	NA
AUJ06382.1|3892326_3893586_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06383.1|3893755_3894868_+	ABC transporter permease	NA	NA	NA	NA	NA
AUJ06384.1|3894953_3895796_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.5	2.4e-13
AUJ06385.1|3895798_3896725_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUJ06386.1|3896721_3897366_+	ABC transporter	NA	NA	NA	NA	NA
AUJ06387.1|3897508_3897985_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ06388.1|3898393_3898651_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06389.1|3898766_3899375_-	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A2K9L0M4	Tupanvirus	34.6	1.8e-23
AUJ06390.1|3899491_3901141_+	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
AUJ07289.1|3901160_3903986_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AUJ06391.1|3904009_3904648_-	succinyl-CoA--3-ketoacid-CoA transferase	NA	NA	NA	NA	NA
AUJ06392.1|3904647_3905379_-	succinyl-CoA--3-ketoacid-CoA transferase	NA	NA	NA	NA	NA
AUJ06393.1|3905512_3906859_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.6e-33
AUJ06394.1|3906904_3908308_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	28.8	1.6e-41
AUJ06395.1|3908424_3909333_-	NAD(P)-dependent oxidoreductase	NA	A0A1D7XFA3	Escherichia_phage	33.8	5.4e-27
AUJ06396.1|3909329_3909887_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	48.1	1.7e-44
AUJ06397.1|3909883_3910771_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
AUJ06398.1|3910826_3911882_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
AUJ06399.1|3912263_3913010_+	EtfB protein	NA	NA	NA	NA	NA
AUJ06400.1|3913009_3913951_+	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
AUJ06401.1|3914176_3914995_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
AUJ06402.1|3914984_3916298_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	2.9e-13
AUJ06403.1|3916913_3917183_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ06404.1|3917035_3918022_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.6e-43
AUJ06405.1|3920054_3921431_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	3.2e-63
AUJ06406.1|3922094_3922358_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ06407.1|3922998_3924375_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.0e-77
AUJ06408.1|3924998_3926162_-	glycosyl transferase	NA	NA	NA	NA	NA
AUJ06409.1|3926152_3926443_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06410.1|3926463_3927390_-	glycosyltransferase	NA	NA	NA	NA	NA
AUJ06411.1|3928421_3929498_-	NAD-dependent dehydratase	NA	A0A1V0SG19	Hokovirus	21.8	2.4e-10
AUJ06412.1|3929532_3930333_-	methyltransferase	NA	H8ZJI6	Ostreococcus_tauri_virus	28.0	9.3e-07
AUJ06413.1|3930379_3931573_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
AUJ06414.1|3931663_3933034_-	cystathionine beta-synthase	NA	A0A1X9I5F1	Streptococcus_phage	38.8	2.6e-49
AUJ06415.1|3933274_3933493_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06416.1|3933834_3934725_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06417.1|3934721_3935105_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06418.1|3935203_3936337_+	type IV pili twitching motility protein PilT	NA	NA	NA	NA	NA
AUJ06419.1|3936676_3937339_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
AUJ07290.1|3937382_3938372_-	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
AUJ06420.1|3938533_3938659_-	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
AUJ06421.1|3938751_3940134_+	RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.3	6.4e-56
AUJ07291.1|3940558_3940912_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
AUJ07292.1|3941104_3941440_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06422.1|3941553_3942228_-	dethiobiotin synthase	NA	NA	NA	NA	NA
AUJ06423.1|3942552_3943035_+	diguanylate cyclase	NA	NA	NA	NA	NA
AUJ06424.1|3943031_3943430_+	transcriptional regulator	NA	NA	NA	NA	NA
AUJ06425.1|3943560_3944529_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	4.3e-99
>prophage 27
CP019089	Xanthomonas oryzae pv. oryzae strain MAI106 chromosome, complete genome	4705454	4056655	4127660	4705454	tRNA,transposase,integrase	Leptospira_phage(27.27%)	58	4043272:4043292	4109381:4109401
4043272:4043292	attL	TTTAGAGCGGCTAACAACACG	NA	NA	NA	NA
AUJ06513.1|4056655_4057624_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
AUJ06514.1|4057856_4058237_+	response regulator	NA	NA	NA	NA	NA
AUJ07304.1|4058205_4058436_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06515.1|4058471_4059770_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AUJ06516.1|4059899_4060115_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06517.1|4060286_4060568_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06518.1|4060869_4062279_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AUJ06519.1|4062269_4063286_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AUJ06520.1|4063861_4064113_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06521.1|4065085_4066249_+	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.5	1.0e-09
AUJ06522.1|4066890_4067205_+	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
AUJ06523.1|4067214_4067436_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06524.1|4067876_4068089_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06525.1|4068427_4069165_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06526.1|4069175_4071827_+	chemotaxis protein	NA	NA	NA	NA	NA
AUJ06527.1|4071823_4072498_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06528.1|4072494_4073160_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06529.1|4073244_4075386_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AUJ06530.1|4075475_4076744_-	ABC transporter permease	NA	NA	NA	NA	NA
AUJ06531.1|4076743_4078180_-	ABC transporter permease	NA	NA	NA	NA	NA
AUJ06532.1|4078190_4078913_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	6.8e-17
AUJ06533.1|4080307_4082539_-	isocitrate dehydrogenase, NADP-dependent	NA	NA	NA	NA	NA
AUJ07305.1|4082728_4084441_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06534.1|4084509_4084785_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06535.1|4085279_4086095_-	preQ(1) synthase	NA	A0A2I7SAX1	Vibrio_phage	35.5	1.3e-35
AUJ07306.1|4086268_4086589_+|integrase	integrase	integrase	NA	NA	NA	NA
AUJ06536.1|4088395_4089640_+	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUJ06537.1|4089734_4092983_+	acriflavine resistance protein B	NA	NA	NA	NA	NA
AUJ06538.1|4093116_4096257_+	acriflavin resistance protein	NA	NA	NA	NA	NA
AUJ07307.1|4096875_4097091_+	VOC family protein	NA	NA	NA	NA	NA
AUJ06539.1|4097567_4098935_-	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
AUJ06540.1|4098944_4099154_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07308.1|4099252_4099870_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06541.1|4100723_4101476_-	haloacid dehalogenase	NA	NA	NA	NA	NA
AUJ06542.1|4101513_4101954_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06543.1|4102160_4102502_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06544.1|4102727_4103105_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06545.1|4103301_4103499_-	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
AUJ07309.1|4104639_4105443_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A223VZK2	Agrobacterium_phage	29.3	2.9e-08
AUJ07310.1|4105721_4107071_+	NlpC-P60 family protein	NA	NA	NA	NA	NA
AUJ06546.1|4107067_4108171_+	dipeptide epimerase	NA	NA	NA	NA	NA
AUJ06547.1|4108191_4109250_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.8e-74
AUJ06548.1|4110133_4110910_+	hypothetical protein	NA	NA	NA	NA	NA
4109381:4109401	attR	CGTGTTGTTAGCCGCTCTAAA	NA	NA	NA	NA
AUJ06549.1|4110906_4112223_+	amino acid transporter	NA	NA	NA	NA	NA
AUJ06550.1|4112435_4112717_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06551.1|4112889_4113222_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06552.1|4113276_4113711_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06553.1|4113895_4115074_+	glucose dehydrogenase	NA	NA	NA	NA	NA
AUJ06554.1|4115613_4117785_-	beta-glucosidase	NA	NA	NA	NA	NA
AUJ06555.1|4118013_4118370_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AUJ06556.1|4118449_4119514_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.4	5.1e-101
AUJ06557.1|4119793_4120009_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AUJ07311.1|4120415_4120862_+|tRNA	glutamyl-tRNA amidotransferase	tRNA	A0A292GL36	Xanthomonas_phage	44.5	3.9e-23
AUJ06558.1|4121882_4122941_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.8e-74
AUJ06559.1|4123480_4124443_+	BrkB protein	NA	NA	NA	NA	NA
AUJ06560.1|4124531_4126280_+	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	34.8	6.5e-45
AUJ06561.1|4126551_4126821_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ06562.1|4126673_4127660_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-43
>prophage 28
CP019089	Xanthomonas oryzae pv. oryzae strain MAI106 chromosome, complete genome	4705454	4143600	4196139	4705454	tRNA,protease,transposase	Leptospira_phage(14.29%)	42	NA	NA
AUJ06575.1|4143600_4144059_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AUJ06576.1|4145376_4145646_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ06577.1|4145498_4146485_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.6e-43
AUJ06578.1|4146494_4146620_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ07315.1|4152682_4153894_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
AUJ06579.1|4154064_4155483_+	hypothetical protein	NA	A0A0K2CNY2	Brevibacillus_phage	37.9	6.9e-13
AUJ06580.1|4155853_4156987_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
AUJ06581.1|4157024_4157252_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07316.1|4157310_4158531_-	MFS transporter	NA	NA	NA	NA	NA
AUJ06582.1|4158925_4159726_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	29.0	3.1e-26
AUJ06583.1|4159853_4160513_+	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
AUJ06584.1|4160535_4161294_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06585.1|4161331_4162129_+	chromosome partitioning protein	NA	Q8JL10	Natrialba_phage	30.3	9.5e-20
AUJ06586.1|4162128_4163055_+	chromosome partitioning protein ParB	NA	I3NLC2	Bifidobacterium_phage	34.9	1.0e-12
AUJ06587.1|4163090_4163399_+	mitomycin resistance protein	NA	NA	NA	NA	NA
AUJ06588.1|4163603_4164569_+	protein CapI	NA	A0A1V0SKV4	Klosneuvirus	30.5	1.6e-29
AUJ06589.1|4164935_4165658_+	dolichol-phosphate mannosyltransferase	NA	NA	NA	NA	NA
AUJ06590.1|4165657_4165999_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06591.1|4166416_4166965_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07317.1|4167072_4168467_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	29.5	2.6e-49
AUJ06592.1|4169434_4169902_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	Q2NP83	Xanthomonas_phage	96.1	1.1e-79
AUJ06593.1|4169898_4171173_-	bifunctional 4'-phosphopantothenoylcysteine decarboxylase/phosphopantothenoylcysteine synthetase	NA	Q9HH70	Methanothermobacter_phage	31.2	5.8e-35
AUJ07318.1|4171269_4171947_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06594.1|4173901_4174783_+	sporulation protein	NA	NA	NA	NA	NA
AUJ06595.1|4174789_4175269_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06596.1|4175360_4176116_+	NADP-dependent 3-hydroxy acid dehydrogenase	NA	NA	NA	NA	NA
AUJ06597.1|4176396_4177287_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	42.0	1.1e-37
AUJ06598.1|4177139_4177409_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ06599.1|4177495_4181398_-	avirulence protein	NA	NA	NA	NA	NA
AUJ07319.1|4182181_4182889_-	hypothetical protein	NA	U5P429	Shigella_phage	59.1	3.4e-69
AUJ06600.1|4182933_4183206_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	58.8	1.2e-19
AUJ06601.1|4183579_4183849_-	hypothetical protein	NA	A0A077K814	Ralstonia_phage	64.8	1.2e-19
AUJ06602.1|4184038_4185925_-	arginine decarboxylase	NA	NA	NA	NA	NA
AUJ06603.1|4186163_4187021_+	spermidine synthase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	32.5	2.2e-14
AUJ06604.1|4187459_4188071_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06605.1|4188263_4189076_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07320.1|4189754_4190291_+	kinase	NA	NA	NA	NA	NA
AUJ06606.1|4190639_4192625_-	beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
AUJ07321.1|4193238_4193577_-	transcriptional regulator	NA	NA	NA	NA	NA
AUJ06607.1|4193766_4194045_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06608.1|4194061_4195582_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AUJ06609.1|4195662_4196139_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 29
CP019089	Xanthomonas oryzae pv. oryzae strain MAI106 chromosome, complete genome	4705454	4214786	4286161	4705454	protease,transposase,tRNA	Pithovirus(10.0%)	60	NA	NA
AUJ06621.1|4214786_4216223_+|protease	serine endoprotease DegQ	protease	W5SAB9	Pithovirus	30.7	1.5e-10
AUJ06622.1|4216338_4216701_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06623.1|4216704_4217190_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06624.1|4217186_4217570_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07324.1|4218312_4219419_+	AI-2E family transporter	NA	NA	NA	NA	NA
AUJ06625.1|4219564_4220302_+	HAD family hydrolase	NA	NA	NA	NA	NA
AUJ06626.1|4220342_4221713_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	31.2	2.4e-26
AUJ06627.1|4221768_4222272_-	transmembrane regulator protein PrtR	NA	NA	NA	NA	NA
AUJ06628.1|4222513_4223029_-	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
AUJ06629.1|4223177_4224269_+	catalase	NA	NA	NA	NA	NA
AUJ06630.1|4224265_4224799_+	cytochrome b	NA	NA	NA	NA	NA
AUJ06631.1|4226696_4227605_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06632.1|4227601_4228489_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AUJ06633.1|4228581_4229034_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07325.1|4229532_4231209_-	peptidase M20	NA	NA	NA	NA	NA
AUJ06634.1|4231648_4232593_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AUJ06635.1|4232723_4234013_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AUJ06636.1|4234181_4234391_-	CsbD family protein	NA	NA	NA	NA	NA
AUJ06637.1|4234631_4234766_-	entericidin	NA	NA	NA	NA	NA
AUJ06638.1|4234840_4234993_-	entericidin	NA	NA	NA	NA	NA
AUJ06639.1|4235100_4236024_-	arginase	NA	A0A0N9R043	Chrysochromulina_ericina_virus	34.4	1.7e-28
AUJ06640.1|4236345_4237011_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06641.1|4237007_4237550_+	GTPase	NA	NA	NA	NA	NA
AUJ06642.1|4238053_4238737_+	thymidylate kinase	NA	K7R9G5	Vibrio_phage	33.8	1.3e-14
AUJ06643.1|4240476_4241205_-	pantothenate kinase	NA	NA	NA	NA	NA
AUJ07326.1|4241201_4242167_-	bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor	NA	NA	NA	NA	NA
AUJ06644.1|4242524_4242836_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06645.1|4242844_4243600_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07327.1|4243752_4244937_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07328.1|4245056_4246646_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06646.1|4246765_4248181_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AUJ06647.1|4248210_4248894_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUJ06648.1|4248965_4249268_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06649.1|4249603_4250614_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AUJ06650.1|4251030_4251885_-|transposase	transposase	transposase	U5P429	Shigella_phage	57.7	6.3e-86
AUJ06651.1|4252269_4255761_-	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
AUJ06652.1|4256556_4256736_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06653.1|4256837_4257107_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ07329.1|4258140_4258335_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06654.1|4259086_4259662_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06655.1|4259720_4261244_-	catalase	NA	A0A2K9L0T1	Tupanvirus	48.0	2.8e-97
AUJ06656.1|4261687_4262656_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
AUJ07330.1|4263099_4263570_-	hemolysin D	NA	NA	NA	NA	NA
AUJ07331.1|4263531_4263720_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07332.1|4264254_4266387_-	ATP-dependent DNA helicase DinG	NA	NA	NA	NA	NA
AUJ06657.1|4266873_4267248_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06658.1|4267237_4268089_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
AUJ06659.1|4268141_4269023_+	TolB-like protein	NA	NA	NA	NA	NA
AUJ06660.1|4269688_4272250_-	iron-uptake factor	NA	NA	NA	NA	NA
AUJ06661.1|4272482_4273235_+	endonuclease	NA	H6X497	Enterobacteria_phage	33.3	2.8e-21
AUJ06662.1|4273362_4274277_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ06663.1|4274369_4275347_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06664.1|4275534_4276527_-	porphobilinogen synthase	NA	NA	NA	NA	NA
AUJ07333.1|4276747_4276966_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07334.1|4277216_4277672_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06665.1|4277772_4279602_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06666.1|4279767_4282005_-	S9 family peptidase	NA	NA	NA	NA	NA
AUJ07335.1|4283597_4284614_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	3.3e-49
AUJ06667.1|4284585_4284786_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06668.1|4284784_4286161_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
>prophage 30
CP019089	Xanthomonas oryzae pv. oryzae strain MAI106 chromosome, complete genome	4705454	4300918	4377025	4705454	transposase	Acidithiobacillus_phage(25.0%)	58	NA	NA
AUJ06683.1|4300918_4301182_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ06684.1|4301034_4302021_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-43
AUJ06685.1|4302448_4303825_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
AUJ06686.1|4304405_4305071_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06687.1|4305441_4305726_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06688.1|4306310_4307588_+	murein transglycosylase	NA	NA	NA	NA	NA
AUJ06689.1|4307867_4308194_-	thiol reductase thioredoxin	NA	NA	NA	NA	NA
AUJ06690.1|4308165_4308660_-	flavodoxin	NA	A0A068CFW0	Listeria_phage	36.1	2.7e-17
AUJ06691.1|4308667_4309993_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06692.1|4310067_4311111_-	ribonucleotide-diphosphate reductase subunit beta	NA	A8ASV9	Listeria_phage	75.1	1.1e-151
AUJ06693.1|4311308_4313807_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A088FNW1	Listeria_phage	66.9	4.1e-303
AUJ06694.1|4314422_4315466_-	hypothetical protein	NA	A0A172Q0Y5	Acinetobacter_phage	51.8	4.8e-80
AUJ06695.1|4315572_4318281_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUJ06696.1|4318567_4319182_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06697.1|4319253_4320621_-	magnesium transporter	NA	NA	NA	NA	NA
AUJ06698.1|4321310_4323134_+	glutathione-regulated potassium-efflux system protein KefB	NA	NA	NA	NA	NA
AUJ06699.1|4324145_4324565_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ06700.1|4324677_4326621_-	glucose-6-phosphate dehydrogenase	NA	E3SJC5	Synechococcus_phage	37.3	2.6e-79
AUJ06701.1|4326470_4328270_-	glycosyl hydrolase	NA	NA	NA	NA	NA
AUJ06702.1|4328333_4328663_-	phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
AUJ06703.1|4328689_4332010_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07337.1|4332002_4332263_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06704.1|4332481_4333681_+	beta-ketoacyl-[acyl-carrier-protein] synthase II	NA	NA	NA	NA	NA
AUJ06705.1|4333680_4334454_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06706.1|4334450_4335272_+	dolichyl-phosphate mannose synthase	NA	NA	NA	NA	NA
AUJ06707.1|4335268_4336891_+	halogenase	NA	NA	NA	NA	NA
AUJ06708.1|4337089_4338466_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	2.2e-64
AUJ07338.1|4338795_4339533_-	3-ketoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	27.8	9.1e-09
AUJ07340.1|4339906_4340344_-	phosphotransferase	NA	NA	NA	NA	NA
AUJ07339.1|4340330_4342700_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06709.1|4342838_4343486_-	fatty acyl CoA synthetase	NA	NA	NA	NA	NA
AUJ06710.1|4343409_4344384_-	acyltransferase	NA	NA	NA	NA	NA
AUJ06711.1|4344380_4344668_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06712.1|4344679_4345429_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AUJ06713.1|4345482_4346229_-	ketosynthase	NA	NA	NA	NA	NA
AUJ06714.1|4346203_4346473_-	acyl carrier protein	NA	NA	NA	NA	NA
AUJ06715.1|4346776_4348126_+	hydroxylase	NA	NA	NA	NA	NA
AUJ07341.1|4348236_4349130_+	pteridine-dependent deoxygenase	NA	NA	NA	NA	NA
AUJ06716.1|4349454_4350762_-	AMP-ligase	NA	NA	NA	NA	NA
AUJ07342.1|4351501_4353904_+	S9 family peptidase	NA	NA	NA	NA	NA
AUJ06717.1|4354348_4355068_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06718.1|4356355_4357255_+	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AUJ06719.1|4358072_4358279_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06720.1|4358393_4361195_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.4	3.1e-65
AUJ06721.1|4361271_4361562_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07343.1|4361908_4362034_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06722.1|4362415_4362715_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06723.1|4363796_4364696_+	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
AUJ07344.1|4365488_4365962_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUJ06724.1|4365992_4366178_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06725.1|4366226_4366673_-	universal stress protein UspA	NA	NA	NA	NA	NA
AUJ06726.1|4366935_4367517_-	maltose acetyltransferase	NA	NA	NA	NA	NA
AUJ06727.1|4367972_4368197_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06728.1|4368372_4370559_-	DNA-dependent helicase II	NA	A7KV33	Bacillus_phage	36.8	2.0e-112
AUJ06729.1|4370906_4372301_-	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
AUJ06730.1|4372874_4374293_-	cardiolipin synthase	NA	NA	NA	NA	NA
AUJ06731.1|4374309_4375617_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ07345.1|4375648_4377025_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.6	1.3e-61
>prophage 31
CP019089	Xanthomonas oryzae pv. oryzae strain MAI106 chromosome, complete genome	4705454	4407959	4573065	4705454	tRNA,transposase	Acidithiobacillus_phage(17.24%)	106	NA	NA
AUJ06752.1|4407959_4408928_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
AUJ07349.1|4409053_4409419_-	L-fucose mutarotase	NA	NA	NA	NA	NA
AUJ06753.1|4409415_4410717_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
AUJ06754.1|4410897_4411674_+	transcriptional regulator	NA	NA	NA	NA	NA
AUJ07350.1|4412150_4412735_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07351.1|4412927_4416377_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
AUJ06755.1|4417128_4419771_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07352.1|4419874_4422274_-	NdvB protein	NA	NA	NA	NA	NA
AUJ06756.1|4422276_4423659_-	MFS transporter	NA	NA	NA	NA	NA
AUJ07353.1|4423873_4424401_+	gluconokinase	NA	NA	NA	NA	NA
AUJ06757.1|4425305_4426967_+	polyvinylalcohol dehydrogenase	NA	A0A0M4JT37	Mollivirus	36.1	1.7e-82
AUJ06758.1|4427298_4427604_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07354.1|4427506_4427947_-	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AUJ06759.1|4427966_4428395_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06760.1|4429935_4430205_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ06761.1|4430057_4431044_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.6e-43
AUJ06762.1|4431062_4432031_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
AUJ06763.1|4433461_4434430_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
AUJ06764.1|4434693_4438551_-	pathogenicity protein	NA	NA	NA	NA	NA
AUJ06765.1|4438547_4440329_-	outer membrane protein assembly factor	NA	NA	NA	NA	NA
AUJ06766.1|4440503_4443263_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.8	9.3e-147
AUJ06767.1|4443515_4445105_-	sulfotransferase family protein	NA	NA	NA	NA	NA
AUJ06768.1|4445104_4447363_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AUJ06769.1|4447520_4448429_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
AUJ06770.1|4448518_4450333_+	type II secretion system protein E	NA	NA	NA	NA	NA
AUJ06771.1|4450726_4459213_-	hypothetical protein	NA	A0A1S5SDF1	Streptococcus_phage	32.0	1.3e-10
AUJ07355.1|4459763_4460009_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06772.1|4460138_4460891_+	GMP synthase	NA	NA	NA	NA	NA
AUJ06773.1|4460950_4461850_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06774.1|4462002_4462758_-	twin arginine-targeting protein translocase TatC	NA	NA	NA	NA	NA
AUJ06775.1|4462754_4463327_-	twin arginine-targeting protein translocase TatB	NA	NA	NA	NA	NA
AUJ06776.1|4463342_4463570_-	protein translocase TatA	NA	NA	NA	NA	NA
AUJ06777.1|4463642_4464548_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06778.1|4464701_4465667_+	ferrochelatase	NA	NA	NA	NA	NA
AUJ06779.1|4465663_4466521_+	alpha/beta hydrolase	NA	R4JP33	Mycobacterium_phage	31.3	1.3e-06
AUJ06780.1|4466601_4467060_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07356.1|4467330_4468122_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06781.1|4468731_4469637_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	33.2	1.4e-43
AUJ06782.1|4469700_4470618_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	3.1e-83
AUJ06783.1|4470708_4471248_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06784.1|4471251_4472589_+	xylose isomerase	NA	NA	NA	NA	NA
AUJ06785.1|4472814_4473897_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUJ06786.1|4474036_4476232_+	alpha-glucuronidase	NA	NA	NA	NA	NA
AUJ06787.1|4476228_4478193_+	9-O-acetylesterase	NA	NA	NA	NA	NA
AUJ06788.1|4478204_4479464_+	bifunctional D-altronate/D-mannonate dehydratase	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
AUJ07357.1|4479463_4481164_+	glycoside hydrolase 43 family protein	NA	NA	NA	NA	NA
AUJ06789.1|4481166_4483881_+	glucan 1,4-alpha-glucosidase	NA	NA	NA	NA	NA
AUJ06790.1|4484103_4485624_+	mannitol dehydrogenase	NA	G8DCZ3	Micromonas_pusilla_virus	31.4	2.5e-45
AUJ06791.1|4485618_4486677_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.8e-74
AUJ06792.1|4486832_4488209_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
AUJ06793.1|4488385_4489489_+	restriction endonuclease	NA	A0A1S5SAB0	Streptococcus_phage	40.4	9.4e-58
AUJ06794.1|4489580_4489955_-	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
AUJ06795.1|4490655_4491672_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.9e-49
AUJ06796.1|4492294_4493350_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06797.1|4493576_4494995_-	uronate isomerase	NA	NA	NA	NA	NA
AUJ06798.1|4495035_4496013_-	1,4-beta-xylanase	NA	NA	NA	NA	NA
AUJ06799.1|4497417_4498899_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06800.1|4499240_4502114_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUJ06801.1|4502212_4503700_+	MFS transporter	NA	NA	NA	NA	NA
AUJ06802.1|4503731_4504766_+	alpha-N-arabinofuranosidase	NA	NA	NA	NA	NA
AUJ06803.1|4505107_4505641_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06804.1|4505922_4506891_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	6.6e-100
AUJ06805.1|4506893_4507076_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07358.1|4508364_4508937_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06806.1|4509075_4509294_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06807.1|4509439_4509694_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06808.1|4509930_4510911_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AUJ06809.1|4511106_4513770_-	glycerol-3-phosphate 1-O-acyltransferase	NA	NA	NA	NA	NA
AUJ06810.1|4513769_4514750_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06811.1|4514742_4514988_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06812.1|4515156_4516209_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUJ06813.1|4516373_4519412_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06814.1|4519713_4520145_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06815.1|4520250_4521627_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	3.2e-63
AUJ06816.1|4524375_4525905_+	tryptophan halogenase	NA	M4T1E3	Cyanophage	28.5	3.9e-46
AUJ06817.1|4526211_4526991_-	orotidine 5'-phosphate decarboxylase	NA	NA	NA	NA	NA
AUJ07359.1|4526987_4527947_-	acid phosphatase	NA	NA	NA	NA	NA
AUJ06818.1|4528277_4528943_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06819.1|4530341_4532318_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.2	6.3e-113
AUJ06820.1|4532524_4533154_+	thymidine kinase	NA	A0A023W530	Serratia_phage	55.0	1.1e-52
AUJ06821.1|4533612_4534851_+	histidine kinase	NA	NA	NA	NA	NA
AUJ07360.1|4534993_4536592_-	glucan biosynthesis protein D	NA	NA	NA	NA	NA
AUJ06822.1|4536660_4537752_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ07361.1|4537984_4538800_-	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	27.0	1.1e-18
AUJ06823.1|4539088_4540465_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
AUJ06824.1|4546943_4548848_-	phytochrome	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	3.0e-19
AUJ06825.1|4548844_4549447_-	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
AUJ06826.1|4549547_4550807_-	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
AUJ06827.1|4551097_4553260_-	epimerase	NA	NA	NA	NA	NA
AUJ06828.1|4553412_4553619_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06829.1|4553826_4554216_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06830.1|4554273_4555095_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06831.1|4555219_4556596_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.3	4.3e-60
AUJ06832.1|4556727_4557909_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06833.1|4558006_4561438_-	ATP-binding protein	NA	NA	NA	NA	NA
AUJ06834.1|4561585_4562284_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06835.1|4562267_4563740_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06836.1|4563736_4564324_-	cytoplasmic protein	NA	NA	NA	NA	NA
AUJ06837.1|4564323_4565520_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
AUJ06838.1|4565593_4566223_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	49.5	4.2e-47
AUJ06839.1|4566316_4566814_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ07362.1|4566929_4567073_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06840.1|4568227_4568752_+	FUSC family protein	NA	NA	NA	NA	NA
AUJ07363.1|4568723_4569740_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
AUJ06841.1|4570146_4571508_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.1	5.8e-33
AUJ06842.1|4571688_4573065_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
>prophage 32
CP019089	Xanthomonas oryzae pv. oryzae strain MAI106 chromosome, complete genome	4705454	4576931	4644521	4705454	protease,transposase	Leptospira_phage(23.53%)	52	NA	NA
AUJ06846.1|4576931_4577918_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	40.6	2.9e-42
AUJ06847.1|4577979_4578615_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06848.1|4578796_4579591_-	peptidase	NA	NA	NA	NA	NA
AUJ07365.1|4579761_4580235_+	ATPase	NA	NA	NA	NA	NA
AUJ06849.1|4582717_4583047_-	thiol reductase thioredoxin	NA	A0A0K1Y9C9	Streptomyces_phage	32.5	7.2e-06
AUJ06850.1|4583067_4583466_-	attachment protein	NA	NA	NA	NA	NA
AUJ06851.1|4584425_4584896_-	DNA mismatch repair protein MutT	NA	NA	NA	NA	NA
AUJ06852.1|4586643_4588020_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
AUJ06853.1|4588062_4588143_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06854.1|4588164_4588548_+|protease	metalloprotease	protease	NA	NA	NA	NA
AUJ06855.1|4588544_4588856_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07366.1|4589115_4589598_-	ATPase	NA	NA	NA	NA	NA
AUJ07367.1|4590146_4591064_+	histidine kinase	NA	NA	NA	NA	NA
AUJ06856.1|4591305_4591494_+	CsbD family protein	NA	NA	NA	NA	NA
AUJ06857.1|4592138_4592396_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06858.1|4592520_4592970_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06859.1|4593189_4594107_+	hypothetical protein	NA	K7PHD1	Enterobacteria_phage	47.3	1.7e-68
AUJ06860.1|4594116_4595061_-	hypothetical protein	NA	S5WIU1	Leptospira_phage	38.7	2.0e-32
AUJ06861.1|4595425_4598206_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AUJ06862.1|4598492_4599515_+	2-keto-3-deoxygluconate kinase	NA	NA	NA	NA	NA
AUJ07368.1|4600135_4601344_-	trans-2-enoyl-CoA reductase	NA	NA	NA	NA	NA
AUJ06863.1|4603315_4604482_+	alpha-hydroxy-acid oxidizing enzyme	NA	NA	NA	NA	NA
AUJ06864.1|4606433_4607810_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.0e-77
AUJ06865.1|4607820_4608114_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06866.1|4608224_4610420_-	ligand-gated channel	NA	A0A1B0VCF0	Salmonella_phage	40.6	2.4e-65
AUJ06867.1|4610518_4611721_+	aromatic amino acid aminotransferase	NA	NA	NA	NA	NA
AUJ06868.1|4611991_4613002_+	fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	7.3e-49
AUJ06869.1|4613276_4613744_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07369.1|4614393_4614936_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	42.3	3.0e-33
AUJ06870.1|4615120_4616497_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	4.6e-78
AUJ06871.1|4616612_4616936_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06872.1|4617042_4618011_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
AUJ06873.1|4619039_4621475_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06874.1|4621485_4622262_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06875.1|4622328_4623579_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ07370.1|4623598_4625725_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.3	7.9e-29
AUJ06876.1|4625897_4627229_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.6	2.2e-61
AUJ07371.1|4627294_4628410_+	enterochelin esterase	NA	NA	NA	NA	NA
AUJ07372.1|4628521_4628932_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06877.1|4629191_4629647_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06878.1|4629579_4629777_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06879.1|4629870_4630758_-	pseudouridylate synthase	NA	NA	NA	NA	NA
AUJ06880.1|4631091_4632669_+	chlamydia polymorphic membrane family protein	NA	NA	NA	NA	NA
AUJ06881.1|4633163_4633991_+	restriction endonuclease	NA	NA	NA	NA	NA
AUJ06882.1|4634717_4635776_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.6e-73
AUJ06883.1|4635932_4636115_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ06884.1|4637635_4638622_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.6e-43
AUJ06885.1|4638858_4639380_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06886.1|4639417_4640386_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
AUJ06887.1|4640854_4641592_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06888.1|4641609_4642302_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ06889.1|4643495_4644521_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.9e-49
