The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	7440	60864	4703977	transposase,protease	Leptospira_phage(28.57%)	42	NA	NA
AUJ14793.1|7440_8277_+|protease	CAAX protease family protein	protease	NA	NA	NA	NA
AUJ14794.1|8461_9268_+	peptidase	NA	NA	NA	NA	NA
AUJ14795.1|9544_10738_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14796.1|10891_11560_+	energy transducer TonB	NA	NA	NA	NA	NA
AUJ14797.1|11644_12406_+	biopolymer transporter ExbB	NA	NA	NA	NA	NA
AUJ14798.1|12452_12875_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AUJ14799.1|12878_13292_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
AUJ14800.1|13587_14355_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AUJ14801.1|14365_14635_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14802.1|14709_16170_-	cardiolipin synthase	NA	NA	NA	NA	NA
AUJ14803.1|17315_18692_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	4.1e-63
AUJ18019.1|18920_19805_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	2.0e-87
AUJ14804.1|19937_20924_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	40.6	9.9e-43
AUJ18020.1|21183_22242_-	radical SAM protein	NA	NA	NA	NA	NA
AUJ14805.1|23381_24722_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14806.1|24939_25632_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AUJ18021.1|25748_26069_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14807.1|27366_28890_-	peptidase S41	NA	A0A0R6PIZ1	Moraxella_phage	29.2	1.0e-25
AUJ18022.1|28994_30212_-	peptidase M23	NA	NA	NA	NA	NA
AUJ14808.1|30390_31047_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14809.1|31209_33021_+	aminopeptidase	NA	NA	NA	NA	NA
AUJ14810.1|33168_33519_-	peptidase propeptide and ypeb domain-containing protein	NA	NA	NA	NA	NA
AUJ14811.1|33825_34956_-	cellulase	NA	NA	NA	NA	NA
AUJ14812.1|35738_36791_-	cellulase	NA	NA	NA	NA	NA
AUJ14813.1|37491_38565_-	cellulase	NA	NA	NA	NA	NA
AUJ14814.1|38681_38888_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14815.1|38873_39932_+	hydroxyacid dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.7	3.9e-77
AUJ14816.1|40974_41238_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ14817.1|42339_42969_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14818.1|42991_44050_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.2e-75
AUJ14819.1|44131_45613_-	glutamate synthase small subunit	NA	NA	NA	NA	NA
AUJ14820.1|45807_50280_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
AUJ14821.1|50481_50862_-	Elastase inhibitor AFLEI Flags: Precursor	NA	NA	NA	NA	NA
AUJ14822.1|50918_52196_+	DNA topoisomerase	NA	A0A0U2TSJ7	Niemeyer_virus	35.3	1.4e-41
AUJ14823.1|52398_52704_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ18023.1|53193_53361_+	amino acid transporter	NA	NA	NA	NA	NA
AUJ18024.1|53890_55030_+	saccharopine dehydrogenase	NA	NA	NA	NA	NA
AUJ14824.1|55343_56129_-	Tat pathway signal protein	NA	NA	NA	NA	NA
AUJ18025.1|56139_58704_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AUJ14825.1|58900_60058_+	XylR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ14826.1|60100_60520_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ18026.1|60438_60864_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	206490	274370	4703977	transposase,integrase	Ralstonia_phage(20.0%)	58	249153:249169	276040:276056
AUJ18042.1|206490_206916_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ14929.1|207224_210617_-	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
AUJ14930.1|212395_212611_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14931.1|214592_214895_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14932.1|215051_215816_-	2,5-didehydrogluconate reductase B	NA	A0A2H4PQR8	Staphylococcus_phage	33.9	4.2e-33
AUJ14933.1|215838_216897_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.8e-74
AUJ14934.1|216999_218028_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
AUJ14935.1|218166_219138_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AUJ14936.1|219370_220225_+	methyltransferase	NA	NA	NA	NA	NA
AUJ18043.1|220317_220890_+	pseudouridine synthase	NA	NA	NA	NA	NA
AUJ14937.1|220911_221106_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14938.1|221212_221653_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14939.1|221954_224456_-	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	25.7	4.6e-20
AUJ18044.1|224609_225248_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14940.1|225840_226314_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	48.7	2.1e-35
AUJ18045.1|226499_227204_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AUJ14941.1|227753_228167_-	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
AUJ14942.1|229054_230311_-	aminotransferase V	NA	NA	NA	NA	NA
AUJ14943.1|231447_231840_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUJ14944.1|231951_234459_+	peptidase	NA	NA	NA	NA	NA
AUJ14945.1|234636_235095_-	gas vesicle protein	NA	NA	NA	NA	NA
AUJ14946.1|236228_237197_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
AUJ14947.1|237401_237653_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14948.1|238089_238275_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14949.1|239030_239339_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14950.1|239335_239767_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14951.1|240848_241661_+	hydrolase TatD	NA	NA	NA	NA	NA
AUJ14952.1|242357_242555_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14953.1|242530_243418_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ14954.1|243433_244795_+	MFS transporter	NA	NA	NA	NA	NA
AUJ14955.1|245234_246116_+	NAD-dependent deacetylase	NA	A0A068EPD4	Bacillus_phage	23.3	6.6e-14
AUJ18046.1|246195_247293_+	oxidoreductase	NA	NA	NA	NA	NA
AUJ14956.1|247330_248209_+	oxidoreductase	NA	NA	NA	NA	NA
AUJ18047.1|248551_248944_+	hypothetical protein	NA	NA	NA	NA	NA
249153:249169	attL	CATTGCGCCGATGCGCT	NA	NA	NA	NA
AUJ14957.1|249162_250014_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
AUJ14958.1|250097_250775_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUJ14959.1|250807_251215_-	ATP-binding protein	NA	W8CYF6	Bacillus_phage	32.5	4.7e-15
AUJ14960.1|251211_251457_-	histidine kinase	NA	NA	NA	NA	NA
AUJ18048.1|251473_252370_-	5,10-methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
AUJ14961.1|252627_253293_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14962.1|253292_254207_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ14963.1|254397_254991_+	FMN reductase	NA	NA	NA	NA	NA
AUJ14964.1|255133_256117_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14965.1|256144_257173_+	5-methyltetrahydropteroyltriglutamate-- homocysteine methyltransferase	NA	NA	NA	NA	NA
AUJ18049.1|257380_258337_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
AUJ14966.1|260765_261644_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUJ14967.1|261780_262212_+	transcriptional regulator	NA	NA	NA	NA	NA
AUJ18050.1|262429_262672_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14968.1|263793_264093_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14969.1|264195_264468_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14970.1|264745_265012_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ14971.1|265082_265292_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14972.1|265290_266259_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
AUJ18051.1|266705_266915_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14973.1|267124_267370_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14974.1|267613_270901_-	avirulence protein	NA	NA	NA	NA	NA
AUJ14975.1|271825_272794_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	44.0	5.9e-56
AUJ14976.1|272993_274370_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
276040:276056	attR	AGCGCATCGGCGCAATG	NA	NA	NA	NA
>prophage 3
CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	307057	366431	4703977	tRNA,transposase	Leptospira_phage(37.5%)	53	NA	NA
AUJ14996.1|307057_308962_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
AUJ14997.1|309222_309402_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14998.1|309535_310003_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ14999.1|310160_311120_+	serine/threonine dehydratase	NA	NA	NA	NA	NA
AUJ15000.1|311104_311719_+	protein sanA-like protein	NA	NA	NA	NA	NA
AUJ15001.1|311761_312181_+	isopropylmalate/homocitrate/citramalate synthase	NA	NA	NA	NA	NA
AUJ15002.1|312433_313339_-	aspartyl beta-hydroxylase	NA	S4VR59	Pandoravirus	39.1	9.8e-37
AUJ15003.1|313587_314472_-	malonyl-[acyl-carrier protein] O-methyltransferase BioC	NA	NA	NA	NA	NA
AUJ18055.1|315361_316123_-	pimeloyl-[acyl-carrier protein] methyl ester esterase	NA	NA	NA	NA	NA
AUJ15004.1|316286_316661_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15005.1|316852_318058_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
AUJ15006.1|318149_319184_-	biotin synthase BioB	NA	NA	NA	NA	NA
AUJ15007.1|319227_319959_+	amidophosphoribosyltransferase	NA	NA	NA	NA	NA
AUJ15008.1|320214_321120_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
AUJ15009.1|322067_323126_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.2e-75
AUJ15010.1|323161_325102_-	HpaF protein	NA	NA	NA	NA	NA
AUJ15011.1|325665_328074_-	serine kinase	NA	NA	NA	NA	NA
AUJ18056.1|328281_329136_-|transposase	transposase	transposase	U5P429	Shigella_phage	57.3	1.1e-85
AUJ15012.1|329540_330527_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	40.6	3.4e-43
AUJ15013.1|330379_330649_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ15014.1|331509_331956_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15015.1|331952_333953_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15016.1|334726_335197_-	4-hydroxyphenylacetate 3-monooxygenase	NA	NA	NA	NA	NA
AUJ15017.1|335251_335482_-	serine kinase	NA	NA	NA	NA	NA
AUJ15018.1|335613_335856_-	serine kinase	NA	NA	NA	NA	NA
AUJ15019.1|335865_336804_-	serine kinase	NA	NA	NA	NA	NA
AUJ15020.1|336800_337628_-	4-hydroxyphenylacetate catabolism regulator HpaA	NA	NA	NA	NA	NA
AUJ15021.1|337624_337885_-	EscS/YscS/HrcS family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
AUJ15022.1|337889_338534_-	EscR/YscR/HrcR family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
AUJ15023.1|338520_339474_-	aldolase	NA	NA	NA	NA	NA
AUJ15024.1|339566_340208_-	type III secretion protein HpaP	NA	NA	NA	NA	NA
AUJ15025.1|340207_342130_-	EscV/YscV/HrcV family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
AUJ18057.1|342138_343212_-	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
AUJ15026.1|343427_343883_+	serine kinase	NA	NA	NA	NA	NA
AUJ15027.1|343916_344309_+	type III secretion protein HrpB2	NA	NA	NA	NA	NA
AUJ15028.1|344310_345075_+	EscJ/YscJ/HrcJ family type III secretion inner membrane ring protein	NA	NA	NA	NA	NA
AUJ15029.1|345082_345712_+	type III secretion protein HrpB4	NA	NA	NA	NA	NA
AUJ15030.1|345696_346398_+	ATP-dependent helicase HrpB	NA	NA	NA	NA	NA
AUJ15031.1|346387_347716_+	EscN/YscN/HrcN family type III secretion system ATPase	NA	NA	NA	NA	NA
AUJ15032.1|347708_348218_+	type III secretion protein HrpB7	NA	NA	NA	NA	NA
AUJ15033.1|348214_349045_+	EscT/YscT/HrcT family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
AUJ15034.1|349127_350951_+	EscC/YscC/HrcC family type III secretion system outer membrane ring protein	NA	NA	NA	NA	NA
AUJ15035.1|351690_352122_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ18058.1|352669_353089_+	lytic transglycosylase	NA	A0A0K2QQJ4	Ralstonia_phage	39.4	5.0e-12
AUJ15036.1|353552_355106_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15037.1|356372_356714_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15038.1|356991_359457_+	Ion channel protein	NA	NA	NA	NA	NA
AUJ15039.1|359475_359736_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15040.1|359815_360784_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.6e-98
AUJ15041.1|360909_362634_-	ABC transporter substrate-binding protein	NA	A0A0P0CRE2	Ostreococcus_lucimarinus_virus	28.7	3.0e-34
AUJ15042.1|362644_362857_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15043.1|362874_363816_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15044.1|365372_366431_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.2e-75
>prophage 4
CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	492692	620084	4703977	terminase,transposase,tail,capsid,portal,head,plate,tRNA,integrase	Stenotrophomonas_phage(39.62%)	106	518319:518363	561302:561346
AUJ15137.1|492692_493256_-|tRNA	tRNA threonylcarbamoyladenosine biosynthesis protein RimN	tRNA	NA	NA	NA	NA
AUJ15138.1|493266_495759_-	DNA topoisomerase I	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	35.3	1.9e-114
AUJ15139.1|495941_497216_-	RDD family protein	NA	NA	NA	NA	NA
AUJ15140.1|497257_497980_-	pilus assembly protein PilA	NA	NA	NA	NA	NA
AUJ15141.1|498020_498494_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15142.1|498536_499679_-	DNA protecting protein DprA	NA	NA	NA	NA	NA
AUJ15143.1|499750_500887_-	peptidoglycan-binding protein LysM	NA	G3MBQ1	Bacillus_virus	57.1	1.7e-09
AUJ15144.1|501019_501532_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	2.6e-18
AUJ15145.1|501932_502856_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
AUJ15146.1|502855_504169_+	16S rRNA (cytosine(967)-C(5))-methyltransferase	NA	NA	NA	NA	NA
AUJ15147.1|506119_507397_+	polymerase	NA	NA	NA	NA	NA
AUJ15148.1|507594_508419_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AUJ15149.1|508419_509478_+	CDP-glycerol glycerophosphotransferase	NA	NA	NA	NA	NA
AUJ15150.1|509644_511150_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ18074.1|511146_511656_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15151.1|511765_512899_-	GTP cyclohydrolase	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.1e-28
AUJ15152.1|513141_513663_+	N-acetyltransferase	NA	NA	NA	NA	NA
AUJ15153.1|513861_514776_-	lipid A biosynthesis lauroyl acyltransferase	NA	NA	NA	NA	NA
AUJ15154.1|514876_515317_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
AUJ15155.1|515425_517300_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
AUJ15156.1|517492_517813_+	hypothetical protein	NA	NA	NA	NA	NA
518319:518363	attL	CTCATAATCCTTTGGTTGAAGGTTCGAATCCTTCTGGGCCCACCA	NA	NA	NA	NA
AUJ15157.1|518432_519620_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	50.5	6.0e-111
AUJ15158.1|519619_519844_-	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	71.4	6.1e-17
AUJ15159.1|519840_520047_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15160.1|520043_520316_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ18076.1|520312_520462_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15161.1|520554_520830_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ18075.1|520822_520978_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15162.1|520991_521402_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15163.1|521627_521906_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ18077.1|521902_522121_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ18078.1|522429_525102_-	bifunctional DNA primase/helicase	NA	V9IQW5	Stenotrophomonas_phage	69.7	0.0e+00
AUJ15164.1|525135_525348_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15165.1|525344_525623_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15166.1|525633_525954_-	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	56.5	6.3e-23
AUJ15167.1|525956_526214_-	DNA-binding protein	NA	A0A2H4JE67	uncultured_Caudovirales_phage	46.4	6.6e-07
AUJ15168.1|526285_526723_+	transcriptional regulator	NA	E5E3P4	Burkholderia_phage	32.0	5.4e-09
AUJ18079.1|527083_527368_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15169.1|527383_528370_-	late control protein	NA	V9IQM7	Stenotrophomonas_phage	54.8	2.5e-94
AUJ15170.1|528366_528768_-	oxidoreductase	NA	V9IQX3	Stenotrophomonas_phage	62.3	6.0e-39
AUJ15171.1|528780_531651_-|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	47.5	6.2e-194
AUJ15172.1|531683_531797_-	hypothetical protein	NA	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
AUJ15173.1|531805_532108_-|tail	phage tail protein	tail	A4PE51	Ralstonia_virus	62.6	6.3e-25
AUJ15174.1|532153_532663_-|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	79.9	1.8e-72
AUJ15175.1|532693_533860_-|tail	phage tail protein	tail	E5FFG9	Burkholderia_phage	62.4	4.6e-132
AUJ15176.1|533871_534231_-|plate	baseplate assembly protein	plate	V9IQW0	Stenotrophomonas_phage	66.1	4.3e-36
AUJ15177.1|534227_534791_-|plate	baseplate assembly protein	plate	Q9ZXL0	Pseudomonas_virus	43.7	3.1e-25
AUJ15178.1|534851_535430_-|tail	phage tail protein	tail	NA	NA	NA	NA
AUJ15179.1|535437_536943_-	hypothetical protein	NA	V9IQX0	Stenotrophomonas_phage	47.0	2.1e-52
AUJ15180.1|536952_537498_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	54.7	3.5e-50
AUJ15181.1|537490_538381_-|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	53.7	7.2e-85
AUJ15182.1|538462_538912_-	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	54.7	1.8e-36
AUJ15183.1|538899_539319_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	65.2	2.0e-40
AUJ15184.1|539792_540434_-	lysozyme	NA	V9IQK6	Stenotrophomonas_phage	60.9	7.9e-49
AUJ15185.1|540430_540706_-	hypothetical protein	NA	V9IQV8	Stenotrophomonas_phage	59.8	3.0e-21
AUJ15186.1|540698_541055_-	hypothetical protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	4.5e-22
AUJ15187.1|541059_541269_-|tail	phage tail protein	tail	K4PAW7	Burkholderia_phage	59.4	5.4e-15
AUJ15188.1|541268_541736_-|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	49.7	9.2e-31
AUJ15189.1|541835_542555_-|terminase	terminase	terminase	Q9ZXM2	Pseudomonas_virus	63.4	2.0e-69
AUJ15190.1|542558_543578_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	70.9	2.1e-136
AUJ15191.1|543624_544467_-|capsid	phage capsid protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	52.6	1.7e-67
AUJ15192.1|544588_546373_+|terminase	terminase	terminase	V9IQL5	Stenotrophomonas_phage	75.1	1.2e-267
AUJ15193.1|546372_547392_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	72.5	4.1e-140
AUJ15194.1|547412_547643_+	hypothetical protein	NA	V9IQK2	Stenotrophomonas_phage	54.8	1.9e-13
AUJ15195.1|547575_548280_+	DNA modification methylase	NA	V9IQV5	Stenotrophomonas_phage	77.8	3.3e-109
AUJ15196.1|548311_548779_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15197.1|548778_549957_-	DNA-binding protein	NA	NA	NA	NA	NA
AUJ15198.1|550687_553447_+	type IV secretion protein Rhs	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.3	1.8e-41
AUJ15199.1|553455_554382_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15200.1|554378_557213_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15201.1|557240_557972_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15202.1|557998_560341_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15203.1|561413_561647_-	hypothetical protein	NA	V9IQN0	Stenotrophomonas_phage	53.1	4.1e-16
561302:561346	attR	CTCATAATCCTTTGGTTGAAGGTTCGAATCCTTCTGGGCCCACCA	NA	NA	NA	NA
AUJ15204.1|562003_562858_+|transposase	transposase	transposase	U5P429	Shigella_phage	57.7	6.3e-86
AUJ18080.1|563523_564804_-	transcription termination factor Rho	NA	NA	NA	NA	NA
AUJ15205.1|565629_565971_-	thiol reductase thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	44.4	2.3e-15
AUJ15206.1|566169_567894_+	ATP-dependent RNA helicase RhlB	NA	A0A1V0SBR7	Catovirus	29.4	1.1e-47
AUJ18081.1|567969_568656_+	cell division ATP-binding protein FtsE	NA	NA	NA	NA	NA
AUJ15207.1|568652_569603_+	ABC transporter permease	NA	NA	NA	NA	NA
AUJ18082.1|569659_570454_+	histidine kinase	NA	NA	NA	NA	NA
AUJ15208.1|570450_571176_+	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	44.3	4.7e-50
AUJ15209.1|571392_572268_+	RNA polymerase factor sigma-32	NA	A0A248SJA5	Salicola_phage	39.5	3.6e-44
AUJ15210.1|572346_572961_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15211.1|573013_574306_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AUJ15212.1|576596_576884_+	co-chaperone GroES	NA	A0A221S331	uncultured_virus	40.0	5.1e-16
AUJ15213.1|577027_578668_+	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	63.5	5.1e-177
AUJ15214.1|578968_581245_-	type III secretion system effector protein	NA	NA	NA	NA	NA
AUJ15215.1|582352_583321_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
AUJ15216.1|585706_586675_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
AUJ15217.1|587606_588680_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	47.9	4.3e-84
AUJ15218.1|589166_591374_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ18083.1|591467_593885_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15219.1|594148_595069_-	gluconolactonase	NA	NA	NA	NA	NA
AUJ15220.1|595068_595587_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ18084.1|595748_598574_+	bifunctional glutamine synthetase adenylyltransferase/deadenyltransferase	NA	NA	NA	NA	NA
AUJ15221.1|598669_599230_-	hypothetical protein	NA	A0A2I7SAW6	Vibrio_phage	30.2	1.4e-12
AUJ15222.1|600936_602313_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
AUJ15223.1|603297_603900_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15224.1|606405_606906_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15225.1|607806_608754_-	nucleoside-diphosphate sugar epimerase	NA	NA	NA	NA	NA
AUJ18085.1|608890_609481_+	nitroreductase family protein	NA	NA	NA	NA	NA
AUJ15226.1|609691_610435_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
AUJ15227.1|612750_615438_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
AUJ15228.1|615524_616262_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15229.1|616272_617649_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	7.1e-63
AUJ15230.1|618707_620084_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	7.1e-63
>prophage 5
CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	628012	710839	4703977	transposase,tRNA,protease	Acidithiobacillus_phage(14.29%)	54	NA	NA
AUJ15235.1|628012_628975_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
AUJ15236.1|629262_630639_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
AUJ15237.1|631644_635469_+	avirulence protein	NA	NA	NA	NA	NA
AUJ18086.1|635561_635954_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ15238.1|635847_636372_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	42.9	8.7e-22
AUJ15239.1|636538_638122_-	oxidoreductase	NA	M1NLX1	Moumouvirus	27.5	6.5e-36
AUJ15240.1|638512_638704_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ18087.1|641204_643517_-	S9 family peptidase	NA	NA	NA	NA	NA
AUJ15241.1|645432_646524_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ18088.1|647488_648397_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUJ15242.1|648564_649440_+	EamA family transporter	NA	NA	NA	NA	NA
AUJ15243.1|649717_651490_-	cellulase	NA	NA	NA	NA	NA
AUJ15244.1|651887_653588_-	1,4-beta-cellobiosidase	NA	NA	NA	NA	NA
AUJ18089.1|654742_656119_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
AUJ18090.1|656205_657201_-	type III secretion system effector protein	NA	NA	NA	NA	NA
AUJ15245.1|657446_658358_+	magnesium transporter	NA	NA	NA	NA	NA
AUJ15246.1|658892_659177_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15247.1|659506_659953_+	autotransporter	NA	NA	NA	NA	NA
AUJ15248.1|660264_660528_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ15249.1|660380_661367_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-43
AUJ15250.1|662075_663452_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
AUJ18091.1|663489_664149_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	62.0	6.6e-67
AUJ15251.1|664624_666316_-	alpha,alpha-trehalase	NA	NA	NA	NA	NA
AUJ15252.1|666568_667354_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15253.1|668597_669602_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ18092.1|669640_670582_-	histidine kinase	NA	NA	NA	NA	NA
AUJ15254.1|671105_673994_-	peptidase M16	NA	NA	NA	NA	NA
AUJ15255.1|674246_676829_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	29.2	3.2e-08
AUJ15256.1|677406_677883_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ15257.1|680808_682263_-	endoglucanase	NA	H2DE45	Erwinia_phage	32.6	5.2e-48
AUJ15258.1|682470_683958_+	sodium-independent anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	57.1	2.4e-125
AUJ18093.1|684237_685191_+	hypothetical protein	NA	A0A127AWB9	Bacillus_phage	38.0	1.7e-15
AUJ15259.1|685359_687009_+	peptidase M20	NA	NA	NA	NA	NA
AUJ15260.1|688000_689938_+	glucan biosynthesis glucosyltransferase H	NA	NA	NA	NA	NA
AUJ15261.1|690089_690758_+	carboxylesterase	NA	NA	NA	NA	NA
AUJ15262.1|690762_691815_+	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.6	1.4e-18
AUJ15263.1|691845_692583_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUJ15264.1|692613_693528_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
AUJ15265.1|694090_694891_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15266.1|695452_696418_+	transcriptional regulator	NA	NA	NA	NA	NA
AUJ15267.1|696526_697096_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15268.1|697480_697792_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15269.1|697859_699953_+	S9 family peptidase	NA	NA	NA	NA	NA
AUJ15270.1|700547_701732_-	aminotransferase	NA	NA	NA	NA	NA
AUJ15271.1|701757_701940_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ18094.1|701877_703977_+	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	26.1	1.7e-28
AUJ18095.1|704320_704719_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15272.1|704776_705019_+	sugar transporter	NA	NA	NA	NA	NA
AUJ15273.1|705008_705863_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
AUJ15274.1|705850_706531_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ18096.1|706688_707642_+	tyrosine recombinase XerC	NA	A0A142F2H8	Mycobacterium_phage	28.1	1.8e-12
AUJ15275.1|708157_708709_+	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
AUJ15276.1|708813_710181_+|protease	ATP-dependent protease ATP-binding subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	29.5	4.7e-43
AUJ15277.1|710383_710839_-|tRNA	tRNA-specific adenosine deaminase	tRNA	NA	NA	NA	NA
>prophage 6
CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	728017	803797	4703977	transposase,tRNA,protease,tail	Tupanvirus(11.76%)	54	NA	NA
AUJ15292.1|728017_729049_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	7.9e-75
AUJ15293.1|730350_731742_+	endopolygalacturonase	NA	NA	NA	NA	NA
AUJ15294.1|732010_733150_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
AUJ15295.1|733146_734562_+	hypothetical protein	NA	F5B3X9	Synechococcus_phage	50.6	4.3e-15
AUJ15296.1|735063_736269_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	40.9	1.6e-66
AUJ15297.1|736568_737222_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15298.1|737348_737627_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15299.1|737614_738313_+	octanoyltransferase	NA	NA	NA	NA	NA
AUJ15300.1|738327_739341_+	lipoyl synthase	NA	NA	NA	NA	NA
AUJ15301.1|739739_741923_+|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	31.4	3.7e-82
AUJ15302.1|742214_743081_-	endonuclease	NA	NA	NA	NA	NA
AUJ15303.1|743242_744298_+	ADP-ribose pyrophosphatase	NA	A0A1B0V161	Roseobacter_phage	47.1	3.7e-80
AUJ15304.1|744420_745824_+	nicotinate phosphoribosyltransferase	NA	A0A218M332	Acidovorax_phage	52.6	6.6e-133
AUJ15305.1|748007_748805_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15306.1|748929_749310_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15307.1|749481_750819_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15308.1|750839_751781_+	6-phosphogluconate dehydrogenase (decarboxylating)	NA	M4SJX8	Cyanophage	44.6	8.5e-68
AUJ15309.1|752120_753179_-	oxidoreductase	NA	NA	NA	NA	NA
AUJ18097.1|753338_753701_+	BON domain-containing protein	NA	NA	NA	NA	NA
AUJ15310.1|753985_755797_+	histidine kinase	NA	A0A2K9L0Z8	Tupanvirus	27.8	3.5e-09
AUJ15311.1|755793_756234_+	response regulator	NA	NA	NA	NA	NA
AUJ15312.1|756237_757740_+	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L5I4	Tupanvirus	26.9	4.9e-09
AUJ15313.1|757831_758347_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AUJ15314.1|758515_759253_-	pteridine reductase	NA	NA	NA	NA	NA
AUJ15315.1|759320_760505_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUJ15316.1|761600_761795_-	hypothetical protein	NA	U5P4I9	Shigella_phage	51.0	2.2e-07
AUJ15317.1|761905_762874_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	2.3e-100
AUJ15318.1|763902_766611_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUJ15319.1|766761_769656_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	25.2	2.0e-22
AUJ15320.1|769652_772049_+	alpha-N-acetylglucosaminidase	NA	NA	NA	NA	NA
AUJ15321.1|772182_773349_+	DUF5009 domain-containing protein	NA	NA	NA	NA	NA
AUJ15322.1|773563_774331_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ15323.1|774375_775653_+	glucose/galactose MFS transporter	NA	NA	NA	NA	NA
AUJ15324.1|775693_776761_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUJ15325.1|776767_777796_+	iron dicitrate transport regulator FecR	NA	NA	NA	NA	NA
AUJ15326.1|777798_778953_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
AUJ15327.1|779457_780063_-	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
AUJ15328.1|780059_781313_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
AUJ15329.1|781314_783213_-	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
AUJ15330.1|783214_785257_-	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
AUJ15331.1|785814_786438_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	42.0	2.8e-35
AUJ15332.1|786470_787703_-|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	K4IEX3	Salmonella_phage	41.5	2.3e-73
AUJ15333.1|787923_788892_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
AUJ18098.1|791073_791430_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15334.1|791469_792162_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ18099.1|794256_794994_-	endonuclease	NA	NA	NA	NA	NA
AUJ15335.1|795043_795859_-	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AUJ15336.1|795950_796601_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AUJ18100.1|796694_797435_-	cytochrome C	NA	NA	NA	NA	NA
AUJ15337.1|797636_798260_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
AUJ18101.1|798353_799049_-	nodulin 21	NA	NA	NA	NA	NA
AUJ15338.1|799264_800629_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
AUJ15339.1|800815_801745_-	two-component system sensor protein	NA	W8CYF6	Bacillus_phage	25.2	1.7e-15
AUJ15340.1|802420_803797_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
>prophage 7
CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	832344	902122	4703977	transposase,protease	Streptococcus_phage(25.0%)	56	NA	NA
AUJ15367.1|832344_832821_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ15368.1|834770_836123_+	type III secretion system effector protein	NA	NA	NA	NA	NA
AUJ15369.1|836572_836665_+	K+-transporting ATPase subunit F	NA	NA	NA	NA	NA
AUJ15370.1|836680_838474_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AUJ15371.1|838486_840535_+	potassium-transporting ATPase subunit B	NA	E4ZFI9	Streptococcus_phage	28.2	1.7e-36
AUJ15372.1|840575_841205_+	potassium-transporting ATPase C chain	NA	NA	NA	NA	NA
AUJ15373.1|841255_843916_+	two-component sensor histidine kinase	NA	B5LWN0	Feldmannia_species_virus	28.1	1.6e-10
AUJ15374.1|843905_844622_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUJ15375.1|846472_846736_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ15376.1|846588_847575_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-43
AUJ15377.1|848129_849515_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AUJ18103.1|849511_850051_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15378.1|850080_850449_-	YraN family protein	NA	NA	NA	NA	NA
AUJ15379.1|850453_852184_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
AUJ15380.1|852265_853087_+	rRNA (cytidine-2'-O-)-methyltransferase	NA	M1PLC5	Streptococcus_phage	38.3	9.5e-39
AUJ18104.1|854503_854728_-	plasmid maintenance protein CcdB	NA	NA	NA	NA	NA
AUJ15381.1|854803_855571_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15382.1|855885_856341_+	cell division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
AUJ18105.1|856385_857399_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase	NA	NA	NA	NA	NA
AUJ15383.1|857395_857659_+	cell division protein FtsL	NA	NA	NA	NA	NA
AUJ15384.1|857792_859670_+	cell division protein	NA	NA	NA	NA	NA
AUJ15385.1|859666_861154_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
AUJ15386.1|861150_862662_+	UDP-N-acetylmuramoylalanyl-D-glutamyl-2, 6-diaminopimelate--D-alanyl-D-alanine ligase	NA	NA	NA	NA	NA
AUJ15387.1|862651_863737_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
AUJ15388.1|863736_865110_+	cell division protein FtsW	NA	NA	NA	NA	NA
AUJ15389.1|865106_866432_+	UDP-N-acetylglucosamine--N-acetylmuramyl- (pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase	NA	NA	NA	NA	NA
AUJ15390.1|866428_867862_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
AUJ15391.1|867858_868815_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
AUJ15392.1|868939_869761_+	cell division protein FtsQ	NA	NA	NA	NA	NA
AUJ15393.1|869757_870993_+	cell division protein FtsA	NA	NA	NA	NA	NA
AUJ15394.1|871301_872546_+	cell division protein FtsZ	NA	NA	NA	NA	NA
AUJ15395.1|872773_873685_+	UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
AUJ15396.1|873871_874324_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15397.1|874324_875266_+	peptidase M23	NA	A0A292GJG6	Xanthomonas_phage	46.4	2.0e-29
AUJ15398.1|875422_878161_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
AUJ18106.1|878626_878995_+	glyoxalase	NA	NA	NA	NA	NA
AUJ15399.1|879135_880083_+	DNA mismatch repair protein MutT	NA	NA	NA	NA	NA
AUJ15400.1|880268_880898_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15401.1|881265_882093_-	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
AUJ15402.1|882132_883512_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15403.1|884007_884985_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
AUJ18107.1|885221_886979_+|protease	protease	protease	NA	NA	NA	NA
AUJ15404.1|887058_887241_-	glyoxalase	NA	NA	NA	NA	NA
AUJ15405.1|887841_888777_+	D-galactose 1-dehydrogenase	NA	NA	NA	NA	NA
AUJ15406.1|889316_889739_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15407.1|889925_890471_+	nucleoprotein/polynucleotide-associated enzyme	NA	NA	NA	NA	NA
AUJ15408.1|890700_891258_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15409.1|891408_892095_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15410.1|892587_893520_+	sulfotransferase	NA	A0A1X9T5H0	Ranid_herpesvirus	36.4	1.2e-05
AUJ18108.1|893551_894334_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUJ15411.1|894563_896006_-	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	30.9	1.1e-47
AUJ15412.1|896318_896864_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15413.1|897057_899772_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
AUJ15414.1|899831_900467_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ15415.1|901019_902006_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-43
AUJ15416.1|901858_902122_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	1073126	1134140	4703977	transposase,protease	Leptospira_phage(18.18%)	46	NA	NA
AUJ15563.1|1073126_1074185_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.8e-74
AUJ15564.1|1075218_1076187_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	2.8e-98
AUJ15565.1|1078089_1079463_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15566.1|1079561_1081601_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
AUJ15567.1|1081808_1082831_-	NADPH:quinone reductase	NA	NA	NA	NA	NA
AUJ18121.1|1082804_1082999_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15568.1|1083246_1084344_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15569.1|1084536_1085046_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15570.1|1085065_1085926_+	pseudouridylate synthase	NA	NA	NA	NA	NA
AUJ15571.1|1085876_1086269_-	HNH endonuclease	NA	NA	NA	NA	NA
AUJ15572.1|1086271_1087480_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.5	2.9e-20
AUJ18122.1|1087651_1088668_+	sulfate transporter subunit	NA	NA	NA	NA	NA
AUJ15573.1|1088671_1089532_+	sulfate ABC transporter permease subunit CysT	NA	NA	NA	NA	NA
AUJ15574.1|1089528_1090482_+	sulfate ABC transporter permease subunit CysW	NA	NA	NA	NA	NA
AUJ18123.1|1090489_1091524_+	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	2.0e-25
AUJ15575.1|1091883_1092597_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ18124.1|1092666_1093689_-	L-threonine 3-dehydrogenase	NA	NA	NA	NA	NA
AUJ15576.1|1094204_1096538_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AUJ15577.1|1098952_1101103_+	dipeptidyl-peptidase 7	NA	NA	NA	NA	NA
AUJ15578.1|1101195_1101840_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
AUJ15579.1|1102021_1102372_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15580.1|1102810_1104109_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AUJ15581.1|1104176_1105259_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
AUJ15582.1|1105473_1106214_+	colicin V synthesis protein	NA	NA	NA	NA	NA
AUJ15583.1|1106250_1107717_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.1	8.3e-86
AUJ18125.1|1107855_1108680_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15584.1|1109399_1109876_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ15585.1|1110660_1111080_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15586.1|1111259_1112003_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
AUJ15587.1|1112155_1112518_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15588.1|1112637_1113180_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AUJ15589.1|1113160_1114297_-	glycosyl transferase	NA	NA	NA	NA	NA
AUJ15590.1|1114501_1116028_-	exopolyphosphatase	NA	NA	NA	NA	NA
AUJ15591.1|1116199_1118302_-	RNA degradosome polyphosphate kinase	NA	NA	NA	NA	NA
AUJ15592.1|1118405_1119749_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	33.8	5.0e-29
AUJ15593.1|1119806_1120496_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.7	5.9e-34
AUJ18126.1|1120670_1122317_-	peptidase	NA	NA	NA	NA	NA
AUJ15594.1|1122466_1122775_+	glutaredoxin 3	NA	A0A2L0UZG6	Agrobacterium_phage	43.2	4.7e-07
AUJ15595.1|1122771_1123167_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AUJ15596.1|1123381_1124389_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
AUJ15597.1|1124529_1125291_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15598.1|1126497_1127556_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.6e-73
AUJ15599.1|1128872_1129841_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
AUJ15600.1|1131116_1131590_-	histidine kinase	NA	NA	NA	NA	NA
AUJ15601.1|1132128_1133421_+	trigger factor	NA	NA	NA	NA	NA
AUJ15602.1|1133513_1134140_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
>prophage 9
CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	1243051	1319955	4703977	transposase,protease	Bacillus_phage(15.38%)	54	NA	NA
AUJ15678.1|1243051_1244449_-|protease	serine protease	protease	NA	NA	NA	NA
AUJ15679.1|1244876_1246847_+	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
AUJ15680.1|1246761_1247436_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15681.1|1247691_1248537_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ18139.1|1248825_1250946_+	peptidase S9	NA	NA	NA	NA	NA
AUJ15682.1|1251222_1251684_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15683.1|1251815_1252541_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUJ15684.1|1253358_1255500_+	outer protein P	NA	NA	NA	NA	NA
AUJ15685.1|1255616_1257752_+	outer protein P	NA	NA	NA	NA	NA
AUJ15686.1|1258716_1258911_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ18140.1|1259822_1261061_-	type III secretion system effector protein	NA	NA	NA	NA	NA
AUJ15687.1|1261886_1263992_-	catalase HPII	NA	A0A2K9L0T1	Tupanvirus	47.7	1.9e-136
AUJ15688.1|1264209_1264383_-	oxidoreductase	NA	NA	NA	NA	NA
AUJ15689.1|1265641_1266289_-	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	45.5	6.5e-35
AUJ15690.1|1266285_1266837_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15691.1|1266960_1267143_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ18141.1|1267202_1270136_-	glycine dehydrogenase (aminomethyl-transferring)	NA	M4QFZ1	Prochlorococcus_phage	49.9	8.9e-257
AUJ15692.1|1270603_1270795_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ18142.1|1271225_1272029_+	sulfotransferase	NA	M4QPS9	Synechococcus_phage	27.7	9.0e-26
AUJ18143.1|1272117_1273329_+	hemolysin D	NA	NA	NA	NA	NA
AUJ15693.1|1273325_1275485_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.0	2.2e-34
AUJ15694.1|1276293_1276698_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15695.1|1276779_1278798_-	peptidase M20	NA	NA	NA	NA	NA
AUJ15696.1|1278909_1280580_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
AUJ18144.1|1280576_1281341_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ18145.1|1281440_1283111_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15697.1|1283393_1284110_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	2.8e-23
AUJ15698.1|1284102_1285395_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AUJ15699.1|1285546_1286038_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15700.1|1286106_1286364_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
AUJ15701.1|1286366_1287176_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
AUJ15702.1|1287211_1287952_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
AUJ15703.1|1287956_1288556_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUJ15704.1|1288800_1289997_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AUJ15705.1|1289996_1290638_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUJ15706.1|1290988_1292185_+	polyketide cyclase	NA	NA	NA	NA	NA
AUJ15707.1|1292266_1292653_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15708.1|1292655_1293330_+	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
AUJ18146.1|1293393_1294020_-	peptidase	NA	NA	NA	NA	NA
AUJ15709.1|1294321_1294501_-	Arc family DNA binding domain-containing protein	NA	NA	NA	NA	NA
AUJ15710.1|1294497_1294782_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15711.1|1295397_1296600_+	phosphoribosylglycinamide formyltransferase 2	NA	NA	NA	NA	NA
AUJ15712.1|1297576_1298308_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15713.1|1298507_1299386_+	hypothetical protein	NA	A8ATW4	Listeria_phage	34.5	3.9e-06
AUJ15714.1|1299493_1299754_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15715.1|1305042_1306026_+	type VI secretion-associated protein	NA	NA	NA	NA	NA
AUJ15716.1|1306022_1306817_+	cell envelope biogenesis protein OmpA	NA	NA	NA	NA	NA
AUJ15717.1|1306869_1307940_-	type VI secretion protein	NA	NA	NA	NA	NA
AUJ15718.1|1308843_1309902_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.8e-74
AUJ15719.1|1309973_1312796_+	type IV secretion protein Rhs	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.4	1.0e-52
AUJ15720.1|1313301_1314318_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.3	7.3e-49
AUJ15721.1|1315425_1316802_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	3.0e-77
AUJ15722.1|1316945_1318322_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.6	5.1e-61
AUJ15723.1|1318986_1319955_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
>prophage 10
CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	1342366	1395004	4703977	transposase	Ralstonia_phage(27.27%)	43	NA	NA
AUJ15738.1|1342366_1343353_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.6e-43
AUJ15739.1|1343205_1343469_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ15740.1|1343513_1344290_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	53.1	4.1e-52
AUJ15741.1|1345977_1347042_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
AUJ15742.1|1347056_1347308_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15743.1|1347607_1348720_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
AUJ15744.1|1348716_1349259_-	shikimate kinase	NA	NA	NA	NA	NA
AUJ15745.1|1349425_1350025_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
AUJ15746.1|1350205_1350622_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15747.1|1350634_1351408_+	PspA-IM30 family protein	NA	NA	NA	NA	NA
AUJ15748.1|1351433_1352516_+	potassium channel protein	NA	NA	NA	NA	NA
AUJ18149.1|1352518_1353190_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15749.1|1353227_1353632_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
AUJ15750.1|1353644_1354217_+	hypothetical protein	NA	A0A191ZBZ0	Erwinia_phage	28.1	6.4e-10
AUJ15751.1|1354218_1355385_+	hypothetical protein	NA	B2ZXR7	Ralstonia_phage	41.6	6.4e-73
AUJ18150.1|1358330_1360013_+	peptidase M1	NA	NA	NA	NA	NA
AUJ15752.1|1361062_1364209_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUJ15753.1|1364228_1364465_-	transcriptional regulator	NA	NA	NA	NA	NA
AUJ15754.1|1364540_1365293_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AUJ15755.1|1365303_1366350_+	cupin	NA	NA	NA	NA	NA
AUJ15756.1|1366390_1367908_+	tryptophan halogenase	NA	A0A1D7SF58	Cyanophage	31.8	5.8e-50
AUJ15757.1|1367945_1368950_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AUJ18151.1|1369094_1369493_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ18152.1|1369624_1371001_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	6.0e-78
AUJ15758.1|1371143_1371329_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ18153.1|1371588_1372542_-	endoproteinase ArgC	NA	NA	NA	NA	NA
AUJ15759.1|1373427_1374810_-	porin	NA	NA	NA	NA	NA
AUJ15760.1|1375002_1375767_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ15761.1|1376080_1377022_+	amino acid amidase	NA	NA	NA	NA	NA
AUJ15762.1|1377777_1379166_+	amino acid transporter	NA	NA	NA	NA	NA
AUJ18154.1|1381115_1382534_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	41.0	8.8e-93
AUJ15763.1|1382526_1383429_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15764.1|1383428_1384670_-	DNA (cytosine-5-)-methyltransferase	NA	M1PSQ0	Streptococcus_phage	34.7	3.2e-54
AUJ15765.1|1384902_1385871_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.6e-98
AUJ15766.1|1386991_1388008_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AUJ18155.1|1388068_1388863_-	phospholipase	NA	NA	NA	NA	NA
AUJ15767.1|1389022_1390384_-	magnesium transporter	NA	NA	NA	NA	NA
AUJ15768.1|1390446_1390671_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15769.1|1390671_1392402_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	24.1	1.0e-10
AUJ15770.1|1392460_1392730_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AUJ15771.1|1392722_1393115_-	PTS fructose IIA subunit family protein	NA	NA	NA	NA	NA
AUJ15772.1|1393508_1394477_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
AUJ15773.1|1394602_1395004_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 11
CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	1419882	1482807	4703977	transposase	Ralstonia_phage(27.27%)	56	NA	NA
AUJ15802.1|1419882_1420941_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.2e-75
AUJ15803.1|1421007_1421976_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
AUJ15804.1|1422279_1422609_-	benzene 1,2-dioxygenase	NA	NA	NA	NA	NA
AUJ15805.1|1422605_1423145_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUJ15806.1|1423354_1424323_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
AUJ15807.1|1424436_1425681_-	cysteine sulfinate desulfinase	NA	Q2XUY6	environmental_halophage	41.7	5.0e-92
AUJ15808.1|1425677_1426940_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
AUJ15809.1|1426939_1427704_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.5	2.0e-11
AUJ15810.1|1427961_1429419_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
AUJ15811.1|1429434_1429893_-	transcriptional regulator	NA	NA	NA	NA	NA
AUJ15812.1|1430064_1430532_+	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
AUJ15813.1|1430636_1430855_+	peptidase	NA	NA	NA	NA	NA
AUJ15814.1|1431461_1432058_-	DUF1439 domain-containing protein	NA	NA	NA	NA	NA
AUJ15815.1|1432113_1432656_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15816.1|1432713_1433055_-	DUF3861 domain-containing protein	NA	NA	NA	NA	NA
AUJ18158.1|1433112_1433727_-	peptidase	NA	NA	NA	NA	NA
AUJ15817.1|1433858_1434242_-	DNA-binding protein	NA	NA	NA	NA	NA
AUJ15818.1|1434838_1435837_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
AUJ15819.1|1435742_1436435_-	YggS family pyridoxal phosphate enzyme	NA	NA	NA	NA	NA
AUJ15820.1|1437616_1438654_+	twitching motility protein PilT	NA	NA	NA	NA	NA
AUJ15821.1|1438767_1439898_+	type IV pili twitching motility protein PilT	NA	NA	NA	NA	NA
AUJ18159.1|1440187_1440844_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15822.1|1441946_1442519_-	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
AUJ15823.1|1442515_1442950_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15824.1|1443795_1444362_+	DUF179 domain-containing protein	NA	NA	NA	NA	NA
AUJ15825.1|1444354_1444822_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
AUJ15826.1|1444835_1445783_+	aspartate carbamoyltransferase	NA	NA	NA	NA	NA
AUJ15827.1|1446219_1446654_+	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AUJ18160.1|1446836_1447406_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15828.1|1447703_1448585_-	phenazine biosynthesis protein PhzF family	NA	NA	NA	NA	NA
AUJ15829.1|1449677_1452287_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
AUJ15830.1|1452270_1452729_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15831.1|1452725_1454081_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15832.1|1454061_1455468_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
AUJ15833.1|1455514_1455688_+	AsmA family protein	NA	NA	NA	NA	NA
AUJ18161.1|1455823_1456606_+	dienelactone hydrolase	NA	NA	NA	NA	NA
AUJ15834.1|1456700_1457669_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.5e-99
AUJ15835.1|1457923_1458922_-	octaprenyl-diphosphate synthase	NA	NA	NA	NA	NA
AUJ15836.1|1459197_1459731_+	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	60.9	1.9e-32
AUJ15837.1|1460013_1461498_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.5	5.0e-14
AUJ18162.1|1465010_1465688_+	HAD family hydrolase	NA	NA	NA	NA	NA
AUJ15838.1|1465923_1466130_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15839.1|1466224_1466449_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15840.1|1466448_1468521_-	carbon starvation protein A	NA	NA	NA	NA	NA
AUJ18163.1|1468804_1469611_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15841.1|1469781_1470069_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15842.1|1470472_1473289_+	type IV secretion protein Rhs	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.6	4.7e-53
AUJ15843.1|1473288_1474185_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15844.1|1474181_1474646_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15845.1|1474666_1475149_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ18164.1|1475298_1475778_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15846.1|1475864_1477601_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15847.1|1478071_1478266_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15848.1|1478381_1479758_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
AUJ15849.1|1480408_1481005_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15850.1|1481430_1482807_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.0e-77
>prophage 12
CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	1490433	1527217	4703977	transposase,tRNA	Shigella_phage(42.86%)	30	NA	NA
AUJ18167.1|1490433_1491288_+|transposase	transposase	transposase	U5P429	Shigella_phage	57.7	4.8e-86
AUJ18168.1|1491419_1492541_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
AUJ15854.1|1492555_1493383_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUJ15855.1|1493366_1494650_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AUJ15856.1|1494676_1495192_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ18169.1|1495202_1497215_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.5	1.3e-09
AUJ18170.1|1497270_1497453_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15857.1|1497427_1499431_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
AUJ15858.1|1499449_1499779_-	anti-anti-sigma factor	NA	NA	NA	NA	NA
AUJ15859.1|1500268_1503733_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
AUJ15860.1|1503846_1504038_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15861.1|1504126_1504669_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUJ18171.1|1505093_1506002_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
AUJ15862.1|1507532_1508345_-	peptidase C1	NA	NA	NA	NA	NA
AUJ15863.1|1509290_1509902_+	N-acetyltransferase	NA	NA	NA	NA	NA
AUJ15864.1|1510020_1510905_+	nitrilase	NA	NA	NA	NA	NA
AUJ15865.1|1510926_1512018_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15866.1|1512086_1513490_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
AUJ15867.1|1513503_1514010_+	Fur family transcriptional regulator	NA	NA	NA	NA	NA
AUJ15868.1|1514412_1514871_+	cupin	NA	NA	NA	NA	NA
AUJ15869.1|1515648_1515852_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15870.1|1516015_1516288_+|transposase	transposase	transposase	U5P4I9	Shigella_phage	58.8	1.2e-19
AUJ15871.1|1516305_1517160_+|transposase	transposase	transposase	U5P429	Shigella_phage	56.9	9.1e-85
AUJ18172.1|1517268_1518285_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
AUJ15872.1|1518570_1519947_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	53.7	8.9e-74
AUJ18173.1|1519974_1520865_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15873.1|1521551_1522148_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ18174.1|1524687_1524960_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15874.1|1525631_1526162_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15875.1|1526158_1527217_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	8.9e-74
>prophage 13
CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	1569881	1633554	4703977	transposase,tRNA,protease	Ralstonia_phage(30.0%)	52	NA	NA
AUJ15905.1|1569881_1570850_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
AUJ15906.1|1571173_1571467_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ18178.1|1571545_1571959_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ18179.1|1572650_1573559_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AUJ15907.1|1573687_1573921_-	DUF378 domain-containing protein	NA	NA	NA	NA	NA
AUJ15908.1|1574394_1574688_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15909.1|1575580_1576030_-	tetrameric acyl-CoA thioesterase	NA	NA	NA	NA	NA
AUJ15910.1|1576295_1577153_-	co-chaperone YbbN	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.0e-11
AUJ15911.1|1577357_1577969_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15912.1|1578067_1580710_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	40.0	4.7e-172
AUJ15913.1|1581223_1581859_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15914.1|1581881_1582910_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
AUJ15915.1|1582906_1583806_+	nicotinic acid mononucleotide adenylyltransferase	NA	NA	NA	NA	NA
AUJ15916.1|1583862_1584279_+	ribosome silencing factor RsfS	NA	NA	NA	NA	NA
AUJ15917.1|1584290_1585406_+	molecular chaperone DnaJ	NA	NA	NA	NA	NA
AUJ15918.1|1585731_1585941_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15919.1|1586495_1586966_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
AUJ15920.1|1587403_1588078_-	energy transducer TonB	NA	NA	NA	NA	NA
AUJ15921.1|1588388_1591499_-	Oar protein	NA	NA	NA	NA	NA
AUJ15922.1|1591965_1592700_-	SIMPL domain-containing protein	NA	NA	NA	NA	NA
AUJ15923.1|1592838_1593411_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AUJ15924.1|1593410_1594910_+	ribonuclease E/G	NA	NA	NA	NA	NA
AUJ15925.1|1595050_1598971_+	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
AUJ18180.1|1598976_1599729_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15926.1|1599827_1601273_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AUJ15927.1|1601529_1602111_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ15928.1|1602256_1603624_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
AUJ18181.1|1603698_1604103_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ18182.1|1604229_1604616_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15929.1|1604685_1605783_-|protease	protease	protease	NA	NA	NA	NA
AUJ15930.1|1606511_1606988_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ15931.1|1607099_1607975_-	(2E,6E)-farnesyl diphosphate synthase	NA	NA	NA	NA	NA
AUJ15932.1|1607976_1608237_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
AUJ15933.1|1608268_1609573_-|tRNA	tRNA(Ile)-lysidine synthase	tRNA	NA	NA	NA	NA
AUJ15934.1|1609606_1611313_-	alkaline phosphatase	NA	NA	NA	NA	NA
AUJ15935.1|1611455_1612796_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
AUJ18183.1|1612967_1613642_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUJ15936.1|1613888_1614380_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AUJ15937.1|1614587_1615337_-	hypothetical protein	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
AUJ18184.1|1615446_1616019_-	glycoside hydrolase	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.4e-19
AUJ15938.1|1616093_1616573_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AUJ15939.1|1616801_1618046_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ15940.1|1618053_1619304_+	amino acid dehydrogenase	NA	NA	NA	NA	NA
AUJ15941.1|1619300_1620671_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.8	2.4e-34
AUJ15942.1|1621057_1621327_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ15943.1|1622183_1622525_+	cysteine methyltransferase	NA	NA	NA	NA	NA
AUJ15944.1|1622565_1623264_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AUJ15945.1|1623514_1624483_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
AUJ15946.1|1625066_1626092_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.9e-49
AUJ15947.1|1628487_1630503_-	peptidase M13	NA	NA	NA	NA	NA
AUJ15948.1|1631172_1632189_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	9.6e-49
AUJ15949.1|1632585_1633554_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
>prophage 14
CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	1698483	1757220	4703977	tRNA,transposase,integrase	Tetraselmis_virus(12.5%)	50	1696874:1696890	1771657:1771673
1696874:1696890	attL	TGGCCGAAGGCCGCGCC	NA	NA	NA	NA
AUJ16004.1|1698483_1699410_+|tRNA	tRNA pseudouridine(55) synthase	tRNA	NA	NA	NA	NA
AUJ16005.1|1699566_1699827_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
AUJ16006.1|1699993_1702108_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
AUJ16007.1|1702481_1703522_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ16008.1|1703585_1704461_-	nicotinate-nucleotide diphosphorylase (carboxylating)	NA	NA	NA	NA	NA
AUJ16009.1|1704457_1704727_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ16010.1|1704785_1705289_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	38.7	3.6e-17
AUJ16011.1|1705285_1706431_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AUJ16012.1|1706572_1707151_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	39.6	8.4e-34
AUJ16013.1|1707272_1707593_+	monothiol glutaredoxin, Grx4 family	NA	NA	NA	NA	NA
AUJ16014.1|1707589_1708333_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
AUJ16015.1|1708329_1708929_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ16016.1|1709698_1712893_+	Oar protein	NA	NA	NA	NA	NA
AUJ16017.1|1712999_1714385_+	LOG family protein	NA	NA	NA	NA	NA
AUJ16018.1|1714554_1715070_+	pre-pilin like leader sequence	NA	A0A1W6JT76	Pseudomonas_phage	42.5	1.1e-05
AUJ16019.1|1715066_1715543_+	type IV pilus modification protein PilV	NA	NA	NA	NA	NA
AUJ16020.1|1715539_1716706_+	pilus assembly protein PilW	NA	NA	NA	NA	NA
AUJ16021.1|1716709_1717219_+	pilus assembly protein	NA	NA	NA	NA	NA
AUJ18190.1|1717175_1721177_+	pilus assembly protein	NA	NA	NA	NA	NA
AUJ16022.1|1721189_1721639_+	pilus assembly protein PilE	NA	NA	NA	NA	NA
AUJ16023.1|1721815_1722358_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
AUJ16024.1|1722496_1724518_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AUJ16025.1|1725732_1726002_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ18191.1|1726312_1726747_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ16026.1|1727170_1728265_-	acyltransferase	NA	NA	NA	NA	NA
AUJ16027.1|1728692_1730360_-	urocanate hydratase	NA	NA	NA	NA	NA
AUJ16028.1|1730376_1731234_-	N-formylglutamate deformylase	NA	NA	NA	NA	NA
AUJ16029.1|1731418_1732960_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	42.8	2.7e-79
AUJ16030.1|1732973_1734179_-	imidazolonepropionase	NA	NA	NA	NA	NA
AUJ16031.1|1734254_1735610_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
AUJ16032.1|1735964_1736669_+	histidine utilization repressor	NA	NA	NA	NA	NA
AUJ16033.1|1736825_1737830_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ16034.1|1738402_1738966_-	poly(hydroxyalcanoate) granule associated protein	NA	NA	NA	NA	NA
AUJ16035.1|1739127_1739403_-	polyhydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
AUJ18192.1|1739643_1740453_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ16036.1|1740394_1741051_-	sulfoxide reductase heme-binding subunit YedZ	NA	NA	NA	NA	NA
AUJ16037.1|1741352_1742321_-	mononuclear molybdenum enzyme YedY	NA	NA	NA	NA	NA
AUJ16038.1|1742495_1743581_+	phosphoserine transaminase	NA	M1Q1P2	Streptococcus_phage	43.6	1.7e-75
AUJ16039.1|1743663_1744872_+	chorismate mutase	NA	NA	NA	NA	NA
AUJ16040.1|1744993_1746307_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AUJ16041.1|1746670_1747147_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ16042.1|1747335_1747605_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ16043.1|1747457_1748444_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.6e-43
AUJ18193.1|1748863_1749331_-	energy transducer TonB	NA	NA	NA	NA	NA
AUJ16044.1|1749761_1750730_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
AUJ16045.1|1750851_1751619_-	energy transducer TonB	NA	NA	NA	NA	NA
AUJ16046.1|1751625_1753017_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	49.6	1.0e-93
AUJ16047.1|1753477_1754062_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AUJ16048.1|1754161_1755178_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ18194.1|1755801_1757220_+|integrase	integrase	integrase	NA	NA	NA	NA
1771657:1771673	attR	TGGCCGAAGGCCGCGCC	NA	NA	NA	NA
>prophage 15
CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	1839094	1848982	4703977	tRNA	Escherichia_phage(28.57%)	9	NA	NA
AUJ18208.1|1839094_1840771_+	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.3	2.1e-37
AUJ16110.1|1840859_1841501_+	LexA repressor 2	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
AUJ16111.1|1841673_1842708_+	DNA recombination/repair protein RecA	NA	A0A0S2MVG1	Bacillus_phage	61.0	1.6e-112
AUJ18209.1|1843009_1843498_+	recombination regulator RecX	NA	NA	NA	NA	NA
AUJ16112.1|1843599_1846248_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.8	2.4e-83
AUJ16113.1|1846387_1846600_+	carbon storage regulator	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
AUJ16114.1|1847073_1847310_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ16115.1|1848321_1848576_+	hypothetical protein	NA	A0A0N7C1X7	Escherichia_phage	59.6	4.5e-08
AUJ16116.1|1848490_1848982_+	lysozyme	NA	D5LH07	Escherichia_phage	67.7	4.6e-57
>prophage 16
CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	1974583	2059357	4703977	tRNA,transposase	uncultured_Caudovirales_phage(39.13%)	54	NA	NA
AUJ16218.1|1974583_1976101_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.5	8.6e-86
AUJ16219.1|1976242_1977379_+	two-component system response regulator	NA	NA	NA	NA	NA
AUJ16220.1|1977380_1977719_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ16221.1|1977743_1979921_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	33.1	1.3e-47
AUJ16222.1|1979932_1980802_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUJ16223.1|1980978_1982661_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.2	2.1e-32
AUJ16224.1|1983310_1986079_-	aconitate hydratase	NA	NA	NA	NA	NA
AUJ16225.1|1986226_1986475_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
AUJ16226.1|1986471_1986882_+	VapC toxin family PIN domain ribonuclease	NA	NA	NA	NA	NA
AUJ16227.1|1986947_1989539_+	aconitate hydratase B	NA	NA	NA	NA	NA
AUJ16228.1|1989892_1990708_+	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
AUJ16229.1|1991363_1993550_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	NA	NA	NA	NA
AUJ16230.1|1993715_1994792_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
AUJ16231.1|1994788_1995385_-	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
AUJ16232.1|1995381_1996248_-	chemotaxis protein CheR	NA	NA	NA	NA	NA
AUJ16233.1|1996493_1998884_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	58.3	3.9e-08
AUJ16234.1|1998962_1999346_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ16235.1|1999661_2000144_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
AUJ16236.1|2000279_2001077_-	pilus assembly protein PilZ	NA	NA	NA	NA	NA
AUJ16237.1|2002118_2004380_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.5	1.3e-10
AUJ16238.1|2004791_2007053_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.7	2.5e-12
AUJ18220.1|2007644_2009609_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	47.4	1.5e-10
AUJ16239.1|2010164_2011223_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.2e-75
AUJ16240.1|2014223_2016467_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.8	3.4e-14
AUJ16241.1|2016725_2018102_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
AUJ16242.1|2018383_2020597_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.2	1.9e-09
AUJ16243.1|2020794_2023164_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.7	2.7e-09
AUJ16244.1|2023177_2023939_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ18221.1|2024254_2026984_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	45.6	2.8e-10
AUJ16245.1|2029447_2031709_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.4	2.8e-08
AUJ16246.1|2032607_2034617_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
AUJ16247.1|2034650_2035016_-	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.7e-14
AUJ16248.1|2035012_2035321_-	anti-anti-sigma factor	NA	NA	NA	NA	NA
AUJ16249.1|2035421_2036444_-	chemotaxis protein	NA	NA	NA	NA	NA
AUJ16250.1|2036440_2037223_-	chromosome partitioning protein ParA	NA	Q8JL10	Natrialba_phage	35.7	1.7e-13
AUJ16251.1|2037224_2038199_-	flagellar motor protein MotD	NA	NA	NA	NA	NA
AUJ16252.1|2038205_2038946_-	flagellar motor protein	NA	NA	NA	NA	NA
AUJ16253.1|2039034_2039388_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ16254.1|2041674_2042382_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	51.2	1.4e-51
AUJ16255.1|2042384_2043329_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ16256.1|2043898_2046118_-	TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	28.6	3.7e-05
AUJ16257.1|2046372_2046825_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ18222.1|2047716_2050758_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUJ16258.1|2051436_2052405_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
AUJ16259.1|2052403_2052841_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ16260.1|2052888_2053323_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ16261.1|2054717_2055041_+	hypothetical protein	NA	Q6H9S4	Enterobacteria_phage	57.9	2.0e-24
AUJ16262.1|2055037_2055940_+|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	67.7	1.6e-103
AUJ16263.1|2056035_2056437_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ16264.1|2056433_2056943_+	hypothetical protein	NA	A4PE24	Ralstonia_virus	36.0	1.3e-09
AUJ18223.1|2056923_2057265_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ16265.1|2057278_2057875_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ16266.1|2057772_2057982_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ16267.1|2057980_2059357_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
>prophage 17
CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	2139430	2201871	4703977	tRNA,transposase,protease	Ralstonia_phage(25.0%)	47	NA	NA
AUJ16333.1|2139430_2140567_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AUJ16334.1|2140563_2141022_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AUJ16335.1|2141272_2141593_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.3e-12
AUJ16336.1|2141735_2144018_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.6	5.1e-175
AUJ18228.1|2144225_2144444_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AUJ18229.1|2144524_2145277_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AUJ16337.1|2145410_2146040_-	cinnamoyl-CoA reductase	NA	NA	NA	NA	NA
AUJ16338.1|2146715_2147837_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AUJ16339.1|2147894_2148863_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	2.0e-64
AUJ16340.1|2149146_2151504_+	cell division protein FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
AUJ16341.1|2151666_2153595_+	transglutaminase	NA	NA	NA	NA	NA
AUJ18230.1|2153701_2154331_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AUJ16342.1|2154443_2158610_-	type III effector	NA	NA	NA	NA	NA
AUJ18231.1|2158846_2160223_+	recombination factor protein RarA	NA	G3MBE0	Bacillus_virus	38.3	4.0e-74
AUJ16343.1|2160254_2160581_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ16344.1|2160577_2160985_-	fluoride ion transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	7.5e-21
AUJ16345.1|2161016_2161367_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ16346.1|2161363_2162695_-	voltage-gated chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.2	4.3e-41
AUJ16347.1|2163015_2164221_-	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
AUJ16348.1|2164385_2166758_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUJ16349.1|2166782_2167415_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ16350.1|2167633_2168059_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
AUJ16351.1|2168077_2169283_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
AUJ16352.1|2169293_2170082_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
AUJ16353.1|2170078_2170939_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ16354.1|2171009_2171648_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ16355.1|2171644_2172865_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
AUJ16356.1|2172875_2174273_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
AUJ16357.1|2174587_2175808_+	molybdopterin molybdenumtransferase MoeA	NA	NA	NA	NA	NA
AUJ16358.1|2176299_2177460_-	molybdopterin biosynthesis protein MoeB	NA	NA	NA	NA	NA
AUJ16359.1|2178308_2179325_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.3	3.3e-49
AUJ16360.1|2180407_2181376_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	2.8e-98
AUJ16361.1|2181524_2181914_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ16362.1|2181852_2182230_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ16363.1|2182435_2183689_+	molybdopterin molybdenumtransferase MoeA	NA	NA	NA	NA	NA
AUJ16364.1|2183726_2184296_+	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
AUJ16365.1|2184279_2184642_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ18232.1|2187016_2187994_-	siroheme synthase	NA	NA	NA	NA	NA
AUJ16366.1|2189315_2189504_+	nitrate transport ATP-binding protein	NA	NA	NA	NA	NA
AUJ16367.1|2189516_2189792_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ16368.1|2190436_2190694_+	stress-induced protein	NA	NA	NA	NA	NA
AUJ16369.1|2190919_2191888_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.1e-99
AUJ16370.1|2192529_2193015_+	YciE/YciF family protein	NA	NA	NA	NA	NA
AUJ16371.1|2193121_2194042_+	peptidase	NA	NA	NA	NA	NA
AUJ16372.1|2195231_2197043_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AUJ16373.1|2197793_2200892_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ16374.1|2200902_2201871_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	5.6e-99
>prophage 18
CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	2315392	2374254	4703977	transposase	Leptospira_phage(25.0%)	40	NA	NA
AUJ16400.1|2315392_2315887_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	39.7	3.1e-29
AUJ16401.1|2317865_2320991_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
AUJ16402.1|2321042_2322155_-	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUJ16403.1|2322278_2322857_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ16404.1|2324034_2324592_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ16405.1|2325411_2327499_+	type III effector	NA	NA	NA	NA	NA
AUJ16406.1|2329436_2332526_+	histidine kinase	NA	NA	NA	NA	NA
AUJ16407.1|2332911_2333697_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	47.6	2.8e-48
AUJ16408.1|2334503_2334809_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ16409.1|2334810_2335518_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUJ16410.1|2335514_2336507_+	cytochrome-c peroxidase	NA	NA	NA	NA	NA
AUJ16411.1|2336503_2338963_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AUJ16412.1|2339076_2340057_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ16413.1|2340065_2341094_+	type VI secretion system protein ImpA	NA	NA	NA	NA	NA
AUJ16414.1|2341266_2341593_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ16415.1|2341589_2344493_-	serine/threonine protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	25.0	1.9e-09
AUJ16416.1|2344489_2345212_-	phosphoprotein phosphatase	NA	NA	NA	NA	NA
AUJ16417.1|2345208_2345856_-	type VI secretion-associated protein	NA	NA	NA	NA	NA
AUJ16418.1|2345852_2349311_-	type VI secretion protein	NA	NA	NA	NA	NA
AUJ16419.1|2349314_2350631_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ16420.1|2350632_2351970_-	type VI secretion system-associated protein	NA	NA	NA	NA	NA
AUJ16421.1|2351966_2353355_-	peptide-binding protein	NA	NA	NA	NA	NA
AUJ16422.1|2353351_2353891_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ16423.1|2353899_2355837_-	type IV secretion protein Rhs	NA	A0A077K8Q4	Ralstonia_phage	28.6	7.7e-39
AUJ16424.1|2356100_2356562_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ16425.1|2356664_2356868_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ16426.1|2357912_2359289_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	4.6e-78
AUJ16427.1|2359451_2360420_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
AUJ16428.1|2360514_2360865_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ16429.1|2360861_2363633_-	ClpV1 family T6SS ATPase	NA	H6X3M6	Enterobacteria_phage	29.3	1.2e-77
AUJ16430.1|2363665_2364676_-	type VI secretion protein	NA	NA	NA	NA	NA
AUJ16431.1|2364639_2366517_-	type VI secretion system protein ImpG	NA	NA	NA	NA	NA
AUJ16432.1|2366520_2367024_-	type VI secretion system lysozyme	NA	NA	NA	NA	NA
AUJ16433.1|2367011_2367845_-	ImpE protein	NA	NA	NA	NA	NA
AUJ16434.1|2367880_2368384_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ16435.1|2368483_2369998_-	EvpB family type VI secretion protein	NA	NA	NA	NA	NA
AUJ18234.1|2369990_2370497_-	type VI secretion system-associated protein	NA	NA	NA	NA	NA
AUJ16436.1|2371163_2371640_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ18235.1|2373000_2373204_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ16437.1|2373240_2374254_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.0	6.6e-42
>prophage 19
CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	2624817	2707972	4703977	tRNA,transposase	Ralstonia_phage(18.18%)	46	NA	NA
AUJ18258.1|2624817_2626272_+|tRNA	tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase	tRNA	NA	NA	NA	NA
AUJ16626.1|2626695_2627682_+	PhoH family protein	NA	A0A1B2ICF6	Erwinia_phage	47.7	4.8e-45
AUJ16627.1|2628112_2628757_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ16628.1|2628811_2629297_+	endoribonuclease YbeY	NA	NA	NA	NA	NA
AUJ16629.1|2629296_2629815_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ16630.1|2629909_2630788_+	magnesium/cobalt efflux protein	NA	NA	NA	NA	NA
AUJ18259.1|2630802_2632065_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ16631.1|2632080_2633082_+	magnesium transporter CorA	NA	NA	NA	NA	NA
AUJ18260.1|2633233_2634598_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUJ16632.1|2635072_2635921_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AUJ16633.1|2635917_2636829_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AUJ16634.1|2636957_2638091_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	7.4e-26
AUJ16635.1|2638236_2639748_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ16636.1|2639734_2641321_-	MFS transporter	NA	NA	NA	NA	NA
AUJ16637.1|2641317_2642520_-	multidrug ABC transporter permease	NA	NA	NA	NA	NA
AUJ16638.1|2643368_2644337_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	3.6e-98
AUJ16639.1|2646956_2648342_-	glutamine synthetase	NA	NA	NA	NA	NA
AUJ18261.1|2648988_2650368_+	glutamine synthetase	NA	NA	NA	NA	NA
AUJ16640.1|2650367_2651684_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AUJ16641.1|2651820_2653065_+	diguanylate cyclase response regulator	NA	A0A127AWB9	Bacillus_phage	36.4	1.9e-19
AUJ16642.1|2653370_2654651_-	MFS transporter	NA	NA	NA	NA	NA
AUJ16643.1|2654952_2655261_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ16644.1|2655220_2657569_-	CbbBc protein	NA	NA	NA	NA	NA
AUJ16645.1|2657565_2658411_-	sulfurtransferase FdhD	NA	NA	NA	NA	NA
AUJ16646.1|2658417_2660097_-	MFS transporter	NA	NA	NA	NA	NA
AUJ16647.1|2660625_2661978_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AUJ16648.1|2662038_2665170_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ16649.1|2665334_2666189_+	plasmid replication/partition related protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	38.7	3.2e-13
AUJ16650.1|2666359_2667664_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ16651.1|2672991_2673960_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
AUJ16652.1|2674446_2679456_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
AUJ16653.1|2679733_2680393_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ16654.1|2680407_2681715_+	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUJ16655.1|2681727_2684898_+	multidrug efflux RND transporter permease	NA	NA	NA	NA	NA
AUJ16656.1|2687589_2688585_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUJ16657.1|2688745_2691262_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	6.3e-09
AUJ16658.1|2691258_2692215_+	1-phosphofructokinase	NA	NA	NA	NA	NA
AUJ16659.1|2692373_2694116_+	PTS fructose transporter subunit EIIBC	NA	NA	NA	NA	NA
AUJ18262.1|2694433_2695570_+	carbohydrate porin	NA	NA	NA	NA	NA
AUJ16660.1|2695964_2698727_+	type IV secretion protein Rhs	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.4	3.6e-42
AUJ16661.1|2698997_2699723_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ16662.1|2700201_2701218_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
AUJ16663.1|2703793_2704537_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ18263.1|2705153_2706530_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
AUJ16664.1|2706869_2707133_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ16665.1|2706985_2707972_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-43
>prophage 20
CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	2901970	2946901	4703977	transposase	Ralstonia_phage(13.33%)	36	NA	NA
AUJ16805.1|2901970_2902939_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
AUJ16806.1|2904330_2905347_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
AUJ16807.1|2905519_2906422_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ16808.1|2906619_2907987_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	47.9	1.6e-112
AUJ16809.1|2908238_2908751_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ16810.1|2908680_2908920_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ16811.1|2909262_2910762_+	transcriptional regulator	NA	NA	NA	NA	NA
AUJ16812.1|2910758_2911691_+	N-acetyltransferase	NA	NA	NA	NA	NA
AUJ16813.1|2911871_2914700_+	2-oxoglutarate dehydrogenase subunit E1	NA	NA	NA	NA	NA
AUJ16814.1|2914742_2915945_+	dihydrolipoamide succinyltransferase	NA	NA	NA	NA	NA
AUJ16815.1|2916186_2917623_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.8	3.7e-38
AUJ16816.1|2917821_2918415_+	Rossman fold protein, TIGR00730 family	NA	A0A2I2L3F0	Orpheovirus	27.5	2.1e-11
AUJ18285.1|2918679_2919273_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	8.1e-16
AUJ16817.1|2919269_2921039_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.5	5.2e-58
AUJ16818.1|2921281_2922136_+	RND transporter	NA	NA	NA	NA	NA
AUJ16819.1|2922132_2923536_+	multidrug transporter	NA	NA	NA	NA	NA
AUJ18286.1|2923887_2924082_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ16820.1|2924361_2925483_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
AUJ16821.1|2925479_2926397_-	pyridoxal kinase	NA	NA	NA	NA	NA
AUJ16822.1|2926924_2928055_-	molecular chaperone DnaJ	NA	Q8QNB4	Ectocarpus_siliculosus_virus	30.0	1.4e-24
AUJ16823.1|2928214_2930140_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.6	2.2e-147
AUJ16824.1|2930281_2930800_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AUJ16825.1|2930900_2931953_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
AUJ16826.1|2932069_2933734_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AUJ16827.1|2934176_2934602_-	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
AUJ16828.1|2934691_2935087_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ16829.1|2935433_2935709_-	RnfH family protein	NA	NA	NA	NA	NA
AUJ16830.1|2935722_2936154_-	ubiquinone-binding protein	NA	NA	NA	NA	NA
AUJ16831.1|2936214_2936718_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	41.9	5.8e-23
AUJ16832.1|2936882_2939330_-	serine peptidase	NA	A0A218KC60	Bacillus_phage	26.7	2.6e-15
AUJ16833.1|2940451_2940832_-	hypothetical protein	NA	Q6H9S4	Enterobacteria_phage	56.2	2.3e-19
AUJ16834.1|2941079_2942048_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
AUJ16835.1|2942269_2943646_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.3	7.3e-60
AUJ18287.1|2944414_2945107_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ16836.1|2945798_2946062_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ16837.1|2945914_2946901_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-43
>prophage 21
CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	2956429	3018480	4703977	transposase,tRNA,protease	Acidithiobacillus_phage(17.65%)	48	NA	NA
AUJ16844.1|2956429_2957806_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
AUJ16845.1|2957856_2958900_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.1	1.5e-76
AUJ16846.1|2958948_2959212_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ16847.1|2959064_2960051_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-43
AUJ16848.1|2961430_2961655_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ18290.1|2961688_2962804_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AUJ16849.1|2963400_2964375_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.0	2.6e-19
AUJ16850.1|2966237_2966963_-	OmpA family lipoprotein	NA	G3M9Z0	Bacillus_virus	33.9	1.8e-09
AUJ18291.1|2966972_2967152_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ16851.1|2967747_2968224_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ16852.1|2968231_2969686_-	deoxyribodipyrimidine photolyase	NA	A0A1V0S949	Catovirus	31.5	4.4e-47
AUJ16853.1|2969752_2971183_-	replicative DNA helicase	NA	O80281	Escherichia_phage	53.6	3.8e-120
AUJ16854.1|2971404_2971959_-	NADPH-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	34.1	1.2e-18
AUJ16855.1|2972175_2974116_-	asparagine synthetase B	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.8	2.6e-26
AUJ18292.1|2974291_2974921_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUJ16856.1|2978996_2979788_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ16857.1|2979933_2980149_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ16858.1|2980148_2980916_+	DNAase	NA	NA	NA	NA	NA
AUJ16859.1|2980977_2981808_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
AUJ16860.1|2981880_2982309_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ16861.1|2982440_2982920_+	peptidoglycan-associated outer membrane lipoprotein precursor	NA	NA	NA	NA	NA
AUJ16862.1|2983170_2983386_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
AUJ16863.1|2983352_2983586_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ16864.1|2983613_2984099_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ18293.1|2984300_2984783_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	58.6	4.1e-42
AUJ16865.1|2986717_2988949_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	59.7	1.5e-09
AUJ16866.1|2989092_2990469_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	4.6e-78
AUJ16867.1|2991587_2992556_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	5.6e-99
AUJ16868.1|2992877_2993951_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ16869.1|2994123_2995092_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
AUJ16870.1|2996182_2996818_-	glutathione S-transferase	NA	NA	NA	NA	NA
AUJ16871.1|2996953_2998471_-	fumarate hydratase	NA	NA	NA	NA	NA
AUJ16872.1|2998510_2998771_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ16873.1|2998805_3000686_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	38.9	5.2e-24
AUJ16874.1|3000874_3001654_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AUJ16875.1|3001735_3002221_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	36.2	2.8e-14
AUJ18294.1|3004678_3004918_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ16876.1|3005167_3005881_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ18295.1|3007412_3007901_+	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
AUJ18296.1|3008062_3008641_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ16877.1|3008732_3009233_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ16878.1|3009299_3010145_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ16879.1|3010195_3010474_-	N-acetyltransferase	NA	NA	NA	NA	NA
AUJ16880.1|3010693_3010882_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ16881.1|3011295_3011904_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AUJ16882.1|3013100_3014918_+	peptidase M14	NA	NA	NA	NA	NA
AUJ16883.1|3014989_3017236_+	glycosyl hydrolase	NA	NA	NA	NA	NA
AUJ16884.1|3018003_3018480_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 22
CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	3177879	3264875	4703977	transposase,protease	Hokovirus(26.67%)	53	NA	NA
AUJ17006.1|3177879_3179256_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.3e-61
AUJ18311.1|3180170_3180500_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17007.1|3180690_3182622_-	alpha-L-fucosidase	NA	NA	NA	NA	NA
AUJ17008.1|3183067_3183922_+|transposase	transposase	transposase	U5P429	Shigella_phage	57.7	2.8e-86
AUJ18312.1|3183957_3187497_-	histidine kinase	NA	A0A1V0SGX0	Hokovirus	33.3	2.6e-45
AUJ17009.1|3187999_3191566_-	histidine kinase	NA	A0A1V0SGX0	Hokovirus	33.3	7.7e-45
AUJ17010.1|3191631_3195195_-	histidine kinase	NA	A0A1V0SGX0	Hokovirus	30.7	8.3e-39
AUJ17011.1|3195488_3199064_-	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	32.2	4.6e-37
AUJ17012.1|3199160_3199823_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
AUJ17013.1|3199819_3200383_+	cytochrome b	NA	NA	NA	NA	NA
AUJ17014.1|3200392_3200962_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
AUJ18313.1|3201279_3201669_+	cold-shock protein	NA	NA	NA	NA	NA
AUJ17015.1|3201754_3201988_-	thioredoxin family protein	NA	NA	NA	NA	NA
AUJ17016.1|3202075_3203458_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AUJ17017.1|3205225_3206443_-	O-succinylhomoserine (thiol)-lyase	NA	NA	NA	NA	NA
AUJ18314.1|3206439_3207471_-	homoserine acetyltransferase	NA	NA	NA	NA	NA
AUJ17018.1|3207789_3208689_+	peptidase	NA	S5M424	Bacillus_phage	30.6	3.0e-06
AUJ17019.1|3208821_3210426_+	peptide chain release factor 3	NA	NA	NA	NA	NA
AUJ17020.1|3210501_3211146_+	hemolysin III	NA	NA	NA	NA	NA
AUJ17021.1|3213066_3214443_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	7.1e-63
AUJ17022.1|3216074_3216503_-	histidine kinase	NA	NA	NA	NA	NA
AUJ18315.1|3216462_3217503_-	glycosyl transferase family 2	NA	F1C5B0	Cronobacter_phage	42.6	1.3e-72
AUJ17023.1|3217511_3218249_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AUJ17024.1|3218323_3219214_+	heat-shock protein Hsp33	NA	NA	NA	NA	NA
AUJ17025.1|3219334_3220204_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17026.1|3220599_3223509_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.4	6.6e-26
AUJ17027.1|3223617_3224226_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ17028.1|3224428_3225286_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUJ17029.1|3225282_3227757_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AUJ18316.1|3228151_3228505_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17030.1|3230484_3231864_+	serine hydrolase	NA	NA	NA	NA	NA
AUJ17031.1|3232550_3232994_-	histidine biosynthesis protein HisIE	NA	NA	NA	NA	NA
AUJ17032.1|3233411_3233627_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17033.1|3234009_3234405_-	glycine cleavage system protein H	NA	NA	NA	NA	NA
AUJ17034.1|3234541_3235651_-	glycine cleavage system protein T	NA	NA	NA	NA	NA
AUJ17035.1|3235823_3236258_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17036.1|3236261_3237227_-	hypothetical protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	33.5	1.5e-22
AUJ17037.1|3237524_3237860_-	hypothetical protein	NA	A0A218MNG8	uncultured_virus	56.4	9.2e-25
AUJ17038.1|3237856_3238876_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
AUJ17039.1|3239120_3239921_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
AUJ17040.1|3239917_3240475_-	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
AUJ17041.1|3240507_3241926_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AUJ17042.1|3241916_3242651_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AUJ17043.1|3242952_3243969_-	glucokinase	NA	NA	NA	NA	NA
AUJ17044.1|3244669_3247378_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUJ17045.1|3247586_3249272_+	alpha-L-fucosidase	NA	NA	NA	NA	NA
AUJ18317.1|3249287_3250343_+	glycosyl hydrolase	NA	A0A2P1CFB9	Microbacterium_phage	24.3	2.9e-08
AUJ17046.1|3253272_3255894_+	beta-mannosidase	NA	NA	NA	NA	NA
AUJ17047.1|3256102_3258772_+	beta-glucosidase	NA	NA	NA	NA	NA
AUJ17048.1|3258916_3261031_-	ABC transporter	NA	W8CYL7	Bacillus_phage	26.5	1.4e-33
AUJ17049.1|3261034_3261481_-|protease	protease	protease	NA	NA	NA	NA
AUJ17050.1|3262393_3262657_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ17051.1|3263498_3264875_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
>prophage 23
CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	3409688	3521436	4703977	transposase,tRNA	Acidithiobacillus_phage(20.0%)	82	NA	NA
AUJ17148.1|3409688_3410675_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.0	1.7e-42
AUJ17149.1|3410527_3410791_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ17150.1|3410759_3411212_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17151.1|3411102_3412014_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17152.1|3412138_3414724_-	ATP-dependent chaperone ClpB	NA	A0A1C3S747	Escherichia_phage	35.4	3.8e-126
AUJ17153.1|3415169_3415475_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17154.1|3415855_3418471_+	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.5	2.8e-28
AUJ17155.1|3418771_3419386_+	calcium-binding protein	NA	NA	NA	NA	NA
AUJ17156.1|3419819_3422066_+	catalase-peroxidase	NA	NA	NA	NA	NA
AUJ18327.1|3422189_3422597_-	RNA-binding protein	NA	NA	NA	NA	NA
AUJ17157.1|3422937_3424428_+	MATE family efflux transporter	NA	NA	NA	NA	NA
AUJ17158.1|3425046_3425454_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AUJ17159.1|3425598_3426357_-|tRNA	tRNA (guanine(37)-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
AUJ17160.1|3426421_3426934_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AUJ18328.1|3426977_3427235_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AUJ17161.1|3427344_3428142_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17162.1|3429381_3430617_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17163.1|3430765_3432142_-	signal recognition particle protein	NA	NA	NA	NA	NA
AUJ17164.1|3432526_3433318_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17165.1|3433604_3434654_-	galactose mutarotase	NA	NA	NA	NA	NA
AUJ18329.1|3434893_3436477_+	alpha-N-arabinofuranosidase	NA	NA	NA	NA	NA
AUJ17166.1|3436664_3437141_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ17167.1|3437106_3437463_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ17168.1|3438557_3440519_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
AUJ17169.1|3440502_3441390_-	histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	33.0	9.3e-24
AUJ17170.1|3441386_3442397_-	ATP-binding protein	NA	NA	NA	NA	NA
AUJ17171.1|3442387_3442783_-	anti-sigma regulatory factor	NA	NA	NA	NA	NA
AUJ17172.1|3442779_3443142_-	anti-anti-sigma factor	NA	NA	NA	NA	NA
AUJ18330.1|3443143_3443986_-	polyvinylalcohol dehydrogenase	NA	NA	NA	NA	NA
AUJ17173.1|3444660_3446985_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17174.1|3447009_3448980_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	21.2	3.5e-15
AUJ17175.1|3449091_3450522_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUJ18331.1|3451282_3452074_+	transcriptional regulator	NA	NA	NA	NA	NA
AUJ17176.1|3452291_3452573_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17177.1|3453380_3454775_-	DNA repair protein RadA	NA	NA	NA	NA	NA
AUJ17178.1|3455082_3456069_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.9	3.4e-43
AUJ17179.1|3455921_3456191_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ17180.1|3456362_3457739_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
AUJ17181.1|3457854_3459072_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17182.1|3459960_3460170_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17183.1|3460579_3461956_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
AUJ17184.1|3464524_3465493_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
AUJ17185.1|3466169_3466565_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17186.1|3466727_3468104_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.7e-62
AUJ17187.1|3468124_3468514_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17188.1|3468515_3473255_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	43.3	1.8e-20
AUJ17189.1|3473398_3475018_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17190.1|3475041_3477288_-	type IV secretion protein Rhs	NA	A0A077K8Q4	Ralstonia_phage	31.5	6.8e-55
AUJ18332.1|3477512_3479210_-	peptidase M61	NA	NA	NA	NA	NA
AUJ17191.1|3479561_3479897_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
AUJ18333.1|3479896_3480523_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
AUJ17192.1|3480525_3482526_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AUJ17193.1|3483974_3484925_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
AUJ17194.1|3484998_3485517_-	signal peptidase II	NA	NA	NA	NA	NA
AUJ17195.1|3485831_3488663_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SGW1	Hokovirus	22.2	1.4e-41
AUJ17196.1|3489884_3491489_-	lipid II flippase MurJ	NA	NA	NA	NA	NA
AUJ17197.1|3491605_3491875_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
AUJ17198.1|3491966_3493019_-	Obg family GTPase CgtA	NA	NA	NA	NA	NA
AUJ17199.1|3493254_3493515_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
AUJ17200.1|3493527_3493848_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
AUJ17201.1|3494140_3497098_+	ABC-ATPase UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	2.5e-307
AUJ17202.1|3497094_3497502_+	thioesterase	NA	NA	NA	NA	NA
AUJ17203.1|3497615_3498080_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17204.1|3498103_3498874_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AUJ17205.1|3498944_3499850_+	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
AUJ17206.1|3500077_3500581_+	pathogenicity-like protein	NA	NA	NA	NA	NA
AUJ17207.1|3500692_3501457_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AUJ18334.1|3501698_3502154_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ18335.1|3502287_3502869_-	calcium-binding protein	NA	NA	NA	NA	NA
AUJ17208.1|3503068_3503824_+	arginyltransferase	NA	NA	NA	NA	NA
AUJ17209.1|3503777_3505109_+	endonuclease	NA	NA	NA	NA	NA
AUJ17210.1|3505460_3505880_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ17211.1|3506081_3507683_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17212.1|3508129_3509206_+	DUF4432 domain-containing protein	NA	NA	NA	NA	NA
AUJ17213.1|3509302_3509776_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17214.1|3510012_3512448_+	ligand-gated channel	NA	A0A0P0I887	Acinetobacter_phage	22.6	1.0e-11
AUJ18336.1|3512980_3513520_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17215.1|3513725_3514484_+	trehalose-phosphatase	NA	NA	NA	NA	NA
AUJ17216.1|3514528_3516307_+	glucoamylase	NA	NA	NA	NA	NA
AUJ17217.1|3516303_3517671_+	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
AUJ17218.1|3518273_3520751_+	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
AUJ18337.1|3521172_3521436_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 24
CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	3553114	3576772	4703977	transposase,tRNA	Leptospira_phage(42.86%)	19	NA	NA
AUJ17236.1|3553114_3554083_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.6e-98
AUJ17237.1|3554441_3554834_-	histone-like nucleoid-structuring protein	NA	NA	NA	NA	NA
AUJ18343.1|3555169_3556024_-|transposase	transposase	transposase	U5P429	Shigella_phage	58.1	2.2e-86
AUJ17238.1|3557977_3558946_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
AUJ17239.1|3559190_3560567_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
AUJ17240.1|3560831_3561551_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.3	1.8e-41
AUJ17241.1|3561569_3562556_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	40.6	9.9e-43
AUJ17242.1|3562408_3562672_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ17243.1|3567619_3567820_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
AUJ17244.1|3568182_3568977_+	thiazole synthase	NA	NA	NA	NA	NA
AUJ17245.1|3569278_3570037_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AUJ17246.1|3570112_3571975_+	SLC13 family permease	NA	NA	NA	NA	NA
AUJ17247.1|3572032_3572374_-	ferredoxin	NA	NA	NA	NA	NA
AUJ17248.1|3572632_3572908_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17249.1|3573081_3573558_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ17250.1|3573523_3573988_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ17251.1|3574500_3575214_+	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
AUJ17252.1|3575274_3575706_+	large-conductance mechanosensitive channel	NA	NA	NA	NA	NA
AUJ17253.1|3575713_3576772_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.2e-75
>prophage 25
CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	3661520	3721649	4703977	transposase,protease	Acidithiobacillus_phage(14.29%)	51	NA	NA
AUJ17312.1|3661520_3662897_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
AUJ17313.1|3663161_3663812_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17314.1|3664184_3665474_-	citrate (Si)-synthase	NA	NA	NA	NA	NA
AUJ17315.1|3665708_3665951_-	50S ribosomal protein L31 type B	NA	NA	NA	NA	NA
AUJ17316.1|3666021_3666960_-	nucleoside hydrolase	NA	NA	NA	NA	NA
AUJ17317.1|3667092_3669246_-	DNA helicase RecG	NA	NA	NA	NA	NA
AUJ17318.1|3669266_3669647_-	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
AUJ17319.1|3669726_3671898_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis(diphosphate) 3'-diphosphatase	NA	A0A2I2L310	Orpheovirus	38.8	2.8e-13
AUJ17320.1|3672026_3672326_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AUJ17321.1|3672594_3673206_-	guanylate kinase	NA	A0A218KC48	Bacillus_phage	31.5	1.8e-10
AUJ17322.1|3673321_3674182_-	YicC family protein	NA	NA	NA	NA	NA
AUJ17323.1|3674291_3675017_+	ribonuclease PH	NA	NA	NA	NA	NA
AUJ17324.1|3675378_3676002_+	non-canonical purine NTP pyrophosphatase, RdgB/HAM1 family	NA	C6K8R3	Cassava_brown_streak_virus	34.2	2.0e-12
AUJ17325.1|3676017_3677175_+	YggW family oxidoreductase	NA	NA	NA	NA	NA
AUJ17326.1|3677341_3679762_+	thymidine phosphorylase	NA	NA	NA	NA	NA
AUJ17327.1|3679758_3680106_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
AUJ17328.1|3680304_3681630_+	Xaa-Pro dipeptidase	NA	NA	NA	NA	NA
AUJ17329.1|3682516_3683857_-	peptidase M24 family protein	NA	NA	NA	NA	NA
AUJ18350.1|3683867_3684410_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ18351.1|3684647_3684869_+	TIGR02449 family protein	NA	NA	NA	NA	NA
AUJ17330.1|3684865_3685165_+	cell division protein ZapA	NA	NA	NA	NA	NA
AUJ17331.1|3685775_3686366_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
AUJ18352.1|3686389_3686833_+	EVE domain-containing protein	NA	NA	NA	NA	NA
AUJ17332.1|3686924_3687572_+	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
AUJ17333.1|3687726_3688176_+	ACR family protein	NA	NA	NA	NA	NA
AUJ17334.1|3688325_3689207_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ18353.1|3689256_3689412_-	rubredoxin	NA	NA	NA	NA	NA
AUJ17335.1|3689519_3690143_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
AUJ17336.1|3690566_3692021_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17337.1|3694050_3695340_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AUJ17338.1|3695612_3695849_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17339.1|3695867_3698639_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AUJ17340.1|3698717_3699167_-	azurin	NA	NA	NA	NA	NA
AUJ17341.1|3700610_3701114_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17342.1|3705110_3705728_+	hydrolase	NA	NA	NA	NA	NA
AUJ17343.1|3705973_3707200_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	24.4	4.4e-16
AUJ17344.1|3708360_3708699_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17345.1|3708711_3709116_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17346.1|3709134_3709314_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17347.1|3709369_3709726_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ17348.1|3709691_3710168_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ17349.1|3710214_3710874_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
AUJ17350.1|3711025_3713113_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17351.1|3713226_3713496_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17352.1|3713835_3714720_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17353.1|3714866_3715463_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AUJ18354.1|3715462_3716821_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
AUJ17354.1|3717185_3717749_-	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	31.4	2.1e-13
AUJ17355.1|3717908_3719165_+	6-phosphofructokinase	NA	NA	NA	NA	NA
AUJ17356.1|3719464_3720433_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.6e-98
AUJ17357.1|3720554_3721649_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
>prophage 26
CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	3764283	3824485	4703977	transposase,protease	Staphylococcus_phage(14.29%)	45	NA	NA
AUJ17385.1|3764283_3765300_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.3	5.6e-49
AUJ17386.1|3765215_3765518_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17387.1|3765553_3765823_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ18358.1|3766921_3767284_-	transcriptional regulator	NA	NA	NA	NA	NA
AUJ17388.1|3768304_3768724_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ17389.1|3769193_3769337_+	alpha-mannosidase	NA	NA	NA	NA	NA
AUJ17390.1|3769512_3771822_-	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
AUJ17391.1|3772019_3773393_-	C4-dicarboxylate transporter DctA	NA	NA	NA	NA	NA
AUJ17392.1|3773688_3774861_+	porin	NA	NA	NA	NA	NA
AUJ17393.1|3775182_3777828_+	hybrid sensor histidine kinase/response regulator	NA	B5LWN0	Feldmannia_species_virus	27.7	5.8e-13
AUJ17394.1|3778143_3779493_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.3	1.3e-61
AUJ17395.1|3779489_3780269_+	molybdenum ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUJ17396.1|3780260_3781163_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ17397.1|3781473_3782079_+	rhizopine catabolism protein mocA	NA	NA	NA	NA	NA
AUJ17398.1|3782795_3783182_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ18359.1|3783150_3783789_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUJ17399.1|3784877_3786263_-	histidine kinase	NA	W8CYF6	Bacillus_phage	23.7	2.4e-10
AUJ17400.1|3786255_3786957_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUJ18360.1|3787212_3788406_+	porin	NA	NA	NA	NA	NA
AUJ17401.1|3788405_3788639_+	magnesium transporter	NA	NA	NA	NA	NA
AUJ17402.1|3788632_3789961_+	citrate transporter	NA	NA	NA	NA	NA
AUJ17403.1|3790075_3790816_+	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
AUJ17404.1|3790836_3791034_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17405.1|3791075_3792107_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUJ17406.1|3792333_3793665_-	MFS transporter	NA	NA	NA	NA	NA
AUJ18361.1|3793914_3796377_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUJ17407.1|3796411_3798328_+	amylosucrase	NA	NA	NA	NA	NA
AUJ17408.1|3798494_3799175_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
AUJ17409.1|3799327_3800590_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17410.1|3800589_3801681_-	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
AUJ17411.1|3801834_3803106_+	aminotransferase	NA	NA	NA	NA	NA
AUJ17412.1|3803105_3803756_+	lysophospholipase	NA	NA	NA	NA	NA
AUJ17413.1|3804077_3804749_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AUJ17414.1|3805051_3805828_-	acetyl xylan esterase	NA	NA	NA	NA	NA
AUJ17415.1|3805888_3806815_+	monothiol glutaredoxin, Grx4 family	NA	NA	NA	NA	NA
AUJ17416.1|3810146_3811427_+	amidohydrolase	NA	NA	NA	NA	NA
AUJ18362.1|3811730_3812057_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17417.1|3812417_3814019_+	rhamnogalacturonase B	NA	NA	NA	NA	NA
AUJ18363.1|3814634_3815381_-	cellulase	NA	NA	NA	NA	NA
AUJ17418.1|3818179_3818695_-	peptide deformylase	NA	NA	NA	NA	NA
AUJ17419.1|3819007_3819976_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
AUJ17420.1|3820177_3820600_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	62.2	1.0e-41
AUJ17421.1|3821192_3821582_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ18364.1|3821574_3823227_+|protease	serine protease	protease	NA	NA	NA	NA
AUJ17422.1|3823678_3824485_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	37.1	9.1e-10
>prophage 27
CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	3850708	3897950	4703977	tRNA,transposase,protease	Staphylococcus_phage(18.18%)	34	NA	NA
AUJ17444.1|3850708_3852592_-|protease	protease	protease	A0A1B0T6A2	Bacillus_phage	30.7	7.0e-21
AUJ17445.1|3852812_3858893_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17446.1|3859870_3863923_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	56.9	5.8e-121
AUJ18367.1|3863815_3864082_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17447.1|3864338_3865136_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17448.1|3865619_3866591_-	site-specific tyrosine recombinase XerD	NA	A0A0K0N6I5	Gordonia_phage	30.3	1.9e-14
AUJ17449.1|3867016_3867484_+	RDD family protein	NA	NA	NA	NA	NA
AUJ17450.1|3867581_3867893_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ18368.1|3867897_3869004_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AUJ17451.1|3869000_3870083_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AUJ17452.1|3870190_3871663_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.5	9.0e-48
AUJ17453.1|3871662_3872019_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17454.1|3872018_3872444_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AUJ17455.1|3872454_3873687_+	ATPase	NA	NA	NA	NA	NA
AUJ17456.1|3873689_3874337_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17457.1|3874465_3877408_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	34.2	2.2e-130
AUJ18369.1|3878067_3880104_+	lytic murein transglycosylase	NA	A0A0H3V0Q1	Geobacillus_virus	36.7	1.4e-14
AUJ17458.1|3880560_3881937_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	9.2e-63
AUJ17459.1|3882290_3883307_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
AUJ17460.1|3884660_3885677_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
AUJ17461.1|3885876_3886863_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.0	1.3e-42
AUJ17462.1|3886715_3886985_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ18370.1|3887537_3888011_-	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
AUJ17463.1|3888016_3888484_-	alanine acetyltransferase	NA	NA	NA	NA	NA
AUJ17464.1|3888494_3889268_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AUJ18371.1|3889432_3889804_+	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
AUJ17465.1|3889915_3891610_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AUJ17466.1|3891752_3892214_+	DNA-binding protein	NA	NA	NA	NA	NA
AUJ17467.1|3892291_3893551_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17468.1|3893720_3894833_+	ABC transporter permease	NA	NA	NA	NA	NA
AUJ17469.1|3894918_3895761_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.5	2.4e-13
AUJ17470.1|3895763_3896690_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUJ17471.1|3896686_3897331_+	ABC transporter	NA	NA	NA	NA	NA
AUJ17472.1|3897473_3897950_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 28
CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	3905477	3911847	4703977		Enterobacteria_phage(50.0%)	6	NA	NA
AUJ17478.1|3905477_3906824_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.6e-33
AUJ17479.1|3906869_3908273_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	28.8	1.6e-41
AUJ17480.1|3908389_3909298_-	NAD(P)-dependent oxidoreductase	NA	A0A1D7XFA3	Escherichia_phage	33.8	5.4e-27
AUJ17481.1|3909294_3909852_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	48.1	1.7e-44
AUJ17482.1|3909848_3910736_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
AUJ17483.1|3910791_3911847_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
>prophage 29
CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	3916878	3964094	4703977	transposase	Leptospira_phage(11.11%)	43	NA	NA
AUJ17488.1|3916878_3917148_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ17489.1|3917000_3917987_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.6e-43
AUJ17490.1|3920019_3921396_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	3.2e-63
AUJ17491.1|3922059_3922323_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ17492.1|3922367_3923438_-	acyltransferase	NA	A9YX16	Burkholderia_phage	33.0	6.5e-40
AUJ17493.1|3923443_3924607_-	glycosyl transferase	NA	NA	NA	NA	NA
AUJ17494.1|3924597_3924888_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17495.1|3924908_3925835_-	glycosyltransferase	NA	NA	NA	NA	NA
AUJ17496.1|3926866_3927943_-	NAD-dependent dehydratase	NA	A0A1V0SG19	Hokovirus	21.8	2.4e-10
AUJ17497.1|3927977_3928778_-	methyltransferase	NA	H8ZJI6	Ostreococcus_tauri_virus	28.0	9.3e-07
AUJ17498.1|3928824_3930018_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
AUJ18373.1|3930108_3931479_-	cystathionine beta-synthase	NA	A0A1X9I5F1	Streptococcus_phage	38.8	2.6e-49
AUJ17499.1|3931719_3931938_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17500.1|3932279_3933170_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17501.1|3933166_3933550_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17502.1|3933648_3934782_+	type IV pili twitching motility protein PilT	NA	NA	NA	NA	NA
AUJ17503.1|3935121_3935784_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
AUJ18374.1|3935827_3936817_-	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
AUJ17504.1|3936978_3937104_-	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
AUJ17505.1|3937196_3938579_+	RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.3	6.4e-56
AUJ18375.1|3939003_3939357_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
AUJ18376.1|3939549_3939885_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17506.1|3939999_3940674_-	dethiobiotin synthase	NA	NA	NA	NA	NA
AUJ17507.1|3940998_3941481_+	diguanylate cyclase	NA	NA	NA	NA	NA
AUJ17508.1|3941477_3941876_+	transcriptional regulator	NA	NA	NA	NA	NA
AUJ17509.1|3942006_3942975_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	4.3e-99
AUJ17510.1|3943347_3943998_-	phosphoglycolate phosphatase, bacterial	NA	NA	NA	NA	NA
AUJ17511.1|3944140_3945220_-	DNA polymerase IV	NA	NA	NA	NA	NA
AUJ17512.1|3945219_3945567_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17513.1|3945565_3946081_+	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
AUJ17514.1|3946080_3947289_+	beta-ketoacyl-[acyl-carrier-protein] synthase I	NA	NA	NA	NA	NA
AUJ17515.1|3947402_3948224_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17516.1|3948397_3950422_-	oligopeptidase A	NA	NA	NA	NA	NA
AUJ17517.1|3950465_3951569_-	cysteine synthase	NA	NA	NA	NA	NA
AUJ17518.1|3951712_3952129_+	copper homeostasis protein	NA	NA	NA	NA	NA
AUJ18377.1|3952236_3954033_+	copper resistance protein CopA	NA	NA	NA	NA	NA
AUJ17519.1|3954029_3955076_+	copper resistance protein B	NA	NA	NA	NA	NA
AUJ18378.1|3955232_3955757_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
AUJ17520.1|3955956_3956433_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AUJ17521.1|3958261_3958735_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17522.1|3959116_3960946_-	glutamine--fructose-6-phosphate aminotransferase	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.7	3.5e-134
AUJ17523.1|3963559_3963862_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17524.1|3963830_3964094_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 30
CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	4055091	4126106	4703977	transposase,integrase,tRNA	Leptospira_phage(27.27%)	59	4041708:4041728	4107827:4107847
4041708:4041728	attL	TTTAGAGCGGCTAACAACACG	NA	NA	NA	NA
AUJ17596.1|4055091_4056060_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
AUJ17597.1|4056292_4056673_+	response regulator	NA	NA	NA	NA	NA
AUJ18390.1|4056641_4056872_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17598.1|4056907_4058206_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AUJ17599.1|4058336_4058552_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17600.1|4058723_4059005_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17601.1|4059306_4060716_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AUJ17602.1|4060706_4061723_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AUJ17603.1|4062298_4062550_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17604.1|4063522_4064686_+	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.5	1.0e-09
AUJ17605.1|4065327_4065642_+	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
AUJ17606.1|4065651_4065873_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17607.1|4066321_4066534_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17608.1|4066872_4067610_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17609.1|4067620_4070272_+	chemotaxis protein	NA	NA	NA	NA	NA
AUJ17610.1|4070268_4070943_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17611.1|4070939_4071605_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17612.1|4071689_4073831_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AUJ17613.1|4073920_4075189_-	ABC transporter permease	NA	NA	NA	NA	NA
AUJ17614.1|4075188_4076625_-	ABC transporter permease	NA	NA	NA	NA	NA
AUJ17615.1|4076635_4077358_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	6.8e-17
AUJ17616.1|4078752_4080984_-	isocitrate dehydrogenase, NADP-dependent	NA	NA	NA	NA	NA
AUJ18391.1|4081173_4082886_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17617.1|4082954_4083230_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17618.1|4083724_4084540_-	preQ(1) synthase	NA	A0A2I7SAX1	Vibrio_phage	35.5	1.3e-35
AUJ18392.1|4084713_4085034_+|integrase	integrase	integrase	NA	NA	NA	NA
AUJ17619.1|4085262_4086582_-	N-acyl-L-amino acid amidohydrolase	NA	NA	NA	NA	NA
AUJ17620.1|4086841_4088086_+	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AUJ17621.1|4088180_4091429_+	acriflavine resistance protein B	NA	NA	NA	NA	NA
AUJ17622.1|4091562_4094703_+	acriflavin resistance protein	NA	NA	NA	NA	NA
AUJ18393.1|4095321_4095537_+	VOC family protein	NA	NA	NA	NA	NA
AUJ17623.1|4096013_4097381_-	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
AUJ17624.1|4097390_4097600_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ18394.1|4097698_4098316_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17625.1|4099169_4099922_-	haloacid dehalogenase	NA	NA	NA	NA	NA
AUJ17626.1|4099959_4100400_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17627.1|4100606_4100948_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17628.1|4101173_4101551_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17629.1|4101747_4101945_-	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
AUJ18395.1|4103085_4103889_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A223VZK2	Agrobacterium_phage	29.3	2.9e-08
AUJ18396.1|4104167_4105517_+	NlpC-P60 family protein	NA	NA	NA	NA	NA
AUJ17630.1|4105513_4106617_+	dipeptide epimerase	NA	NA	NA	NA	NA
AUJ17631.1|4106637_4107696_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.8e-74
AUJ17632.1|4108579_4109356_+	hypothetical protein	NA	NA	NA	NA	NA
4107827:4107847	attR	CGTGTTGTTAGCCGCTCTAAA	NA	NA	NA	NA
AUJ17633.1|4109352_4110669_+	amino acid transporter	NA	NA	NA	NA	NA
AUJ17634.1|4110881_4111163_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17635.1|4111335_4111668_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17636.1|4111722_4112157_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17637.1|4112341_4113520_+	glucose dehydrogenase	NA	NA	NA	NA	NA
AUJ17638.1|4114059_4116231_-	beta-glucosidase	NA	NA	NA	NA	NA
AUJ17639.1|4116459_4116816_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AUJ17640.1|4116895_4117960_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.4	5.1e-101
AUJ17641.1|4118239_4118455_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AUJ18397.1|4118861_4119308_+|tRNA	glutamyl-tRNA amidotransferase	tRNA	A0A292GL36	Xanthomonas_phage	44.5	3.9e-23
AUJ17642.1|4120328_4121387_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.8e-74
AUJ17643.1|4121926_4122889_+	BrkB protein	NA	NA	NA	NA	NA
AUJ17644.1|4122977_4124726_+	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	34.8	6.5e-45
AUJ17645.1|4124997_4125267_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ17646.1|4125119_4126106_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-43
>prophage 31
CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	4142046	4194586	4703977	transposase,tRNA,protease	Leptospira_phage(14.29%)	42	NA	NA
AUJ17659.1|4142046_4142505_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AUJ17660.1|4143822_4144092_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ17661.1|4143944_4144931_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.6e-43
AUJ17662.1|4144944_4145067_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ18401.1|4151129_4152341_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
AUJ17663.1|4152511_4153930_+	hypothetical protein	NA	A0A0K2CNY2	Brevibacillus_phage	37.9	6.9e-13
AUJ17664.1|4154300_4155434_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
AUJ17665.1|4155471_4155699_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ18402.1|4155757_4156978_-	MFS transporter	NA	NA	NA	NA	NA
AUJ17666.1|4157372_4158173_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	29.0	3.1e-26
AUJ17667.1|4158300_4158960_+	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
AUJ17668.1|4158982_4159741_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17669.1|4159778_4160576_+	chromosome partitioning protein	NA	Q8JL10	Natrialba_phage	30.3	9.5e-20
AUJ17670.1|4160575_4161502_+	chromosome partitioning protein ParB	NA	I3NLC2	Bifidobacterium_phage	34.9	1.0e-12
AUJ17671.1|4161537_4161846_+	mitomycin resistance protein	NA	NA	NA	NA	NA
AUJ17672.1|4162050_4163016_+	protein CapI	NA	A0A1V0SKV4	Klosneuvirus	30.5	1.6e-29
AUJ17673.1|4163382_4164105_+	dolichol-phosphate mannosyltransferase	NA	NA	NA	NA	NA
AUJ17674.1|4164104_4164446_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17675.1|4164863_4165412_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ18403.1|4165519_4166914_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	29.5	2.6e-49
AUJ17676.1|4167881_4168349_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	Q2NP83	Xanthomonas_phage	96.1	1.1e-79
AUJ17677.1|4168345_4169620_-	bifunctional 4'-phosphopantothenoylcysteine decarboxylase/phosphopantothenoylcysteine synthetase	NA	Q9HH70	Methanothermobacter_phage	31.2	5.8e-35
AUJ17678.1|4169716_4170394_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17679.1|4172348_4173230_+	sporulation protein	NA	NA	NA	NA	NA
AUJ17680.1|4173236_4173716_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17681.1|4173807_4174563_+	NADP-dependent 3-hydroxy acid dehydrogenase	NA	NA	NA	NA	NA
AUJ17682.1|4174843_4175734_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	42.0	1.1e-37
AUJ17683.1|4175586_4175856_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ17684.1|4175942_4179845_-	avirulence protein	NA	NA	NA	NA	NA
AUJ18404.1|4180628_4181336_-	hypothetical protein	NA	U5P429	Shigella_phage	59.1	3.4e-69
AUJ17685.1|4181380_4181653_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	58.8	1.2e-19
AUJ17686.1|4182026_4182341_-	hypothetical protein	NA	A0A077K814	Ralstonia_phage	64.1	1.2e-21
AUJ17687.1|4182485_4184372_-	arginine decarboxylase	NA	NA	NA	NA	NA
AUJ17688.1|4184610_4185468_+	spermidine synthase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	32.5	2.2e-14
AUJ17689.1|4185906_4186518_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17690.1|4186710_4187523_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ18405.1|4188201_4188738_+	kinase	NA	NA	NA	NA	NA
AUJ17691.1|4189086_4191072_-	beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
AUJ18406.1|4191685_4192024_-	transcriptional regulator	NA	NA	NA	NA	NA
AUJ17692.1|4192213_4192492_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17693.1|4192508_4194029_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AUJ17694.1|4194109_4194586_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 32
CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	4231173	4300473	4703977	tRNA,transposase	Staphylococcus_phage(18.18%)	60	NA	NA
AUJ17723.1|4231173_4232463_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AUJ17724.1|4232631_4232841_-	CsbD family protein	NA	NA	NA	NA	NA
AUJ17725.1|4233081_4233216_-	entericidin	NA	NA	NA	NA	NA
AUJ17726.1|4233290_4233443_-	entericidin	NA	NA	NA	NA	NA
AUJ17727.1|4233550_4234474_-	arginase	NA	A0A0N9R043	Chrysochromulina_ericina_virus	34.4	1.7e-28
AUJ17728.1|4234795_4235461_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17729.1|4235457_4236000_+	GTPase	NA	NA	NA	NA	NA
AUJ17730.1|4236503_4237187_+	thymidylate kinase	NA	K7R9G5	Vibrio_phage	33.8	1.3e-14
AUJ17731.1|4238926_4239655_-	pantothenate kinase	NA	NA	NA	NA	NA
AUJ17732.1|4239651_4240617_-	bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor	NA	NA	NA	NA	NA
AUJ17733.1|4240974_4241286_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17734.1|4241294_4242050_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ18410.1|4242202_4243387_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ18411.1|4243506_4245096_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17735.1|4245215_4246631_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AUJ17736.1|4246660_4247344_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AUJ17737.1|4247415_4247718_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17738.1|4248053_4249064_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AUJ17739.1|4249480_4250335_-|transposase	transposase	transposase	U5P429	Shigella_phage	57.7	6.3e-86
AUJ17740.1|4250719_4254211_-	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
AUJ17741.1|4255007_4255187_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ18412.1|4256591_4256786_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17742.1|4257537_4258113_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17743.1|4258171_4259695_-	catalase	NA	A0A2K9L0T1	Tupanvirus	48.0	2.8e-97
AUJ17744.1|4260138_4261107_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
AUJ18413.1|4261550_4262021_-	hemolysin D	NA	NA	NA	NA	NA
AUJ18414.1|4261982_4262171_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ18415.1|4262705_4264838_-	ATP-dependent DNA helicase DinG	NA	NA	NA	NA	NA
AUJ17745.1|4265324_4265699_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17746.1|4265688_4266540_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
AUJ18416.1|4266592_4267474_+	TolB-like protein	NA	NA	NA	NA	NA
AUJ17747.1|4268139_4270701_-	iron-uptake factor	NA	NA	NA	NA	NA
AUJ17748.1|4270933_4271686_+	endonuclease	NA	H6X497	Enterobacteria_phage	33.3	2.8e-21
AUJ17749.1|4271813_4272728_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ17750.1|4272820_4273798_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17751.1|4273985_4274978_-	porphobilinogen synthase	NA	NA	NA	NA	NA
AUJ18417.1|4275198_4275417_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ18418.1|4275667_4276123_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ18419.1|4276223_4278053_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17752.1|4278218_4280456_-	S9 family peptidase	NA	NA	NA	NA	NA
AUJ17753.1|4282049_4283066_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	3.3e-49
AUJ17754.1|4283037_4283238_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17755.1|4283236_4284613_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
AUJ17756.1|4287031_4288042_+	energy transducer TonB	NA	NA	NA	NA	NA
AUJ17757.1|4288442_4289636_-	sodium ABC transporter permease	NA	NA	NA	NA	NA
AUJ17758.1|4289632_4290379_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	5.2e-20
AUJ17759.1|4290410_4292012_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUJ17760.1|4292072_4292273_-	transcriptional regulator	NA	NA	NA	NA	NA
AUJ18420.1|4292269_4292677_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17761.1|4293305_4293578_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17762.1|4293643_4294633_+	cation transporter	NA	NA	NA	NA	NA
AUJ17763.1|4294702_4295464_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AUJ17764.1|4295566_4296562_+	ABC transporter	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.2	8.5e-26
AUJ18421.1|4296579_4297371_+	ABC transporter permease	NA	NA	NA	NA	NA
AUJ17765.1|4297372_4297957_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17766.1|4298075_4299014_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AUJ17767.1|4299013_4299196_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17768.1|4299127_4299331_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17769.1|4299370_4299634_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ17770.1|4299486_4300473_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-43
>prophage 33
CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	4374101	4432883	4703977	transposase	Ralstonia_phage(42.86%)	42	NA	NA
AUJ17818.1|4374101_4375478_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.6	1.3e-61
AUJ17819.1|4375691_4376363_+	4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase	NA	NA	NA	NA	NA
AUJ18430.1|4377402_4377642_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17820.1|4377638_4378661_+	4-oxalomesaconate hydratase	NA	NA	NA	NA	NA
AUJ17821.1|4379050_4379218_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
AUJ17822.1|4379231_4379468_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
AUJ18431.1|4379652_4379979_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ18432.1|4382491_4383130_-	16S rRNA methyltransferase G	NA	NA	NA	NA	NA
AUJ18433.1|4383352_4384981_+	alkaline phosphatase	NA	NA	NA	NA	NA
AUJ17823.1|4386754_4387351_-	4-phosphopantetheinyl transferase	NA	NA	NA	NA	NA
AUJ17824.1|4387477_4387729_+	transglycosylase	NA	NA	NA	NA	NA
AUJ17825.1|4387790_4388228_-	aldehyde-activating protein	NA	NA	NA	NA	NA
AUJ17826.1|4388224_4389004_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
AUJ17827.1|4390682_4392410_-	cation acetate symporter	NA	NA	NA	NA	NA
AUJ17828.1|4392406_4392724_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17829.1|4394489_4396433_+	acetyl-coenzyme A synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	37.8	8.7e-83
AUJ17830.1|4396694_4397363_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AUJ17831.1|4398627_4398831_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17832.1|4400184_4400406_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17833.1|4400402_4401413_+	oxidoreductase	NA	NA	NA	NA	NA
AUJ17834.1|4401409_4402282_+	amidohydrolase	NA	NA	NA	NA	NA
AUJ17835.1|4402278_4403049_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUJ17836.1|4403218_4404076_+	2-hydroxyhepta-2,4-diene-1,7-dioate isomerase	NA	NA	NA	NA	NA
AUJ17837.1|4404598_4405918_+	L-fuconate dehydratase	NA	NA	NA	NA	NA
AUJ17838.1|4406412_4407381_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
AUJ18434.1|4407506_4407872_-	L-fucose mutarotase	NA	NA	NA	NA	NA
AUJ17839.1|4407868_4409170_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
AUJ17840.1|4409350_4410127_+	transcriptional regulator	NA	NA	NA	NA	NA
AUJ18435.1|4410603_4411188_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ18436.1|4411380_4414830_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
AUJ17841.1|4415581_4418224_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ18437.1|4418327_4420727_-	NdvB protein	NA	NA	NA	NA	NA
AUJ17842.1|4420729_4422112_-	MFS transporter	NA	NA	NA	NA	NA
AUJ18438.1|4422326_4422854_+	gluconokinase	NA	NA	NA	NA	NA
AUJ18439.1|4423758_4425420_+	polyvinylalcohol dehydrogenase	NA	A0A0M4JT37	Mollivirus	36.1	1.7e-82
AUJ17843.1|4425751_4426057_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ18440.1|4425959_4426400_-	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AUJ17844.1|4426419_4426848_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17845.1|4428388_4428658_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ17846.1|4428510_4429497_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.6e-43
AUJ17847.1|4429515_4430484_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
AUJ17848.1|4431914_4432883_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
>prophage 34
CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	4468153	4538918	4703977	tRNA,transposase	Acidithiobacillus_phage(21.43%)	47	NA	NA
AUJ17867.1|4468153_4469071_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	3.1e-83
AUJ17868.1|4469161_4469701_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17869.1|4469704_4471042_+	xylose isomerase	NA	NA	NA	NA	NA
AUJ17870.1|4471267_4472350_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUJ17871.1|4472489_4474685_+	alpha-glucuronidase	NA	NA	NA	NA	NA
AUJ17872.1|4474681_4476646_+	9-O-acetylesterase	NA	NA	NA	NA	NA
AUJ17873.1|4476657_4477917_+	bifunctional D-altronate/D-mannonate dehydratase	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
AUJ17874.1|4477916_4479617_+	glycoside hydrolase 43 family protein	NA	NA	NA	NA	NA
AUJ17875.1|4479619_4482334_+	glucan 1,4-alpha-glucosidase	NA	NA	NA	NA	NA
AUJ17876.1|4482556_4484077_+	mannitol dehydrogenase	NA	G8DCZ3	Micromonas_pusilla_virus	31.4	2.5e-45
AUJ17877.1|4484071_4485130_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.8e-74
AUJ17878.1|4485285_4486662_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
AUJ17879.1|4486838_4487942_+	restriction endonuclease	NA	A0A1S5SAB0	Streptococcus_phage	40.4	9.4e-58
AUJ17880.1|4488033_4488408_-	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
AUJ17881.1|4489108_4490125_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.9e-49
AUJ17882.1|4490747_4491803_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17883.1|4492029_4493448_-	uronate isomerase	NA	NA	NA	NA	NA
AUJ17884.1|4493488_4494466_-	1,4-beta-xylanase	NA	NA	NA	NA	NA
AUJ17885.1|4495870_4497352_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ18443.1|4497693_4500567_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AUJ17886.1|4500665_4502153_+	MFS transporter	NA	NA	NA	NA	NA
AUJ17887.1|4502184_4503219_+	alpha-N-arabinofuranosidase	NA	NA	NA	NA	NA
AUJ18444.1|4503560_4504094_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17888.1|4504375_4505344_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	6.6e-100
AUJ17889.1|4505346_4505529_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17890.1|4506817_4507390_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17891.1|4507528_4507747_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17892.1|4507892_4508147_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17893.1|4508383_4509364_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AUJ17894.1|4509559_4512223_-	glycerol-3-phosphate 1-O-acyltransferase	NA	NA	NA	NA	NA
AUJ17895.1|4512222_4513203_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17896.1|4513195_4513441_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17897.1|4513609_4514662_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AUJ17898.1|4514826_4517865_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17899.1|4518166_4518598_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17900.1|4518703_4520080_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	3.2e-63
AUJ17901.1|4522828_4524358_+	tryptophan halogenase	NA	M4T1E3	Cyanophage	28.5	3.9e-46
AUJ17902.1|4524664_4525444_-	orotidine 5'-phosphate decarboxylase	NA	NA	NA	NA	NA
AUJ18445.1|4525440_4526400_-	acid phosphatase	NA	NA	NA	NA	NA
AUJ17903.1|4526730_4527396_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17904.1|4528794_4530771_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.2	6.3e-113
AUJ17905.1|4530977_4531607_+	thymidine kinase	NA	A0A023W530	Serratia_phage	55.0	1.1e-52
AUJ17906.1|4532065_4533304_+	histidine kinase	NA	NA	NA	NA	NA
AUJ18446.1|4533446_4535045_-	glucan biosynthesis protein D	NA	NA	NA	NA	NA
AUJ17907.1|4535113_4536205_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ18447.1|4536437_4537253_-	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	27.0	1.1e-18
AUJ17908.1|4537541_4538918_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
>prophage 35
CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	4553672	4616464	4703977	transposase,protease	Acidithiobacillus_phage(31.25%)	50	NA	NA
AUJ17916.1|4553672_4555049_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.3	4.3e-60
AUJ17917.1|4555180_4556362_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17918.1|4556459_4559891_-	ATP-binding protein	NA	NA	NA	NA	NA
AUJ17919.1|4560038_4560737_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17920.1|4560720_4562193_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17921.1|4562189_4562777_-	cytoplasmic protein	NA	NA	NA	NA	NA
AUJ17922.1|4562776_4563973_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
AUJ17923.1|4564046_4564676_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	49.5	4.2e-47
AUJ17924.1|4564769_4565267_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ18448.1|4565382_4565526_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17925.1|4566680_4567205_+	FUSC family protein	NA	NA	NA	NA	NA
AUJ17926.1|4567176_4568193_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
AUJ17927.1|4568599_4569961_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.1	5.8e-33
AUJ18449.1|4570141_4571518_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
AUJ18450.1|4572206_4572920_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17928.1|4572950_4573457_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17929.1|4573730_4573937_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17930.1|4573923_4575036_+	plasmid stabilization protein ParE	NA	NA	NA	NA	NA
AUJ17931.1|4575384_4576371_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	40.6	2.9e-42
AUJ17932.1|4576432_4577068_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17933.1|4577249_4578044_-	peptidase	NA	NA	NA	NA	NA
AUJ17934.1|4578214_4578688_+	ATPase	NA	NA	NA	NA	NA
AUJ17935.1|4581170_4581500_-	thiol reductase thioredoxin	NA	A0A0K1Y9C9	Streptomyces_phage	32.5	7.2e-06
AUJ17936.1|4581520_4581919_-	attachment protein	NA	NA	NA	NA	NA
AUJ17937.1|4582878_4583349_-	DNA mismatch repair protein MutT	NA	NA	NA	NA	NA
AUJ17938.1|4585096_4586473_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
AUJ17939.1|4586515_4586596_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17940.1|4586617_4587001_+|protease	metalloprotease	protease	NA	NA	NA	NA
AUJ17941.1|4586997_4587309_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ18451.1|4587568_4588051_-	ATPase	NA	NA	NA	NA	NA
AUJ18452.1|4588599_4589517_+	histidine kinase	NA	NA	NA	NA	NA
AUJ17942.1|4589758_4589947_+	CsbD family protein	NA	NA	NA	NA	NA
AUJ17943.1|4590591_4590849_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17944.1|4590973_4591423_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17945.1|4591642_4592560_+	hypothetical protein	NA	K7PHD1	Enterobacteria_phage	47.3	1.7e-68
AUJ17946.1|4592569_4593514_-	hypothetical protein	NA	S5WIU1	Leptospira_phage	38.7	2.0e-32
AUJ17947.1|4593878_4596659_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AUJ17948.1|4596945_4597968_+	2-keto-3-deoxygluconate kinase	NA	NA	NA	NA	NA
AUJ18453.1|4598588_4599797_-	trans-2-enoyl-CoA reductase	NA	NA	NA	NA	NA
AUJ17949.1|4601768_4602935_+	alpha-hydroxy-acid oxidizing enzyme	NA	NA	NA	NA	NA
AUJ17950.1|4604886_4606263_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.0e-77
AUJ17951.1|4606273_4606567_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17952.1|4606677_4608873_-	ligand-gated channel	NA	A0A1B0VCF0	Salmonella_phage	40.6	2.4e-65
AUJ17953.1|4608971_4610174_+	aromatic amino acid aminotransferase	NA	NA	NA	NA	NA
AUJ17954.1|4610444_4611455_+	fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	7.3e-49
AUJ17955.1|4611729_4612197_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ18454.1|4612846_4613389_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	42.3	3.0e-33
AUJ17956.1|4613573_4614950_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	4.6e-78
AUJ17957.1|4615065_4615389_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17958.1|4615495_4616464_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
>prophage 36
CP019092	Xanthomonas oryzae pv. oryzae strain MAI145 chromosome, complete genome	4703977	4624350	4698357	4703977	transposase,tRNA,protease	Ralstonia_phage(25.0%)	59	NA	NA
AUJ17962.1|4624350_4625682_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.6	2.2e-61
AUJ18456.1|4625747_4626863_+	enterochelin esterase	NA	NA	NA	NA	NA
AUJ18457.1|4626974_4627385_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17963.1|4627644_4628100_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17964.1|4628032_4628230_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17965.1|4628323_4629211_-	pseudouridylate synthase	NA	NA	NA	NA	NA
AUJ17966.1|4629544_4631122_+	chlamydia polymorphic membrane family protein	NA	NA	NA	NA	NA
AUJ17967.1|4631616_4632444_+	restriction endonuclease	NA	NA	NA	NA	NA
AUJ17968.1|4633170_4634229_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.6e-73
AUJ17969.1|4636088_4637075_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.6e-43
AUJ17970.1|4637311_4637833_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17971.1|4637870_4638839_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
AUJ18458.1|4639307_4640045_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17972.1|4640062_4640755_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17973.1|4641948_4642974_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.9e-49
AUJ17974.1|4643011_4643344_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17975.1|4643336_4643813_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17976.1|4643815_4644250_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17977.1|4644365_4644611_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17978.1|4644611_4644806_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17979.1|4644947_4645280_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17980.1|4645528_4645627_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17981.1|4645729_4647124_-	nucleoside hydrolase	NA	NA	NA	NA	NA
AUJ17982.1|4648007_4648262_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	71.4	5.9e-16
AUJ17983.1|4648279_4648558_-	plasmid maintenance system killer protein	NA	A0A222YWE2	Escherichia_phage	37.0	2.9e-08
AUJ17984.1|4648655_4650917_-	exodeoxyribonuclease V subunit alpha	NA	A0A0N9S864	Staphylococcus_phage	44.9	1.5e-09
AUJ17985.1|4651104_4655166_-	exodeoxyribonuclease V subunit beta	NA	S5MMD7	Bacillus_phage	22.5	3.2e-10
AUJ17986.1|4655162_4658576_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
AUJ17987.1|4658901_4659594_-	hypothetical protein	NA	G3M9Y6	Bacillus_virus	24.2	9.8e-05
AUJ17988.1|4659605_4660742_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17989.1|4660881_4661850_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
AUJ18459.1|4662029_4663031_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.5	2.7e-96
AUJ17990.1|4664607_4665297_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	1.8e-35
AUJ17991.1|4665309_4666467_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ18460.1|4666602_4667790_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ17992.1|4667871_4668060_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ17993.1|4668105_4669092_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	40.6	9.9e-43
AUJ17994.1|4669416_4670211_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.5	5.8e-09
AUJ17995.1|4670210_4670960_+	ABC transporter permease	NA	NA	NA	NA	NA
AUJ17996.1|4670971_4671523_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
AUJ17997.1|4671519_4672182_+	organic solvent ABC transporter	NA	NA	NA	NA	NA
AUJ17998.1|4672156_4672462_+	anti-sigma B factor antagonist	NA	NA	NA	NA	NA
AUJ17999.1|4672472_4673531_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ18000.1|4673603_4674125_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ18001.1|4674212_4675589_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	3.2e-63
AUJ18461.1|4675957_4676503_-	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	34.5	2.0e-16
AUJ18462.1|4677642_4679223_-	recombinase RmuC	NA	NA	NA	NA	NA
AUJ18002.1|4679570_4680539_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.5e-99
AUJ18003.1|4683113_4683629_-	PucR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ18004.1|4683700_4684870_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	38.6	4.9e-41
AUJ18005.1|4684895_4686260_-	MFS transporter	NA	NA	NA	NA	NA
AUJ18006.1|4688054_4688375_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ18007.1|4688493_4689660_-	rRNA large subunit methyltransferase I	NA	NA	NA	NA	NA
AUJ18008.1|4689922_4690879_+	hypothetical protein	NA	K4F9T9	Cronobacter_phage	29.9	1.4e-30
AUJ18009.1|4691254_4692040_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AUJ18010.1|4692167_4693280_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
AUJ18011.1|4693508_4695809_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AUJ18012.1|4696003_4696858_+	phosphatase	NA	NA	NA	NA	NA
AUJ18013.1|4697016_4698357_-|tRNA	tRNA modification GTPase	tRNA	NA	NA	NA	NA
