The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP015496	Lactobacillus helveticus strain FAM8105 chromosome, complete genome	2209387	10451	56775	2209387	transposase,integrase	Streptococcus_phage(53.85%)	40	28563:28578	59459:59474
AUI73417.1|10451_11705_+|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.4	1.5e-40
AUI73418.1|12374_13967_-	multidrug ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.9	1.0e-12
AUI73419.1|13944_14436_-	hypothetical protein	NA	NA	NA	NA	NA
AUI73420.1|15604_15799_-	hypothetical protein	NA	NA	NA	NA	NA
AUI73421.1|16234_16843_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73422.1|16950_18972_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73423.1|18983_19439_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
AUI73424.1|19469_20864_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	50.1	3.2e-119
AUI73425.1|21071_22250_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
AUI73426.1|22480_23410_+	phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUI73427.1|23526_24804_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.4	5.6e-46
AUI73428.1|24894_26172_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.4	8.6e-47
AUI73429.1|26440_27370_+	fatty acid-binding protein DegV	NA	NA	NA	NA	NA
AUI73430.1|27499_28351_+	fructokinase	NA	NA	NA	NA	NA
28563:28578	attL	GGCAAGGTTACCGGCG	NA	NA	NA	NA
AUI73431.1|28723_28984_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73432.1|29044_30274_-	esterase	NA	NA	NA	NA	NA
AUI73433.1|30357_31062_-	methyltransferase	NA	G3MA03	Bacillus_virus	44.4	1.6e-18
AUI73434.1|31614_32901_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	51.3	1.7e-106
AUI73435.1|33158_33512_-	hypothetical protein	NA	NA	NA	NA	NA
AUI73436.1|33508_33709_-	transcriptional regulator	NA	NA	NA	NA	NA
AUI73437.1|33876_34515_+	spermidine/putrescine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.8	2.7e-17
AUI73438.1|34511_35270_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
AUI73439.1|37748_37973_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73440.1|37982_38570_+	transcriptional regulator	NA	NA	NA	NA	NA
AUI73441.1|38673_39975_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73442.1|41635_43036_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73443.1|43132_43906_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73444.1|43944_44505_-	ATP:cob(I)alamin adenosyltransferase	NA	NA	NA	NA	NA
AUI73445.1|44505_45030_-	hypothetical protein	NA	NA	NA	NA	NA
AUI73446.1|45031_45442_-	hypothetical protein	NA	NA	NA	NA	NA
AUI73447.1|45462_47697_-	ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent	NA	A0A1D8EUG2	Mycobacterium_phage	32.2	3.5e-88
AUI73448.1|47950_48985_+	AI-2E family transporter	NA	NA	NA	NA	NA
AUI73449.1|48981_49554_+	esterase	NA	NA	NA	NA	NA
AUI73450.1|49733_50762_-|integrase	integrase	integrase	H7BUM7	unidentified_phage	32.4	5.3e-47
AUI73451.1|50897_51527_-	fructose-2,6-bisphosphatase	NA	NA	NA	NA	NA
AUI73452.1|51929_53051_+	phosphoserine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.0e-92
AUI73453.1|53028_54195_+	3-phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	46.9	2.6e-98
AUI73454.1|54362_54677_+	supressor protein SugE	NA	NA	NA	NA	NA
AUI73455.1|55433_56267_+|transposase	transposase	transposase	NA	NA	NA	NA
AUI75207.1|56214_56775_+|transposase	transposase	transposase	NA	NA	NA	NA
59459:59474	attR	CGCCGGTAACCTTGCC	NA	NA	NA	NA
>prophage 2
CP015496	Lactobacillus helveticus strain FAM8105 chromosome, complete genome	2209387	90842	129000	2209387	transposase,protease	Corynebacterium_phage(16.67%)	35	NA	NA
AUI73477.1|90842_92021_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
AUI73478.1|92589_93492_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73479.1|94187_95303_+|transposase	transposase	transposase	A0A0N9STL0	Staphylococcus_phage	27.2	3.0e-19
AUI73480.1|95467_95662_-	hypothetical protein	NA	NA	NA	NA	NA
AUI73481.1|95839_96097_-	hypothetical protein	NA	NA	NA	NA	NA
AUI73482.1|96147_97326_-|transposase	transposase	transposase	A0A0N9STL0	Staphylococcus_phage	30.3	3.7e-28
AUI73483.1|97445_97652_-	hypothetical protein	NA	NA	NA	NA	NA
AUI73484.1|99586_100303_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.8	6.7e-41
AUI75209.1|100369_102226_+	PAS domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	32.0	5.1e-32
AUI73485.1|102215_103565_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73486.1|103567_104392_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73487.1|104407_105205_+	MBL fold hydrolase	NA	A0A2I7SDH3	Paenibacillus_phage	34.1	1.2e-30
AUI73488.1|105291_106533_+|protease	serine protease	protease	W5SAB9	Pithovirus	27.5	6.3e-10
AUI75210.1|106997_107477_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
AUI73489.1|107985_108870_-	proline iminopeptidase	NA	NA	NA	NA	NA
AUI73490.1|108878_109532_-	ABC transporter permease	NA	NA	NA	NA	NA
AUI73491.1|109535_110885_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.1	3.3e-12
AUI73492.1|111025_112204_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
AUI73493.1|112422_113364_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73494.1|115032_115929_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
AUI73495.1|115943_116504_-	hypothetical protein	NA	A0A0C5K8T5	Enterococcus_phage	28.7	5.1e-12
AUI73496.1|116570_117677_-	cation transporter	NA	NA	NA	NA	NA
AUI73497.1|117854_118259_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73498.1|118328_118511_+	hypothetical protein	NA	NA	NA	NA	NA
AUI75211.1|118867_119539_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73499.1|119758_120949_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	58.5	5.6e-125
AUI73500.1|121003_121336_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73501.1|121332_121815_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73502.1|122108_122342_-	hypothetical protein	NA	NA	NA	NA	NA
AUI73503.1|122506_123154_+	hydrolase	NA	NA	NA	NA	NA
AUI73504.1|123154_124072_+	restriction endonuclease	NA	NA	NA	NA	NA
AUI73505.1|124124_124880_-	ABC transporter	NA	G9BWD6	Planktothrix_phage	36.7	3.1e-28
AUI73506.1|124879_126493_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUI73507.1|126820_127453_-	3-methyladenine DNA glycosylase	NA	NA	NA	NA	NA
AUI73508.1|127593_129000_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
CP015496	Lactobacillus helveticus strain FAM8105 chromosome, complete genome	2209387	144505	209404	2209387	transposase,protease,tRNA	Lactobacillus_phage(14.29%)	50	NA	NA
AUI73527.1|144505_145741_-|protease	serine protease	protease	NA	NA	NA	NA
AUI73528.1|145896_146979_+	D-alanine--D-alanine ligase A	NA	NA	NA	NA	NA
AUI73529.1|147006_147747_+	transcriptional regulator	NA	NA	NA	NA	NA
AUI73530.1|147851_148985_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73531.1|148981_149767_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73532.1|149738_149924_+	hypothetical protein	NA	NA	NA	NA	NA
AUI75213.1|151372_151861_-|transposase	transposase	transposase	NA	NA	NA	NA
AUI73533.1|152116_155134_-	alpha-glucosidase	NA	NA	NA	NA	NA
AUI73534.1|155615_156092_-	nucleoside 2-deoxyribosyltransferase	NA	A0A0A7DMT2	Lactobacillus_phage	63.6	1.3e-51
AUI73535.1|156207_156705_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AUI73536.1|156723_157527_-	protein tyrosine phosphatase	NA	NA	NA	NA	NA
AUI73537.1|157677_158169_+	universal stress protein UspA	NA	NA	NA	NA	NA
AUI73538.1|158516_159452_+	phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUI73539.1|159481_160255_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	6.6e-26
AUI73540.1|160254_161052_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
AUI73541.1|161051_161864_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
AUI73542.1|161907_162480_-	3-methyladenine DNA glycosylase	NA	NA	NA	NA	NA
AUI73543.1|162634_163120_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73544.1|163173_164571_+	serine/threonine protein phosphatase	NA	A0A2P0ZKZ2	Lactobacillus_phage	21.6	6.8e-05
AUI73545.1|164686_166636_+	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y1H0	Organic_Lake_phycodnavirus	26.0	2.1e-20
AUI73546.1|166658_167942_+	carboxylate--amine ligase	NA	NA	NA	NA	NA
AUI73547.1|168592_170812_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	64.3	1.9e-251
AUI73548.1|170804_171518_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0C5K925	Enterococcus_phage	55.8	1.0e-49
AUI73549.1|171569_172139_+	metal-sulfur cluster biosynthetic enzyme	NA	NA	NA	NA	NA
AUI73550.1|172131_173325_+	histidine kinase	NA	NA	NA	NA	NA
AUI73551.1|173424_174642_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	33.1	5.0e-52
AUI73552.1|174719_176663_+	peptidase M13	NA	E3T4I7	Cafeteria_roenbergensis_virus	30.2	6.0e-68
AUI73553.1|176884_178906_-	potassium transporter Kup	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	34.4	9.4e-64
AUI73554.1|179169_179604_-	hypothetical protein	NA	NA	NA	NA	NA
AUI73555.1|180119_180521_-	hypothetical protein	NA	NA	NA	NA	NA
AUI73556.1|180757_180973_+	DUF1659 domain-containing protein	NA	NA	NA	NA	NA
AUI73557.1|181806_183141_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73558.1|185143_186367_+	N-acetylmuramidase	NA	S5M633	Brevibacillus_phage	38.8	1.4e-14
AUI73559.1|186385_187477_+	amidase	NA	NA	NA	NA	NA
AUI73560.1|187626_188805_+|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
AUI73561.1|189033_190440_+|transposase	transposase	transposase	NA	NA	NA	NA
AUI73562.1|190567_192403_+	potassium transporter	NA	NA	NA	NA	NA
AUI73563.1|193431_194838_+|transposase	transposase	transposase	NA	NA	NA	NA
AUI73564.1|195208_196174_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AUI73565.1|196183_196975_-	hypothetical protein	NA	NA	NA	NA	NA
AUI73566.1|197062_197293_-|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	57.4	2.3e-11
AUI73567.1|197399_198458_-	hypothetical protein	NA	A0A1B1P773	Bacillus_phage	43.9	2.2e-27
AUI73568.1|199421_200114_+	phosphoglyceromutase	NA	NA	NA	NA	NA
AUI73569.1|200336_200939_+	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
AUI73570.1|201002_201563_+	aldose epimerase	NA	NA	NA	NA	NA
AUI73571.1|201664_202774_+	LytR family transcriptional regulator	NA	NA	NA	NA	NA
AUI73572.1|202773_203391_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73573.1|203426_206417_+	glucan modification protein	NA	NA	NA	NA	NA
AUI73574.1|206502_207888_+	ferrous iron transporter A	NA	NA	NA	NA	NA
AUI73575.1|208141_209404_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	3.0e-84
>prophage 4
CP015496	Lactobacillus helveticus strain FAM8105 chromosome, complete genome	2209387	217993	284309	2209387	transposase,tRNA	Corynebacterium_phage(16.67%)	55	NA	NA
AUI73583.1|217993_219016_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AUI73584.1|219040_219520_+	competence protein ComE	NA	A7KUY9	Bacillus_phage	59.0	5.2e-37
AUI73585.1|219500_220118_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73586.1|220415_223079_+	magnesium-translocating P-type ATPase	NA	M1HK51	Paramecium_bursaria_Chlorella_virus	22.9	6.4e-36
AUI73587.1|223171_225148_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.2	2.3e-99
AUI73588.1|225147_225915_+	hydrolase TatD	NA	NA	NA	NA	NA
AUI73589.1|225901_226468_+	ribonuclease M5	NA	NA	NA	NA	NA
AUI73590.1|226457_227342_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase	NA	NA	NA	NA	NA
AUI73591.1|227404_227662_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73592.1|227780_228611_+	pur operon repressor	NA	NA	NA	NA	NA
AUI73593.1|228657_230043_+	UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase	NA	A0A1V0SFS6	Hokovirus	35.0	3.9e-29
AUI73594.1|230274_230880_+	S-layer protein	NA	NA	NA	NA	NA
AUI73595.1|230965_232117_+	cell separation protein	NA	NA	NA	NA	NA
AUI73596.1|232252_233647_+	cell division protein	NA	NA	NA	NA	NA
AUI73597.1|233887_234862_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	36.8	8.6e-47
AUI73598.1|235891_236167_-	hypothetical protein	NA	NA	NA	NA	NA
AUI73599.1|236194_237559_-	hypothetical protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	30.1	1.2e-27
AUI73600.1|237672_238074_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73601.1|238120_238678_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
AUI73602.1|238795_240415_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	47.2	5.6e-136
AUI73603.1|240544_241840_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AUI73604.1|242221_242584_+	haloacid dehalogenase	NA	NA	NA	NA	NA
AUI73605.1|242639_244064_-	peptidase U34	NA	NA	NA	NA	NA
AUI73606.1|244144_244969_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AUI73607.1|245068_246343_-	Uric acid permease PucJ	NA	NA	NA	NA	NA
AUI73608.1|246346_246925_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
AUI75215.1|247198_247801_-	hypothetical protein	NA	NA	NA	NA	NA
AUI73609.1|248152_249343_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	57.7	9.0e-123
AUI73610.1|249660_249855_-	hypothetical protein	NA	NA	NA	NA	NA
AUI75216.1|249841_250135_-	hypothetical protein	NA	NA	NA	NA	NA
AUI73611.1|250177_250330_-	DNA-binding protein	NA	NA	NA	NA	NA
AUI73612.1|250569_252120_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	34.1	6.2e-23
AUI73613.1|253872_254112_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73614.1|254278_255457_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
AUI73615.1|255888_257124_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.2	1.2e-101
AUI73616.1|257251_258529_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.1	1.2e-45
AUI73617.1|261033_262212_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.8e-38
AUI73618.1|262965_264144_+|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
AUI73619.1|264668_265736_+	cell surface protein	NA	NA	NA	NA	NA
AUI73620.1|265936_267652_-|transposase	transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	4.6e-88
AUI73621.1|267890_269075_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	58.8	2.6e-122
AUI73622.1|269261_270092_-	sugar-phosphatase	NA	NA	NA	NA	NA
AUI73623.1|270276_270522_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
AUI73624.1|270648_272016_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
AUI73625.1|272028_273540_+	DEAD/DEAH box helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	38.1	2.9e-65
AUI73626.1|273622_273979_+	holo-ACP synthase	NA	NA	NA	NA	NA
AUI73627.1|273981_275112_+	alanine racemase	NA	NA	NA	NA	NA
AUI73628.1|275895_276603_-	hypothetical protein	NA	NA	NA	NA	NA
AUI73629.1|276790_277762_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
AUI73630.1|277896_278454_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AUI73631.1|278455_281953_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
AUI73632.1|281964_282207_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73633.1|282272_282650_+	septation inhibitor protein	NA	NA	NA	NA	NA
AUI73634.1|282649_283012_+	RNA-binding protein	NA	NA	NA	NA	NA
AUI73635.1|283052_284309_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A0N7G7K4	Chrysochromulina_ericina_virus	26.0	1.6e-16
>prophage 5
CP015496	Lactobacillus helveticus strain FAM8105 chromosome, complete genome	2209387	367134	421717	2209387	transposase,tRNA	Streptococcus_phage(31.82%)	53	NA	NA
AUI73720.1|367134_367641_+|tRNA	tRNA-specific adenosine deaminase	tRNA	NA	NA	NA	NA
AUI73721.1|367835_369623_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	39.7	2.0e-49
AUI73722.1|369655_369991_+	nucleoid-associated protein	NA	NA	NA	NA	NA
AUI73723.1|369991_370591_+	recombination protein RecR	NA	NA	NA	NA	NA
AUI73724.1|370590_370836_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73725.1|370939_371578_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	51.0	3.6e-54
AUI73726.1|371589_371910_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73727.1|371910_372768_+	DNA polymerase III subunit delta	NA	M1NSC1	Streptococcus_phage	29.2	3.9e-19
AUI73728.1|372778_373129_+	Initiation-control protein	NA	NA	NA	NA	NA
AUI73729.1|373130_373985_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.7	2.3e-64
AUI73730.1|373987_374722_+	acyl-ACP thioesterase	NA	NA	NA	NA	NA
AUI73731.1|374764_375283_+	BioY family transporter	NA	NA	NA	NA	NA
AUI73732.1|375307_376042_+|tRNA	tRNA N6-adenosine(37)-N6-threonylcarbamoyltransferase complex dimerization subunit TsaB	tRNA	NA	NA	NA	NA
AUI73733.1|376025_376598_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
AUI75218.1|376648_377698_+|tRNA	tRNA N6-adenosine(37)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	35.2	1.1e-50
AUI73734.1|377766_379044_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.1	4.3e-46
AUI73735.1|379221_381135_-	ABC transporter	NA	A0A2K9L3Z8	Tupanvirus	31.4	6.0e-60
AUI73736.1|381308_381956_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
AUI73737.1|382095_382554_+	DNA-binding protein	NA	NA	NA	NA	NA
AUI73738.1|382550_383297_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73739.1|384696_385242_+	sucrose PTS transporter	NA	NA	NA	NA	NA
AUI73740.1|385456_387178_+|transposase	transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	4.7e-88
AUI75219.1|387226_387490_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73741.1|387571_387757_-	hypothetical protein	NA	NA	NA	NA	NA
AUI73742.1|388023_388554_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73743.1|388769_389054_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	42.4	4.3e-15
AUI73744.1|389107_390730_+	chaperonin GroL	NA	A0A240F766	uncultured_virus	54.0	4.4e-157
AUI73745.1|390889_393487_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	25.4	1.8e-38
AUI73746.1|393486_395397_+	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	29.7	5.8e-55
AUI73747.1|395397_395988_+	Holliday junction DNA helicase RuvA	NA	NA	NA	NA	NA
AUI73748.1|396036_397053_+	Holliday junction DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	31.6	5.5e-12
AUI73749.1|397111_397537_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
AUI73750.1|397672_399124_+	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	32.2	9.7e-63
AUI73751.1|399116_400238_+	DNA polymerase IV	NA	NA	NA	NA	NA
AUI73752.1|400297_401254_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73753.1|401246_402608_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.2	4.4e-49
AUI73754.1|403185_403671_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73755.1|403940_406580_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	33.0	6.1e-63
AUI73756.1|406640_406898_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73757.1|406897_407326_+	Holliday junction DNA helicase RuvA	NA	NA	NA	NA	NA
AUI73758.1|407327_407639_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73759.1|407702_410060_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	48.7	9.7e-20
AUI73760.1|410160_410472_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	37.8	7.0e-19
AUI73761.1|410531_411809_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.2	5.6e-46
AUI73762.1|411984_412356_-	mechanosensitive ion channel protein MscL	NA	NA	NA	NA	NA
AUI73763.1|413665_414079_-	hypothetical protein	NA	NA	NA	NA	NA
AUI73764.1|414155_414959_+	glutamate racemase	NA	NA	NA	NA	NA
AUI73765.1|414958_415579_+	non-canonical purine NTP pyrophosphatase	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	30.5	1.4e-10
AUI73766.1|416010_417288_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.7	6.6e-47
AUI73767.1|417390_418554_-|transposase	transposase	transposase	A0A1X9I619	Streptococcus_phage	36.1	8.6e-54
AUI73768.1|419136_419922_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73769.1|419925_420159_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73770.1|420310_421717_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
CP015496	Lactobacillus helveticus strain FAM8105 chromosome, complete genome	2209387	472292	588458	2209387	portal,transposase,tail,bacteriocin,capsid,terminase,head,tRNA,integrase	Lactobacillus_phage(63.64%)	130	490710:490729	531583:531602
AUI73803.1|472292_474707_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	65.8	0.0e+00
AUI73804.1|474800_476447_+	transporter	NA	NA	NA	NA	NA
AUI73805.1|476599_476779_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73806.1|476787_477696_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73807.1|477714_478170_+	pullulanase	NA	NA	NA	NA	NA
AUI73808.1|479056_479530_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73809.1|479602_480166_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73810.1|480162_480858_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73811.1|481811_482144_+	thiol reductase thioredoxin	NA	NA	NA	NA	NA
AUI73812.1|482133_482784_+	transcriptional regulator	NA	NA	NA	NA	NA
AUI73813.1|482898_483822_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	49.3	9.5e-80
AUI73814.1|483915_484074_+	protein-disulfide isomerase	NA	NA	NA	NA	NA
AUI73815.1|484129_484429_+	dithiol-disulfide isomerase	NA	NA	NA	NA	NA
AUI73816.1|484549_484843_-	hypothetical protein	NA	NA	NA	NA	NA
AUI73817.1|485106_485400_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73818.1|485455_485764_-	hypothetical protein	NA	NA	NA	NA	NA
AUI73819.1|486063_487359_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
AUI73820.1|487360_488209_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
AUI73821.1|488335_489010_+	cell surface protein	NA	NA	NA	NA	NA
AUI73822.1|489049_489541_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
490710:490729	attL	TGTTGCACAAATGTTGCACA	NA	NA	NA	NA
AUI73823.1|490772_490973_-	hypothetical protein	NA	NA	NA	NA	NA
AUI73824.1|491119_492241_-	lysin	NA	Q71JA9	Lactobacillus_phage	83.6	3.4e-180
AUI73825.1|492303_492693_-	hypothetical protein	NA	L0P6Z4	Lactobacillus_phage	37.8	2.0e-10
AUI73826.1|492694_492934_-	hypothetical protein	NA	L0P6E4	Lactobacillus_phage	72.2	1.6e-23
AUI73827.1|492917_493199_-	hypothetical protein	NA	NA	NA	NA	NA
AUI73828.1|493211_493616_-	hypothetical protein	NA	Q6SEB9	Lactobacillus_prophage	47.5	5.9e-26
AUI73829.1|493775_494504_-	hypothetical protein	NA	NA	NA	NA	NA
AUI73830.1|494906_495773_-	hypothetical protein	NA	NA	NA	NA	NA
AUI73831.1|495793_497212_-	hypothetical protein	NA	Q20DB8	Lactobacillus_phage	26.3	9.7e-07
AUI73832.1|497208_497883_-	hypothetical protein	NA	L0P8N4	Lactobacillus_phage	48.3	2.4e-32
AUI73833.1|497875_499021_-	hypothetical protein	NA	L0P7C2	Lactobacillus_phage	78.2	5.5e-170
AUI75221.1|499010_499424_-	hypothetical protein	NA	L0P6H1	Lactobacillus_phage	98.5	1.3e-68
AUI73834.1|499449_499794_-	hypothetical protein	NA	L0P6Y6	Lactobacillus_phage	100.0	9.0e-60
AUI75220.1|499766_500816_-	hypothetical protein	NA	L0P6D8	Lactobacillus_phage	92.6	9.5e-185
AUI73835.1|500830_501532_-	hypothetical protein	NA	L0P8M9	Lactobacillus_phage	93.1	2.4e-115
AUI73836.1|501535_504565_-	hypothetical protein	NA	L0P6G7	Lactobacillus_phage	91.2	1.1e-132
AUI73837.1|504814_505231_-	hypothetical protein	NA	L0P6Y3	Lactobacillus_phage	97.1	1.6e-66
AUI73838.1|505243_505717_-|tail	phage tail protein	tail	L0P6D4	Lactobacillus_phage	94.9	8.9e-82
AUI73839.1|505730_507188_-|tail	phage tail protein	tail	L0P8M7	Lactobacillus_phage	90.3	1.4e-247
AUI73840.1|507191_507395_-	hypothetical protein	NA	L0P7B3	Lactobacillus_phage	80.6	2.2e-21
AUI73841.1|507363_507789_-	hypothetical protein	NA	L0P6G4	Lactobacillus_phage	94.3	1.8e-73
AUI73842.1|507785_508187_-	hypothetical protein	NA	X2CXN4	Lactobacillus_phage	54.2	1.3e-38
AUI73843.1|508183_508546_-	hypothetical protein	NA	A9D9T8	Lactobacillus_prophage	65.8	1.9e-39
AUI73844.1|508542_508914_-	hypothetical protein	NA	L0P6D1	Lactobacillus_phage	89.4	4.5e-57
AUI73845.1|508930_510007_-|capsid	capsid protein	capsid	L0P8M2	Lactobacillus_phage	92.2	1.5e-185
AUI73846.1|510021_510561_-|capsid	phage capsid protein	capsid	L0P7B0	Lactobacillus_phage	93.9	2.0e-85
AUI73847.1|511009_512095_-|head	phage head morphogenesis protein	head	Q20DD6	Lactobacillus_phage	58.2	3.8e-120
AUI75222.1|512097_513549_-|portal	portal protein	portal	X2CY64	Lactobacillus_phage	67.9	3.0e-181
AUI73848.1|513554_514778_-|terminase	terminase	terminase	A9D9R9	Lactobacillus_prophage	58.0	7.8e-138
AUI73849.1|514779_515283_-|terminase	terminase	terminase	Q20DD9	Lactobacillus_phage	60.4	2.0e-47
AUI73850.1|515738_515960_-	hypothetical protein	NA	NA	NA	NA	NA
AUI73851.1|516834_517275_-	hypothetical protein	NA	L0P6G6	Lactobacillus_phage	91.1	2.2e-71
AUI73852.1|517392_517938_-	hypothetical protein	NA	NA	NA	NA	NA
AUI73853.1|517924_518119_-	hypothetical protein	NA	NA	NA	NA	NA
AUI73854.1|518108_518447_-	VRR-NUC domain protein	NA	L0P7E5	Lactobacillus_phage	81.1	1.6e-48
AUI73855.1|518490_518736_-	hypothetical protein	NA	NA	NA	NA	NA
AUI73856.1|519135_520449_-	hypothetical protein	NA	U3PCP1	Lactobacillus_phage	50.6	1.0e-111
AUI73857.1|520902_521706_-	DNA primase	NA	U3PBE3	Lactobacillus_phage	65.4	3.1e-87
AUI73858.1|521783_522086_-	hypothetical protein	NA	NA	NA	NA	NA
AUI73859.1|522102_522690_-	hypothetical protein	NA	U3PDN3	Lactobacillus_phage	48.7	1.8e-44
AUI73860.1|522692_523454_-	NTP-binding protein	NA	U3PIS9	Lactobacillus_phage	60.8	6.4e-74
AUI73861.1|523446_523650_-	transcriptional regulator	NA	D2IZX1	Enterococcus_phage	41.9	8.9e-07
AUI73862.1|523729_524047_+	hypothetical protein	NA	A0A1B0YA89	Lactobacillus_phage	37.3	1.7e-12
AUI73863.1|524043_524223_-	hypothetical protein	NA	NA	NA	NA	NA
AUI73864.1|524219_525491_-	DEAD/DEAH box helicase	NA	U3PFS7	Lactobacillus_phage	57.3	9.6e-131
AUI73865.1|525623_525968_-	hypothetical protein	NA	NA	NA	NA	NA
AUI73866.1|525970_526321_-	hypothetical protein	NA	NA	NA	NA	NA
AUI73867.1|526317_526794_-	hypothetical protein	NA	A0A2P0ZLB3	Lactobacillus_phage	38.4	2.2e-24
AUI73868.1|527003_527303_-	hypothetical protein	NA	NA	NA	NA	NA
AUI73869.1|527313_528120_-	antirepressor	NA	L0P8P6	Lactobacillus_phage	79.8	1.3e-112
AUI73870.1|528125_528335_-	transcriptional regulator	NA	NA	NA	NA	NA
AUI73871.1|528596_528944_+	transcriptional regulator	NA	E3W8B9	Leuconostoc_phage	46.9	1.6e-08
AUI73872.1|528948_529353_+	repressor	NA	F8J1D9	Lactobacillus_phage	41.9	7.2e-16
AUI75223.1|529722_530274_+	hypothetical protein	NA	A0A0F6N4L7	Staphylococcus_phage	33.9	2.3e-17
AUI73873.1|530435_531557_+|integrase	integrase	integrase	A0A0M9JJ77	Lactobacillus_phage	41.4	8.9e-72
AUI73874.1|532450_534136_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	31.4	6.0e-72
531583:531602	attR	TGTTGCACAAATGTTGCACA	NA	NA	NA	NA
AUI73875.1|534246_535158_+	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
AUI73876.1|535229_535748_+	DNA mismatch repair protein MutT	NA	NA	NA	NA	NA
AUI73877.1|535750_536020_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73878.1|536167_536452_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73879.1|536655_537834_+|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
AUI73880.1|537903_538125_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73881.1|538254_538524_+	transcriptional regulator	NA	NA	NA	NA	NA
AUI73882.1|538690_538945_+	AbrB family toxin-antitoxin system antitoxin	NA	NA	NA	NA	NA
AUI73883.1|539009_539324_+	transcriptional regulator	NA	NA	NA	NA	NA
AUI73884.1|541023_541245_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73885.1|541592_542012_-	DDE endonuclease	NA	NA	NA	NA	NA
AUI73886.1|542154_542640_-	hypothetical protein	NA	NA	NA	NA	NA
AUI73887.1|542782_543622_+	fatty acid-binding protein DegV	NA	A0A1X9I5J4	Streptococcus_phage	37.3	3.9e-48
AUI73888.1|543935_544118_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73889.1|544114_544813_+	hypothetical protein	NA	NA	NA	NA	NA
AUI75224.1|546241_546757_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73890.1|546753_546936_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUI73891.1|546946_547765_+	triphosphoribosyl-dephospho-CoA synthase	NA	NA	NA	NA	NA
AUI73892.1|547815_548163_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73893.1|548226_548979_-	aquaporin	NA	NA	NA	NA	NA
AUI73894.1|550035_550182_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AUI73895.1|550221_551079_-	RNA pseudouridine synthase	NA	NA	NA	NA	NA
AUI73896.1|551167_553225_+	carboxypeptidase	NA	NA	NA	NA	NA
AUI73897.1|553245_553596_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73898.1|553604_554825_+	phosphoesterase	NA	NA	NA	NA	NA
AUI73899.1|554805_557307_+	DNA repair protein	NA	NA	NA	NA	NA
AUI73900.1|557299_558277_+	3'-5' exonuclease	NA	NA	NA	NA	NA
AUI73901.1|558319_558742_-	hypothetical protein	NA	NA	NA	NA	NA
AUI73902.1|558880_559783_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AUI73903.1|559901_560237_-	hypothetical protein	NA	NA	NA	NA	NA
AUI73904.1|560246_560684_-	diadenosine tetraphosphate hydrolase	NA	D7NW73	Streptomyces_phage	34.9	7.1e-09
AUI73905.1|560895_561162_+	addiction module toxin RelE	NA	NA	NA	NA	NA
AUI73906.1|561178_561514_+	addiction module antidote protein, HigA family	NA	NA	NA	NA	NA
AUI73907.1|561528_562272_+	multidrug ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.1	1.1e-20
AUI73908.1|562264_563452_+	ABC transporter permease	NA	NA	NA	NA	NA
AUI73909.1|563463_564117_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AUI73910.1|564187_564508_+	thiol reductase thioredoxin	NA	NA	NA	NA	NA
AUI73911.1|564527_565175_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
AUI73912.1|565226_566534_-	hypothetical protein	NA	NA	NA	NA	NA
AUI73913.1|568235_568433_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73914.1|568540_569149_+	resolvase	NA	A0A1V0SJI5	Klosneuvirus	42.0	5.2e-34
AUI73915.1|569178_570504_+|transposase	transposase	transposase	G3MB42	Bacillus_virus	36.3	7.3e-57
AUI75225.1|570868_571255_+	permease	NA	NA	NA	NA	NA
AUI73916.1|571592_576563_+	peptidase S8	NA	A0A2P0VP02	Tetraselmis_virus	27.3	2.6e-06
AUI73917.1|576690_577968_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.4	8.6e-47
AUI73918.1|578199_579477_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.4	3.3e-46
AUI73919.1|579612_580848_-	hypothetical protein	NA	A0A1B1P773	Bacillus_phage	47.3	9.8e-56
AUI73920.1|580903_581548_-	hypothetical protein	NA	NA	NA	NA	NA
AUI73921.1|581582_582215_-	aggregation promoting protein	NA	A0A0E3XCL7	Enterococcus_phage	62.2	4.1e-18
AUI73922.1|582787_583240_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73923.1|583394_584708_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
AUI73924.1|584762_585740_-	cell surface protein	NA	NA	NA	NA	NA
AUI73925.1|585828_587343_-	aminopeptidase	NA	NA	NA	NA	NA
AUI73926.1|587480_588458_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 7
CP015496	Lactobacillus helveticus strain FAM8105 chromosome, complete genome	2209387	611452	669044	2209387	transposase,protease,tRNA	Tupanvirus(23.08%)	53	NA	NA
AUI73942.1|611452_613387_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	33.2	3.6e-97
AUI73943.1|614199_614730_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73944.1|614920_615529_+	resolvase	NA	A0A1V0SJI5	Klosneuvirus	43.2	4.0e-34
AUI73945.1|615558_616884_+|transposase	transposase	transposase	G3MB42	Bacillus_virus	36.3	2.8e-56
AUI73946.1|618088_618382_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73947.1|618388_619639_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73948.1|620195_621434_+	aryl-sulfate sulfotransferase	NA	NA	NA	NA	NA
AUI73949.1|621678_622158_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	38.4	6.8e-13
AUI73950.1|622179_622380_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AUI73951.1|622423_622780_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AUI73952.1|622925_623450_+	HAD family hydrolase	NA	NA	NA	NA	NA
AUI73953.1|623442_624552_+	ribosome biogenesis GTPase YqeH	NA	NA	NA	NA	NA
AUI73954.1|624562_625237_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
AUI73955.1|625217_625811_+	HD domain-containing protein	NA	NA	NA	NA	NA
AUI73956.1|625832_626180_+	ribosome silencing factor	NA	NA	NA	NA	NA
AUI73957.1|626185_627337_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73958.1|627338_627893_+	DNA-binding protein	NA	NA	NA	NA	NA
AUI73959.1|628055_628772_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	30.1	1.8e-25
AUI73960.1|628758_630318_+	two-component sensor histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	32.2	4.2e-11
AUI73961.1|630420_631785_+	SlpX	NA	NA	NA	NA	NA
AUI73962.1|632404_633682_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.4	3.1e-44
AUI73963.1|633859_634348_-|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
AUI73964.1|634395_635364_-	insertase	NA	NA	NA	NA	NA
AUI73965.1|635410_635683_-	acylphosphatase	NA	NA	NA	NA	NA
AUI73966.1|635780_636548_+	rRNA methyltransferase	NA	NA	NA	NA	NA
AUI73967.1|636659_637010_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUI73968.1|637294_638344_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.3	5.3e-34
AUI73969.1|638347_640762_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AUI73970.1|640838_641315_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
AUI73971.1|641377_642292_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
AUI75226.1|642413_642821_+	addiction module toxin RelE	NA	NA	NA	NA	NA
AUI75227.1|642813_643086_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUI75228.1|643144_643375_-|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	55.9	3.0e-11
AUI73972.1|645881_646805_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AUI73973.1|646950_648129_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
AUI73974.1|648292_650884_-	ABC transporter permease	NA	NA	NA	NA	NA
AUI73975.1|650974_653083_+	cell division protein FtsI	NA	NA	NA	NA	NA
AUI73976.1|653159_653309_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AUI73977.1|653357_653918_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
AUI73978.1|653938_654619_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AUI73979.1|654619_654847_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73980.1|654905_655307_+	sulfurtransferase	NA	NA	NA	NA	NA
AUI73981.1|655385_656306_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AUI73982.1|656370_656790_+	DDE endonuclease	NA	NA	NA	NA	NA
AUI73983.1|658068_659406_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
AUI73984.1|660517_661423_+	ABC transporter	NA	NA	NA	NA	NA
AUI75229.1|661523_662522_+	hypothetical protein	NA	NA	NA	NA	NA
AUI73985.1|662857_663073_-	hypothetical protein	NA	A0A2I6AZV9	Macacine_betaherpesvirus	42.9	3.3e-12
AUI73986.1|663149_663455_-	hypothetical protein	NA	NA	NA	NA	NA
AUI73987.1|664092_665085_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	39.9	1.4e-52
AUI73988.1|665189_666146_-	beta-galactosidase	NA	NA	NA	NA	NA
AUI73989.1|666129_668016_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	33.5	5.3e-93
AUI73990.1|668240_669044_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
CP015496	Lactobacillus helveticus strain FAM8105 chromosome, complete genome	2209387	705781	757858	2209387	transposase	Corynebacterium_phage(50.0%)	33	NA	NA
AUI74014.1|705781_706960_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
AUI74015.1|708769_709999_+	MFS transporter	NA	NA	NA	NA	NA
AUI74016.1|710071_711946_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
AUI74017.1|712078_713485_-|transposase	transposase	transposase	NA	NA	NA	NA
AUI74018.1|715706_716324_+	PepQ protein	NA	NA	NA	NA	NA
AUI74019.1|716326_716908_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74020.1|717568_718975_+|transposase	transposase	transposase	NA	NA	NA	NA
AUI74021.1|719095_720274_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
AUI74022.1|721091_722258_+	galactokinase	NA	NA	NA	NA	NA
AUI74023.1|722279_723743_+	galactose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
AUI74024.1|723863_724859_+	galactose mutarotase	NA	NA	NA	NA	NA
AUI74025.1|724979_725420_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74026.1|725654_726356_+|transposase	transposase	transposase	NA	NA	NA	NA
AUI74027.1|728219_729392_+	MFS transporter permease	NA	NA	NA	NA	NA
AUI74028.1|729410_729818_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74029.1|729837_730542_+	oxidoreductase	NA	NA	NA	NA	NA
AUI74030.1|731515_732793_+|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.4	8.6e-47
AUI74031.1|734068_734575_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74032.1|734849_736028_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
AUI74033.1|736111_737587_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74034.1|737647_738925_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.1	4.3e-46
AUI74035.1|739187_742400_+	type I restriction-modification system endonuclease	NA	A0A097BY72	Enterococcus_phage	27.5	3.1e-08
AUI74036.1|742420_743875_+	SAM-dependent methyltransferase	NA	A0A220A2U4	Liberibacter_phage	26.4	1.6e-25
AUI75233.1|745344_745959_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74037.1|746041_747286_+	Fe-S cluster assembly protein HesB	NA	NA	NA	NA	NA
AUI74038.1|747525_748710_+	hypothetical protein	NA	NA	NA	NA	NA
AUI75234.1|750378_750999_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74039.1|753833_754076_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74040.1|754097_754487_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74041.1|754641_754968_-	DNA methyltransferase	NA	NA	NA	NA	NA
AUI74042.1|754969_755854_-	L-serine dehydratase, iron-sulfur-dependent subunit alpha	NA	NA	NA	NA	NA
AUI74043.1|755868_756531_-	serine dehydratase	NA	NA	NA	NA	NA
AUI74044.1|756679_757858_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
>prophage 9
CP015496	Lactobacillus helveticus strain FAM8105 chromosome, complete genome	2209387	800482	923840	2209387	transposase,protease,integrase,tRNA	Streptococcus_phage(13.89%)	99	793603:793618	923917:925514
793603:793618	attL	ATCAACATCATCAATT	NA	NA	NA	NA
AUI74078.1|800482_801532_+|integrase	integrase	integrase	H7BWC8	unidentified_phage	35.4	1.4e-47
793603:793618	attL	ATCAACATCATCAATT	NA	NA	NA	NA
AUI74079.1|801655_802504_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	43.1	2.5e-42
AUI74080.1|802493_803837_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	30.2	7.4e-33
AUI74081.1|803839_804082_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
AUI74082.1|804084_804954_+	geranyl transferase	NA	NA	NA	NA	NA
AUI74083.1|804954_805767_+	cell division protein FtsJ	NA	NA	NA	NA	NA
AUI74084.1|805777_807460_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AUI74085.1|808098_809505_+|transposase	transposase	transposase	NA	NA	NA	NA
AUI74086.1|809638_810253_+	guanylate kinase	NA	A0A0M5KCK5	Mollivirus	32.6	6.2e-11
AUI74087.1|810255_810480_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AUI74088.1|810530_812930_+	primosomal protein N'	NA	NA	NA	NA	NA
AUI74089.1|812961_813888_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	30.2	6.1e-10
AUI74090.1|813874_815203_+	16S rRNA (cytosine(967)-C(5))-methyltransferase	NA	NA	NA	NA	NA
AUI75236.1|815207_815963_+	serine/threonine protein phosphatase	NA	NA	NA	NA	NA
AUI74091.1|815952_817968_+	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	31.6	1.2e-21
AUI74092.1|817968_818859_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
AUI74093.1|818871_819522_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
AUI74094.1|819521_820208_+	thiamine pyrophosphokinase	NA	NA	NA	NA	NA
AUI74095.1|820249_820555_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74096.1|820661_820847_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
AUI74097.1|821002_821365_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74098.1|821386_823048_+	hypothetical protein	NA	NA	NA	NA	NA
AUI75237.1|823049_825080_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
AUI74099.1|825100_826102_+	phosphate acyltransferase	NA	NA	NA	NA	NA
AUI74100.1|826132_826375_+	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	56.1	8.1e-07
AUI74101.1|826496_827531_+	dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.2	7.8e-14
AUI74102.1|827534_828521_+	peptide ABC transporter substrate-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	5.5e-17
AUI74103.1|828523_829483_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AUI74104.1|829497_830427_+	peptide ABC transporter permease	NA	NA	NA	NA	NA
AUI74105.1|830631_832383_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUI74106.1|832580_833858_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.4	8.6e-47
AUI74107.1|835936_836623_+	ribonuclease III	NA	M4QMG4	Micromonas_pusilla_virus	32.0	1.2e-18
AUI74108.1|836638_840208_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
AUI74109.1|840208_841501_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
AUI74110.1|841543_842965_+	peptidase C69	NA	NA	NA	NA	NA
AUI74111.1|843161_843452_+	transcriptional regulator	NA	NA	NA	NA	NA
AUI74112.1|843518_844946_-	amino acid permease	NA	NA	NA	NA	NA
AUI75238.1|845596_846028_+|transposase	transposase	transposase	H7BWC8	unidentified_phage	36.9	1.1e-17
AUI74113.1|846142_846484_+	transcriptional regulator	NA	NA	NA	NA	NA
AUI74114.1|846488_847919_+	signal recognition particle protein	NA	D6PHS7	uncultured_phage	27.0	1.4e-05
AUI74115.1|848009_848282_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AUI74116.1|848350_848866_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AUI74117.1|848855_849575_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AUI74118.1|849687_850035_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AUI74119.1|850493_851900_+|transposase	transposase	transposase	NA	NA	NA	NA
AUI74120.1|852682_853468_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AUI74121.1|853496_854123_-	repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	53.6	8.9e-13
AUI75239.1|854289_854538_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74122.1|854600_854819_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74123.1|855117_856344_-|transposase	transposase	transposase	A0A1X9I619	Streptococcus_phage	37.9	1.5e-64
AUI74124.1|856584_857754_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.7	1.4e-43
AUI74125.1|858761_859940_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
AUI74126.1|860322_861513_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	57.9	1.2e-122
AUI74127.1|862573_862906_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74128.1|862948_864007_+	hypothetical protein	NA	A0A1B1P773	Bacillus_phage	43.9	2.2e-27
AUI74129.1|864113_864344_+|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	57.4	2.3e-11
AUI74130.1|865923_867867_+	peptidase M13	NA	NA	NA	NA	NA
865277:865292	attR	AATTGATGATGTTGAT	NA	NA	NA	NA
AUI74131.1|867924_869106_-	cyclopropane-fatty-acyl-phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	36.1	4.7e-47
865277:865292	attR	AATTGATGATGTTGAT	NA	NA	NA	NA
AUI74132.1|869160_869775_-	acyl-phosphate glycerol 3-phosphate acyltransferase	NA	NA	NA	NA	NA
AUI74133.1|869840_870872_+	methyltransferase	NA	NA	NA	NA	NA
AUI74134.1|871033_871807_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
AUI74135.1|871840_872866_+	translation elongation factor Ts	NA	NA	NA	NA	NA
AUI74136.1|873004_873730_+	UMP kinase	NA	NA	NA	NA	NA
AUI74137.1|873729_874287_+	ribosome recycling factor	NA	NA	NA	NA	NA
AUI74138.1|874289_875024_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	39.0	2.5e-22
AUI74139.1|875025_875841_+	CDP-diglyceride synthetase	NA	A0A2K9L268	Tupanvirus	31.4	3.0e-05
AUI74140.1|875851_877108_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
AUI74141.1|877150_878848_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AUI74142.1|878853_883170_+	PolC-type DNA polymerase III	NA	Q8W6C3	Saccharomonospora_phage	22.5	3.0e-27
AUI74143.1|883279_883756_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
AUI75240.1|883775_884957_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
AUI75241.1|884986_885262_+	DNA-binding protein	NA	NA	NA	NA	NA
AUI74144.1|885264_885576_+	50S ribosomal protein L7	NA	NA	NA	NA	NA
AUI74145.1|885580_888193_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.5	9.7e-21
AUI74146.1|888212_888578_+	ribosome-binding factor A	NA	NA	NA	NA	NA
AUI74147.1|888629_889523_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
AUI74148.1|889528_890491_+	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
AUI74149.1|890660_891710_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
AUI74150.1|891725_892325_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AUI74151.1|892342_894169_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.5	1.8e-143
AUI74152.1|894250_895405_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	32.9	1.9e-21
AUI74153.1|895879_897718_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.1	5.2e-21
AUI74154.1|897720_898410_+	class A sortase	NA	NA	NA	NA	NA
AUI74155.1|898530_900804_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	35.9	3.7e-77
AUI74156.1|900908_901436_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	39.7	2.5e-24
AUI74157.1|901579_902509_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	59.5	2.2e-100
AUI75242.1|902524_903241_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
AUI74158.1|905075_905573_+	lactocepin S-layer protein	NA	NA	NA	NA	NA
AUI74159.1|905726_907430_+|transposase	transposase	transposase	A0ZS58	Staphylococcus_virus	36.7	5.1e-87
AUI74160.1|907435_909709_-	proton-efflux P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	24.4	5.5e-44
AUI74161.1|909837_910692_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUI74162.1|912052_913231_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
AUI74163.1|916796_917333_+	holo-ACP synthase CitX	NA	NA	NA	NA	NA
AUI74164.1|917453_918620_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AUI74165.1|918799_919405_+	transcriptional regulator	NA	NA	NA	NA	NA
AUI74166.1|919571_920600_+|integrase	integrase	integrase	H7BUM7	unidentified_phage	32.4	5.3e-47
AUI74167.1|921149_922028_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74168.1|922129_922363_-	hypothetical protein	NA	A0A0M9JJ77	Lactobacillus_phage	55.3	6.0e-15
AUI74169.1|922433_923840_-|transposase	transposase	transposase	NA	NA	NA	NA
923917:925514	attR	CAAAGGATTTGAGCTTTTTTAATTAATTATTCAACTTACCGCAAAAAATTATACACTTAGATTCACAGTCGCAGAAGTAGGTGGCAGATCATTTTCTGCAGGATTGCCAAAAATGAATTTACATTTATTGGCTTTCAAGTCATTAAGTCGTTCAAGTAAAAAATCATTAACCTTGATTTTACGTATGGAACTTTTGTTTTTAGTTGGCCCTATTTTCTTACGTTGCCAACTCCATGATTTATTAATATCAATAATATTATTTGTAAAATCTATATCGCTCCATTGTAAGCCGGATATTTCACCTAATCTTGCACTAGTAAAAATAGCAGTGAGGATCATATGCCGTGATGGTGTATTAATATCTAGTTCATTAATAGTTGTTTGAGTTAATCTTTTGATTTCATCAACATTCAAGTAAGTCACAGCTAATTCTCTATCTTCATTACCATGAACTTGAACTTGCTTAGTAAAATCAGCGGATATAAGACCATCAATAATAGCTGAATTAACACAAGCTCTAACACTGCCATTCAATTTCTTTACAGTAACTGGAGCATGTTTCTTAGCTGTAAAATTAATAAATTCTTGGTACTTGGTTCTAGTTATATCTTTAATGGTTAAATCACCAAAATAATGCCTAACCAAATTTATTTCATAGTTGTATTTAGTACTGGTGGCAGGGGAGCAGTTAGGCTTCTTATAGGTTTCAAACCATTTCTGCATATAATCAGCAAAAACAGGATTCTTGGTAACATCTACACCTGAAATAGAAGCAGCTTCCATTTTAATTCCATATTGTTGAGCTTCAGCTTTGGTTTTAAAACCGCCCTTTGATTTTTGCTTGAGGACAGAAACATTTTTTTGCTTTTCTGGATCCCATTGATTTTCTCTCTTTGAAAATCTCACATACCAAGTTTTACCGCGTTTCTTAATTGAAGCCATAAAATACTCCTATTCTAGCCGTGGTTCTGCTACAATAAAAGGGCAGAGTCCAAGCGGCTTTGTTCATATATACCATCGCTATTGACGTAGGATGGTTGTTTAATTCAAATATATTCATAATATAAAGCTATTGGCGTAGCTCATTTAATTACTCACTTGCTGTTGGCGCAGTAGGTGAGTTTTTTGTTTTATTTTGGCAAATGATTTATTGCATATCTAGCTTGACTTGGTGTAAATCTTTCAACGCTTGAAGTTAATTGATCATAAATTGCATTTCTAGACATCTTTTCATTCTTTTGATAGCTCTTTGCTTTTTCTAATGCATTTTTATTCCAATTAGCTTGAACATGTTTAATAGCATAAGAAGCGGATTTTTTAGAAAATCCTTCCACTTCTGAAGTTAGTTGCTCATAGAGTCCTTGCTTGGACATATGCATATTATCAGAATAACTTTGAGCCTTATCTAGAGCATTTTGATATTCAACTGGAACATTAGCTTCTTCTTGGTCTTTCTTATTTTTGAACTTAAGTGTTACATAGTTGTAAGCAGGAACTAAGATATTTCCATCTTCATCATAAATTGTAATGAAGATATTTTTACCCTTTACATGATTTTCTTTAAGAGTCTTTTTAACTAAGGTATCAATGCTTTGACC	NA	NA	NA	NA
>prophage 10
CP015496	Lactobacillus helveticus strain FAM8105 chromosome, complete genome	2209387	967322	1084787	2209387	transposase,integrase,tRNA	Corynebacterium_phage(20.69%)	101	967389:967404	1030888:1030903
AUI74207.1|967322_968621_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	27.3	1.3e-47
967389:967404	attL	TGGTTAACAGATAAAA	NA	NA	NA	NA
AUI74208.1|968706_969351_+	DNA replication protein DnaD	NA	A0A0N7AE27	Bacillus_phage	36.0	4.2e-10
AUI74209.1|969352_969973_+	endonuclease III	NA	NA	NA	NA	NA
AUI74210.1|970188_972468_-	penicillin-binding protein	NA	NA	NA	NA	NA
AUI74211.1|972464_973097_-	Holliday junction resolvase RecU	NA	A0A2H4J3A4	uncultured_Caudovirales_phage	37.1	1.5e-20
AUI74212.1|973160_973730_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74213.1|973820_974237_+	cell division protein	NA	NA	NA	NA	NA
AUI75245.1|974700_975825_+	RNA methyltransferase	NA	NA	NA	NA	NA
AUI74214.1|977073_977406_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74215.1|977402_979079_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
AUI74216.1|979085_979550_+	signal peptidase II	NA	NA	NA	NA	NA
AUI75246.1|979542_980454_+	pseudouridine synthase	NA	NA	NA	NA	NA
AUI74217.1|980456_981512_+	carbamoyl phosphate synthase small subunit	NA	NA	NA	NA	NA
AUI74218.1|981515_984707_+	carbamoyl phosphate synthase large subunit	NA	NA	NA	NA	NA
AUI74219.1|984774_986469_-	hypothetical protein	NA	Q84500	Paramecium_bursaria_Chlorella_virus	40.0	3.2e-09
AUI74220.1|986617_987034_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUI74221.1|987109_987991_+	fatty acid-binding protein DegV	NA	A0A0N9SI50	Staphylococcus_phage	35.9	4.4e-10
AUI74222.1|988220_989399_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.8e-38
AUI74223.1|989573_990656_-	tyrosine recombinase XerS	NA	NA	NA	NA	NA
AUI74224.1|991171_991627_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74225.1|991633_992125_+	adenylate kinase	NA	NA	NA	NA	NA
AUI74226.1|992170_992779_-	DUF5052 domain-containing protein	NA	NA	NA	NA	NA
AUI74227.1|992985_993342_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74228.1|993406_993610_-	gametolysin	NA	NA	NA	NA	NA
AUI74229.1|994726_995905_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
AUI74230.1|996182_996428_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74231.1|997576_998755_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
AUI74232.1|1001009_1001363_+	transcriptional regulator	NA	NA	NA	NA	NA
AUI74233.1|1001392_1001977_-	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	44.6	8.2e-29
AUI74234.1|1002061_1002997_-	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
AUI74235.1|1003029_1003992_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AUI74236.1|1004142_1006599_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.3	3.0e-96
AUI74237.1|1006615_1008562_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	41.0	2.7e-116
AUI74238.1|1008658_1009285_+	acyl-phosphate glycerol 3-phosphate acyltransferase	NA	NA	NA	NA	NA
AUI74239.1|1009590_1010808_-	hypothetical protein	NA	A0A160DHD3	Gordonia_phage	27.8	7.2e-27
AUI74240.1|1010935_1011403_-	DNA starvation/stationary phase protection protein	NA	A0A291I9P0	Lactobacillus_phage	30.1	1.3e-13
AUI74241.1|1011491_1012010_-	GCN5 family acetyltransferase	NA	M1PSC3	Streptococcus_phage	37.8	1.9e-21
AUI74242.1|1012223_1013084_+	Sir2 silent information regulator family NAD-dependent deacetylase	NA	NA	NA	NA	NA
AUI74243.1|1013820_1014411_+	Sir2 silent information regulator family NAD-dependent deacetylase	NA	NA	NA	NA	NA
AUI74244.1|1015080_1015320_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74245.1|1015475_1016234_-	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
AUI74246.1|1016385_1016736_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74247.1|1017707_1018175_-	GCN5 family acetyltransferase	NA	NA	NA	NA	NA
AUI74248.1|1018331_1019738_+|transposase	transposase	transposase	NA	NA	NA	NA
AUI74249.1|1019845_1021186_+	glutathione reductase	NA	NA	NA	NA	NA
AUI74250.1|1021483_1021762_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AUI74251.1|1022018_1022639_-|integrase	integrase	integrase	A0A1J1J900	Escherichia_phage	32.3	2.5e-15
AUI74252.1|1022754_1023393_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74253.1|1023704_1024205_-	DNA methyltransferase	NA	A0A1S5PRR3	Streptococcus_phage	45.4	1.6e-33
AUI75247.1|1024316_1025237_-|integrase	integrase	integrase	A0A0C5AC89	Paenibacillus_phage	39.2	1.6e-34
AUI74254.1|1025317_1025605_-|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	45.1	6.1e-09
AUI74255.1|1025586_1025946_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74256.1|1026167_1027028_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUI75248.1|1027039_1027780_-	glutamine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.2	4.1e-33
AUI74257.1|1027789_1028464_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUI74258.1|1028444_1029104_-	polar amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUI74259.1|1029478_1029847_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AUI74260.1|1030435_1030972_-	phosphohydrolase	NA	NA	NA	NA	NA
1030888:1030903	attR	TTTTATCTGTTAACCA	NA	NA	NA	NA
AUI74261.1|1030983_1032075_-	dihydropteroate synthase	NA	NA	NA	NA	NA
AUI74262.1|1032064_1033399_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AUI74263.1|1033382_1034456_-	GTP cyclohydrolase I	NA	A0A2I7S8W4	Vibrio_phage	41.2	1.8e-34
AUI74264.1|1034452_1034803_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AUI74265.1|1035233_1035887_+	endonuclease III	NA	NA	NA	NA	NA
AUI74266.1|1035952_1036228_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74267.1|1036405_1036843_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
AUI74268.1|1036844_1037258_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74269.1|1037293_1037791_-	acetyltransferase	NA	NA	NA	NA	NA
AUI74270.1|1037794_1039378_-	ATPase	NA	NA	NA	NA	NA
AUI74271.1|1039344_1039557_+	transcriptional regulator	NA	NA	NA	NA	NA
AUI74272.1|1039592_1042331_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
AUI74273.1|1042469_1043876_-|transposase	transposase	transposase	NA	NA	NA	NA
AUI74274.1|1044642_1044882_+|transposase	transposase	transposase	NA	NA	NA	NA
AUI74275.1|1044921_1045935_-	serine hydrolase	NA	NA	NA	NA	NA
AUI74276.1|1046136_1047540_+	dipeptidase PepV	NA	NA	NA	NA	NA
AUI74277.1|1047593_1048829_-	hypothetical protein	NA	A0A1B1P773	Bacillus_phage	47.3	9.8e-56
AUI74278.1|1048898_1050278_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
AUI74279.1|1050660_1050996_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74280.1|1052029_1052269_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74281.1|1053799_1054351_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74282.1|1054485_1054716_-	replication-associated protein RepA	NA	NA	NA	NA	NA
AUI74283.1|1054879_1055413_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	23.9	1.7e-09
AUI74284.1|1057032_1057227_-	hypothetical protein	NA	A0A2K5B2C5	Erysipelothrix_phage	76.0	1.9e-14
AUI75249.1|1057318_1058566_-	DNA replication initiation protein	NA	NA	NA	NA	NA
AUI74285.1|1061271_1062432_-	amidohydrolase	NA	NA	NA	NA	NA
AUI74286.1|1062569_1063748_+|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.8e-38
AUI74287.1|1064536_1065883_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
AUI74288.1|1066164_1066530_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
AUI74289.1|1066667_1068074_-|transposase	transposase	transposase	NA	NA	NA	NA
AUI74290.1|1068315_1070262_+	peptidase M13	NA	E3T4I7	Cafeteria_roenbergensis_virus	28.8	3.0e-59
AUI74291.1|1070448_1072341_-	hypothetical protein	NA	Q6SEF9	Lactobacillus_prophage	50.5	2.0e-15
AUI74292.1|1072400_1074887_-	TIGR02687 family protein	NA	NA	NA	NA	NA
AUI74293.1|1075071_1075461_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74294.1|1075528_1076707_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
AUI74295.1|1076866_1077304_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74296.1|1077452_1079033_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74297.1|1079140_1079857_-	antibiotic transporter permease	NA	NA	NA	NA	NA
AUI74298.1|1079856_1080591_-	multidrug ABC transporter permease	NA	NA	NA	NA	NA
AUI74299.1|1080594_1081356_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.7	1.1e-22
AUI74300.1|1081367_1081580_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74301.1|1081858_1083265_+|transposase	transposase	transposase	NA	NA	NA	NA
AUI74302.1|1083608_1084787_+|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
>prophage 11
CP015496	Lactobacillus helveticus strain FAM8105 chromosome, complete genome	2209387	1100440	1159891	2209387	transposase,bacteriocin,integrase,tRNA	Corynebacterium_phage(23.08%)	51	1121209:1121225	1155208:1155224
AUI74316.1|1100440_1101619_+|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.8e-38
AUI74317.1|1101927_1102395_-	regulator	NA	NA	NA	NA	NA
AUI74318.1|1102592_1102892_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74319.1|1104293_1104641_-	addiction module toxin RelE	NA	NA	NA	NA	NA
AUI74320.1|1104640_1104919_-	prevent-host-death family protein	NA	NA	NA	NA	NA
AUI74321.1|1108744_1109236_-	DUF5067 domain-containing protein	NA	NA	NA	NA	NA
AUI74322.1|1109345_1109705_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74323.1|1110095_1110719_-	ADP-ribose pyrophosphatase	NA	NA	NA	NA	NA
AUI74324.1|1110721_1111483_-	phosphorylase	NA	F5CA76	Streptococcus_phi-m46.1-like_phage	45.3	1.1e-36
AUI74325.1|1111498_1111918_-	cytidine deaminase	NA	NA	NA	NA	NA
AUI74326.1|1112181_1112658_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AUI74327.1|1112747_1113185_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74328.1|1113364_1114543_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	57.5	8.3e-121
AUI74329.1|1114653_1115364_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AUI74330.1|1115452_1116634_+	permease	NA	NA	NA	NA	NA
AUI74331.1|1116699_1117281_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74332.1|1117370_1117988_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74333.1|1118250_1118796_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74334.1|1119384_1119762_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74335.1|1119774_1120515_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74336.1|1120521_1122105_-	ABC transporter permease	NA	W8CYL7	Bacillus_phage	23.5	5.7e-16
1121209:1121225	attL	ATTATTCATCAAATTAT	NA	NA	NA	NA
AUI74337.1|1122094_1123699_-|bacteriocin	bacteriocin ABC transporter	bacteriocin	W8CYL7	Bacillus_phage	26.7	2.6e-16
AUI74338.1|1123918_1125196_+|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.4	8.6e-47
AUI74339.1|1125341_1125692_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74340.1|1125994_1126234_-	hypothetical protein	NA	NA	NA	NA	NA
AUI75250.1|1126233_1126446_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74341.1|1126451_1127738_-	peptidase T	NA	NA	NA	NA	NA
AUI74342.1|1127896_1129231_+	MATE family efflux transporter	NA	NA	NA	NA	NA
AUI74343.1|1129279_1130485_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74344.1|1130566_1131124_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74345.1|1131130_1131892_-	pyridoxal kinase	NA	NA	NA	NA	NA
AUI74346.1|1131924_1133103_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.6	2.3e-38
AUI74347.1|1133398_1134496_-	penicillin-binding protein	NA	NA	NA	NA	NA
AUI74348.1|1134620_1135235_-	acetyltransferase	NA	NA	NA	NA	NA
AUI74349.1|1135335_1135968_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74350.1|1136196_1136646_-	transcriptional regulator	NA	NA	NA	NA	NA
AUI74351.1|1136873_1138052_+|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
AUI74352.1|1138134_1139907_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	38.6	2.9e-77
AUI75251.1|1141392_1142019_+	potassium transporter Trk	NA	NA	NA	NA	NA
AUI74353.1|1142085_1143345_-	aluminum resistance protein	NA	NA	NA	NA	NA
AUI74354.1|1143361_1145458_-	ornithine decarboxylase	NA	NA	NA	NA	NA
AUI74355.1|1146655_1147096_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74356.1|1147121_1148528_-|transposase	transposase	transposase	NA	NA	NA	NA
AUI74357.1|1150361_1150739_-	camphor resistance protein CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	33.6	1.6e-09
AUI74358.1|1150740_1151124_-	chromosome condensation protein CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	36.5	3.1e-08
AUI74359.1|1152784_1153600_+|integrase	integrase	integrase	NA	NA	NA	NA
AUI74360.1|1154667_1155567_-	aldose epimerase	NA	NA	NA	NA	NA
1155208:1155224	attR	ATTATTCATCAAATTAT	NA	NA	NA	NA
AUI74361.1|1155719_1157123_-	HslU--HslV peptidase ATPase subunit	NA	A0A1B2IB03	Erwinia_phage	25.3	9.8e-28
AUI74362.1|1157133_1157658_-	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
AUI74363.1|1157666_1158575_-	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	36.2	5.8e-21
AUI74364.1|1158574_1159891_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
>prophage 12
CP015496	Lactobacillus helveticus strain FAM8105 chromosome, complete genome	2209387	1196938	1343926	2209387	transposase,protease,tRNA	Corynebacterium_phage(16.67%)	115	NA	NA
AUI74399.1|1196938_1197796_-|transposase	transposase	transposase	NA	NA	NA	NA
AUI74400.1|1197872_1198235_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74401.1|1198248_1198839_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74402.1|1199056_1199572_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74403.1|1200282_1201218_-	restriction endonuclease	NA	NA	NA	NA	NA
AUI74404.1|1202418_1203015_+	alkaline phosphatase	NA	NA	NA	NA	NA
AUI74405.1|1203121_1204507_+	amino acid permease	NA	NA	NA	NA	NA
AUI74406.1|1207824_1208661_-	2,5-diketo-D-gluconic acid reductase	NA	NA	NA	NA	NA
AUI75253.1|1208832_1210026_-	DNA/pantothenate metabolism flavoprotein	NA	Q9HH70	Methanothermobacter_phage	32.4	1.7e-41
AUI74407.1|1210530_1211937_+|transposase	transposase	transposase	NA	NA	NA	NA
AUI74408.1|1212065_1213250_+	amino acid aminotransferase	NA	NA	NA	NA	NA
AUI74409.1|1213338_1215192_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SFI4	Hokovirus	34.5	3.1e-05
AUI74410.1|1215197_1216484_-|tRNA	histidine--tRNA ligase	tRNA	A0A1V0SLE3	Klosneuvirus	26.6	8.2e-29
AUI74411.1|1216845_1218252_-|transposase	transposase	transposase	NA	NA	NA	NA
AUI74412.1|1218398_1218836_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
AUI74413.1|1218835_1221076_-	GTP pyrophosphokinase	NA	A0A2I2L310	Orpheovirus	38.0	1.3e-10
AUI75254.1|1221090_1221453_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74414.1|1221508_1222456_-	ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AUI74415.1|1222516_1223026_+|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
AUI74416.1|1224683_1225862_+|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.8e-38
AUI74417.1|1226103_1226610_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74418.1|1226712_1228059_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74419.1|1229196_1229529_+	transporter	NA	A0A0P0I7G8	Lactobacillus_phage	43.6	4.4e-19
AUI74420.1|1229783_1230164_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74421.1|1230295_1230853_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74422.1|1230865_1232575_+	heme ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.0	2.6e-14
AUI74423.1|1232567_1233401_+	cobalt ABC transporter permease	NA	NA	NA	NA	NA
AUI74424.1|1233611_1234067_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74425.1|1235451_1236270_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74426.1|1236674_1238234_-	citrate lyase subunit alpha	NA	NA	NA	NA	NA
AUI74427.1|1238205_1239120_-	citrate lyase subunit beta	NA	NA	NA	NA	NA
AUI74428.1|1239120_1239414_-	citrate lyase acyl carrier protein	NA	NA	NA	NA	NA
AUI74429.1|1239403_1240456_-	[citrate (pro-3S)-lyase] ligase	NA	NA	NA	NA	NA
AUI74430.1|1240546_1241338_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUI74431.1|1241416_1242883_-	anion permease	NA	NA	NA	NA	NA
AUI74432.1|1243201_1244515_-	aminopeptidase	NA	NA	NA	NA	NA
AUI74433.1|1244612_1245146_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74434.1|1245168_1245882_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74435.1|1248273_1249200_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
AUI74436.1|1249514_1250162_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74437.1|1250231_1250546_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74438.1|1250614_1250860_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74439.1|1250856_1251693_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74440.1|1251727_1251895_-	mucus-binding protein	NA	NA	NA	NA	NA
AUI74441.1|1251942_1252245_-	mucus-binding protein	NA	NA	NA	NA	NA
AUI74442.1|1252231_1252918_-	mucus-binding protein	NA	NA	NA	NA	NA
AUI74443.1|1252914_1253235_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74444.1|1253529_1254906_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	32.1	2.9e-56
AUI74445.1|1254917_1256321_-	class II fumarate hydratase	NA	NA	NA	NA	NA
AUI74446.1|1256508_1256733_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74447.1|1258201_1258903_-	methionine ABC transporter permease	NA	NA	NA	NA	NA
AUI74448.1|1258895_1259957_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.1e-30
AUI74449.1|1259969_1260830_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUI74450.1|1261180_1263598_-	ATPase P	NA	M1HM40	Paramecium_bursaria_Chlorella_virus	26.5	1.9e-39
AUI74451.1|1264215_1264734_-	diacylglycerol kinase	NA	G3MBI7	Bacillus_virus	39.5	2.2e-25
AUI74452.1|1264748_1265705_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	60.5	3.6e-114
AUI74453.1|1266409_1267588_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
AUI74454.1|1268947_1270354_+|transposase	transposase	transposase	NA	NA	NA	NA
AUI74455.1|1270720_1271089_+	antitoxin HicB	NA	A0A1L2JY34	Aeribacillus_phage	39.4	3.6e-06
AUI74456.1|1271424_1272603_+|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
AUI74457.1|1273785_1274394_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74458.1|1274505_1276260_+|transposase	transposase	transposase	A0ZS58	Staphylococcus_virus	36.7	5.2e-87
AUI74459.1|1277281_1278568_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	51.7	2.3e-108
AUI74460.1|1278643_1279051_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74461.1|1279040_1279247_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74462.1|1279399_1279888_-	nitroreductase	NA	NA	NA	NA	NA
AUI74463.1|1281051_1282434_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AUI74464.1|1282433_1283375_+	PTS beta-glucoside transporter subunit IIC	NA	NA	NA	NA	NA
AUI74465.1|1283533_1284775_-|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	57.2	2.8e-119
AUI74466.1|1284951_1285380_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74467.1|1285525_1286248_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUI74468.1|1287242_1287947_-	ADP-ribose pyrophosphatase	NA	NA	NA	NA	NA
AUI74469.1|1289654_1291094_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	41.8	1.5e-95
AUI74470.1|1291090_1291645_+	isochorismatase	NA	G3MA16	Bacillus_virus	41.8	4.7e-34
AUI74471.1|1293787_1294423_+	transcriptional regulator	NA	NA	NA	NA	NA
AUI74472.1|1297107_1298037_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUI74473.1|1298115_1299510_+	hypothetical protein	NA	A0A1B1P773	Bacillus_phage	43.8	4.7e-54
AUI74474.1|1299570_1300086_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74475.1|1300808_1301987_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
AUI74476.1|1302070_1303684_+	beta-carotene 15,15'-monooxygenase	NA	NA	NA	NA	NA
AUI74477.1|1303728_1304289_-	ADP-ribose pyrophosphatase	NA	NA	NA	NA	NA
AUI74478.1|1305192_1306371_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
AUI74479.1|1306487_1306841_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74480.1|1306944_1308003_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUI74481.1|1308014_1309181_-	amino acid aminotransferase	NA	NA	NA	NA	NA
AUI74482.1|1309201_1309981_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
AUI74483.1|1309973_1310909_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
AUI74484.1|1310910_1312065_-	N-acetyldiaminopimelate deacetylase	NA	NA	NA	NA	NA
AUI74485.1|1312067_1312778_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
AUI74486.1|1312797_1314114_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
AUI74487.1|1314585_1315959_+	aspartate kinase	NA	NA	NA	NA	NA
AUI74488.1|1315951_1316956_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
AUI74489.1|1318737_1320474_+|transposase	transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	3.6e-88
AUI74490.1|1320438_1321029_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
AUI74491.1|1321018_1322293_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	55.4	5.1e-132
AUI74492.1|1322423_1323782_-	trigger factor	NA	NA	NA	NA	NA
AUI74493.1|1323932_1325123_-	translation elongation factor Tu	NA	A0A1V0SGC3	Hokovirus	26.9	1.8e-30
AUI74494.1|1325312_1326146_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74495.1|1326148_1327921_-	RNase J family beta-CASP ribonuclease	NA	NA	NA	NA	NA
AUI75255.1|1328077_1328347_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
AUI74496.1|1328545_1328803_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
AUI74497.1|1328863_1329850_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
AUI74498.1|1329846_1332135_-	DNA internalization-related competence protein ComEC/Rec2	NA	M1PSD2	Streptococcus_phage	34.9	2.7e-19
AUI74499.1|1332103_1332799_-	competence protein	NA	NA	NA	NA	NA
AUI74500.1|1332876_1333911_-	peptide-binding protein	NA	NA	NA	NA	NA
AUI74501.1|1333894_1334389_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	36.2	9.7e-23
AUI74502.1|1334391_1334940_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
AUI74503.1|1334936_1335281_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74504.1|1335277_1336459_-	cell division protein FtsW	NA	NA	NA	NA	NA
AUI74505.1|1336554_1338399_-	GTP-binding protein TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	41.5	3.6e-22
AUI75256.1|1338651_1339206_+	peptide deformylase	NA	NA	NA	NA	NA
AUI74506.1|1339556_1339778_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74507.1|1339784_1341464_+	ribonuclease J	NA	NA	NA	NA	NA
AUI74508.1|1342433_1342619_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74509.1|1342648_1343926_+|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.2	5.6e-46
>prophage 13
CP015496	Lactobacillus helveticus strain FAM8105 chromosome, complete genome	2209387	1347722	1528977	2209387	holin,transposase,tail,capsid,terminase,integrase,tRNA	Lactobacillus_phage(35.29%)	180	1336351:1336367	1404551:1404567
1336351:1336367	attL	CTAATAAAATATCTGAA	NA	NA	NA	NA
AUI74513.1|1347722_1348850_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AUI74514.1|1348857_1349199_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74515.1|1349246_1350404_-	cysteine desulfurase	NA	NA	NA	NA	NA
AUI74516.1|1350405_1351101_-	5'-methylthioadenosine nucleosidase	NA	NA	NA	NA	NA
AUI74517.1|1351118_1351427_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74518.1|1351429_1351999_-	ADP-ribose pyrophosphatase	NA	NA	NA	NA	NA
AUI74519.1|1352018_1352222_-	cold-shock protein	NA	NA	NA	NA	NA
AUI74520.1|1352221_1355005_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	27.9	1.2e-88
AUI74521.1|1355225_1356023_-	cell division protein DivIVA	NA	NA	NA	NA	NA
AUI74522.1|1355998_1356799_-	RNA-binding protein	NA	NA	NA	NA	NA
AUI74523.1|1356798_1357101_-	cell division protein	NA	NA	NA	NA	NA
AUI74524.1|1357100_1357538_-	cell division protein SepF	NA	NA	NA	NA	NA
AUI74525.1|1357555_1358875_-	cell division protein FtsZ	NA	NA	NA	NA	NA
AUI74526.1|1358889_1360248_-	cell division protein FtsA	NA	NA	NA	NA	NA
AUI75257.1|1360310_1361168_-	cell division protein FtsQ	NA	NA	NA	NA	NA
AUI74527.1|1361184_1362291_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
AUI74528.1|1362292_1363672_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
AUI74529.1|1363681_1364650_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
AUI74530.1|1366804_1367167_-	cell division protein FtsL	NA	NA	NA	NA	NA
AUI75258.1|1367180_1368128_-	16S rRNA (cytosine(1402)-N(4))-methyltransferase	NA	NA	NA	NA	NA
AUI74531.1|1368132_1368564_-	cell division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
AUI74532.1|1368759_1369938_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.0e-38
AUI74533.1|1370138_1370471_-	DUF3397 domain-containing protein	NA	NA	NA	NA	NA
AUI74534.1|1370740_1371280_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AUI74535.1|1371279_1372131_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AUI74536.1|1372176_1373181_-	rod shape-determining protein	NA	NA	NA	NA	NA
AUI74537.1|1373276_1373900_-	DNA repair protein RadC	NA	NA	NA	NA	NA
AUI74538.1|1373938_1374616_-	hydrolase	NA	NA	NA	NA	NA
AUI74539.1|1374605_1375880_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AUI74540.1|1375880_1378520_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	43.4	4.8e-161
AUI74541.1|1379046_1380225_+|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.0	7.4e-37
AUI74542.1|1380615_1381806_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	57.7	2.4e-123
AUI74543.1|1383905_1384832_-	bactoprenol glucosyl transferase	NA	V5USA4	Oenococcus_phage	49.3	1.7e-76
AUI74544.1|1384828_1385245_-	dolichyl-phosphate beta-D-mannosyltransferase	NA	NA	NA	NA	NA
AUI75259.1|1385791_1386055_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74545.1|1386228_1386939_-	16S rRNA pseudouridine(516) synthase	NA	NA	NA	NA	NA
AUI74546.1|1387116_1387431_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74547.1|1388553_1389354_-	hypothetical protein	NA	NA	NA	NA	NA
AUI75260.1|1389526_1390330_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74548.1|1390573_1391383_-	transcriptional regulator	NA	NA	NA	NA	NA
AUI74549.1|1391570_1392149_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74550.1|1392297_1393035_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74551.1|1393299_1394562_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74552.1|1394613_1395792_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
AUI74553.1|1396030_1396687_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74554.1|1396688_1397192_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74555.1|1397664_1397850_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74556.1|1398305_1399484_+|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.0e-38
AUI74557.1|1399666_1400716_-|integrase	integrase	integrase	H7BUM7	unidentified_phage	33.2	1.9e-47
AUI74558.1|1402964_1403414_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74559.1|1403385_1403727_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74560.1|1403782_1404640_-	hypothetical protein	NA	NA	NA	NA	NA
1404551:1404567	attR	TTCAGATATTTTATTAG	NA	NA	NA	NA
AUI74561.1|1404799_1405978_+|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.8e-38
AUI74562.1|1406012_1406753_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74563.1|1407362_1408541_+|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
AUI74564.1|1408562_1409222_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74565.1|1410439_1411249_-	transcriptional regulator	NA	NA	NA	NA	NA
AUI74566.1|1411265_1411847_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74567.1|1412097_1413375_+|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.2	5.6e-46
AUI74568.1|1413502_1413811_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74569.1|1414302_1414545_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74570.1|1414729_1415587_+|transposase	transposase	transposase	NA	NA	NA	NA
AUI75261.1|1415901_1416594_-	16S rRNA pseudouridine(516) synthase	NA	NA	NA	NA	NA
AUI74571.1|1416558_1416909_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74572.1|1417618_1418836_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
AUI74573.1|1418835_1419996_-	aminotransferase V	NA	NA	NA	NA	NA
AUI74574.1|1420088_1421798_-	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
AUI74575.1|1422005_1423412_+|transposase	transposase	transposase	NA	NA	NA	NA
AUI74576.1|1423694_1424306_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
AUI74577.1|1424396_1424864_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74578.1|1424863_1426177_+	recombinase RarA	NA	A0A127AWE7	Bacillus_phage	49.3	6.2e-101
AUI74579.1|1426476_1426758_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74580.1|1426825_1427290_+	universal stress protein UspA	NA	NA	NA	NA	NA
AUI74581.1|1427355_1428549_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
AUI74582.1|1428570_1428798_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74583.1|1429113_1430103_-	rod shape-determining protein	NA	NA	NA	NA	NA
AUI74584.1|1430186_1430417_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74585.1|1430480_1430921_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
AUI74586.1|1430932_1432372_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
AUI74587.1|1432394_1433357_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
AUI74588.1|1433367_1434879_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
AUI74589.1|1434893_1435442_-	ATP synthase F1 subunit delta	NA	NA	NA	NA	NA
AUI74590.1|1435441_1435951_-	ATP synthase F0 subunit B	NA	NA	NA	NA	NA
AUI75262.1|1436002_1436227_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74591.1|1436255_1436969_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
AUI74592.1|1437092_1437722_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AUI74593.1|1437805_1438807_-	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	38.1	1.2e-48
AUI74594.1|1438812_1439655_-	protein-(glutamine-N5) methyltransferase, release factor-specific	NA	NA	NA	NA	NA
AUI74595.1|1439647_1440736_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	44.6	1.4e-05
AUI74596.1|1440752_1441352_-	thymidine kinase	NA	C1KFH3	Lactobacillus_virus	50.8	2.4e-47
AUI74597.1|1441540_1442893_+	UDP-N-acetylmuramyl peptide synthase	NA	NA	NA	NA	NA
AUI74598.1|1443212_1444226_+	esterase	NA	NA	NA	NA	NA
AUI74599.1|1447205_1448546_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
AUI74600.1|1448621_1449236_-	antibiotic resistance protein VanZ	NA	NA	NA	NA	NA
AUI74601.1|1449360_1451532_+	alkaline phosphatase	NA	W6LM83	Streptococcus_phage	43.2	1.6e-149
AUI74602.1|1453034_1454492_-	two-component sensor histidine kinase	NA	A0A1X9VNV7	Mimivirus	25.9	3.8e-06
AUI74603.1|1454491_1455214_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.4	1.7e-36
AUI74604.1|1455213_1455606_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74605.1|1455640_1456606_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
AUI74606.1|1456698_1457856_-	plastocyanin	NA	NA	NA	NA	NA
AUI74607.1|1458989_1459232_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74608.1|1459487_1460381_-	lysin	NA	Q38373	Lactococcus_phage	55.3	6.4e-89
AUI74609.1|1460370_1460829_-|holin	phage holin	holin	NA	NA	NA	NA
AUI74610.1|1460825_1461023_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74611.1|1461035_1461431_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74612.1|1461551_1462133_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74613.1|1462263_1462890_-	hypothetical protein	NA	Q6SE68	Lactobacillus_prophage	38.1	1.4e-21
AUI74614.1|1462984_1464565_-	DUF2479 domain-containing protein	NA	NA	NA	NA	NA
AUI74615.1|1464524_1464761_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74616.1|1464769_1468222_-	endopeptidase	NA	B8R659	Lactobacillus_phage	27.3	3.2e-72
AUI74617.1|1468221_1469004_-|tail	phage tail protein	tail	Q9T1E6	Lactobacillus_phage	26.8	8.8e-18
AUI74618.1|1468993_1475572_-	hypothetical protein	NA	A0A0A7DMV4	Lactobacillus_phage	43.6	3.7e-117
AUI74619.1|1475571_1476219_-	hypothetical protein	NA	A8ASK5	Listeria_phage	30.6	2.2e-14
AUI74620.1|1476228_1476663_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74621.1|1476678_1477311_-|capsid	phage capsid protein	capsid	O03972	Lactobacillus_phage	49.6	1.5e-28
AUI74622.1|1477311_1477746_-|capsid	phage capsid protein	capsid	O03934	Lactobacillus_phage	36.5	1.8e-12
AUI74623.1|1477732_1478131_-|capsid	capsid protein	capsid	O03933	Lactobacillus_phage	36.5	1.7e-14
AUI74624.1|1478130_1478481_-|capsid	minor capsid protein	capsid	O03932	Lactobacillus_phage	38.8	3.1e-15
AUI74625.1|1478473_1478866_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74626.1|1478879_1479911_-	replication protein	NA	O03966	Lactobacillus_phage	61.1	5.4e-108
AUI74627.1|1479921_1480542_-	scaffolding protein	NA	X2CYF9	Lactobacillus_phage	26.4	1.1e-07
AUI74628.1|1480641_1480854_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74629.1|1480834_1481110_-	hypothetical protein	NA	NA	NA	NA	NA
AUI75263.1|1481099_1482233_-|capsid	minor capsid protein	capsid	U3PFU0	Lactobacillus_phage	50.4	2.2e-102
AUI74630.1|1482216_1483842_-|capsid	capsid protein	capsid	Q38341	Lactococcus_phage	53.4	1.3e-148
AUI74631.1|1483853_1485110_-|terminase	terminase	terminase	A4L7R3	Lactococcus_phage	63.9	4.2e-163
AUI74632.1|1485126_1485801_-|terminase	terminase	terminase	A0A1S5SAK3	Streptococcus_phage	46.1	3.7e-33
AUI74633.1|1485819_1486014_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74634.1|1486029_1486221_-	hypothetical protein	NA	L0P709	Lactobacillus_phage	63.6	2.9e-07
AUI74635.1|1486241_1486574_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74636.1|1487003_1487474_-	hypothetical protein	NA	A9D9Q7	Lactobacillus_prophage	35.0	2.8e-11
AUI74637.1|1487485_1487704_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74638.1|1487860_1488127_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74639.1|1488138_1488321_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74640.1|1488383_1488860_-	hypothetical protein	NA	L0P6G1	Lactobacillus_phage	91.7	3.9e-85
AUI74641.1|1488831_1489122_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74642.1|1489207_1490386_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
AUI75264.1|1490565_1491366_-	hypothetical protein	NA	L0P6I8	Lactobacillus_phage	98.9	2.0e-150
AUI74643.1|1491400_1492261_-	hypothetical protein	NA	L0P704	Lactobacillus_phage	92.4	1.9e-58
AUI74644.1|1492263_1492971_-	hypothetical protein	NA	X2CXM9	Lactobacillus_phage	48.0	3.8e-44
AUI74645.1|1492963_1493221_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74646.1|1493230_1493506_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74647.1|1493735_1493969_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74648.1|1493978_1494293_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74649.1|1494252_1494495_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74650.1|1494506_1495220_-	antirepressor	NA	A0A0A7DN29	Lactobacillus_phage	55.2	7.4e-32
AUI74651.1|1495252_1495459_-	transcriptional regulator	NA	NA	NA	NA	NA
AUI74652.1|1495624_1495978_+	hypothetical protein	NA	E9LUL4	Lactobacillus_phage	39.3	1.4e-10
AUI74653.1|1495986_1496388_+	hypothetical protein	NA	O48433	Lactobacillus_phage	44.7	3.7e-20
AUI74654.1|1496374_1497511_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74655.1|1497600_1498707_+	hypothetical protein	NA	Q6SEG4	Lactobacillus_prophage	45.1	5.8e-84
AUI74656.1|1499215_1500400_-	acetate kinase	NA	NA	NA	NA	NA
AUI74657.1|1500448_1501450_-	DNA methyltransferase	NA	NA	NA	NA	NA
AUI74658.1|1501619_1502120_-	competence protein ComGF	NA	NA	NA	NA	NA
AUI74659.1|1502127_1502397_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74660.1|1502393_1502825_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
AUI74661.1|1502793_1503144_-	competence protein ComGC	NA	NA	NA	NA	NA
AUI75265.1|1503155_1504157_-	type II secretion system protein F	NA	NA	NA	NA	NA
AUI74662.1|1504125_1505100_-	competence protein	NA	NA	NA	NA	NA
AUI74663.1|1505247_1505976_-	transcriptional regulator	NA	NA	NA	NA	NA
AUI74664.1|1506066_1506582_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74665.1|1506676_1506862_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
AUI74666.1|1506959_1508150_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	56.4	1.2e-119
AUI74667.1|1509926_1510883_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUI74668.1|1512557_1514579_-	PTS beta-glucoside transporter subunit EIIBCA	NA	NA	NA	NA	NA
AUI74669.1|1515761_1516916_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	38.1	4.4e-42
AUI74670.1|1516920_1517388_-	protein tyrosine phosphatase	NA	NA	NA	NA	NA
AUI74671.1|1517391_1518105_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74672.1|1518121_1518937_-	HAD family hydrolase	NA	NA	NA	NA	NA
AUI74673.1|1518946_1519762_-	HAD family hydrolase	NA	NA	NA	NA	NA
AUI74674.1|1519856_1521209_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AUI74675.1|1521239_1522199_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74676.1|1522195_1523038_-	TIGR00159 family protein	NA	NA	NA	NA	NA
AUI74677.1|1523095_1524169_-	spermidine/putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUI74678.1|1524165_1524981_-	spermidine/putrescine ABC transporter permease	NA	NA	NA	NA	NA
AUI74679.1|1524977_1525790_-	spermidine/putrescine ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	30.5	6.7e-13
AUI74680.1|1525779_1526883_-	spermidine/putrescine import ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	41.1	2.5e-34
AUI74681.1|1526942_1527839_-	UDP-N-acetylenolpyruvoylglucosamine reductase	NA	NA	NA	NA	NA
AUI74682.1|1527936_1528470_+	exonuclease	NA	M1PFD8	Streptococcus_phage	36.6	6.8e-22
AUI74683.1|1528476_1528977_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
>prophage 14
CP015496	Lactobacillus helveticus strain FAM8105 chromosome, complete genome	2209387	1555817	1603080	2209387	transposase,protease	Streptococcus_phage(27.27%)	40	NA	NA
AUI74702.1|1555817_1557002_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	58.8	8.9e-123
AUI74703.1|1557426_1558704_+|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.9	6.6e-47
AUI74704.1|1558801_1559821_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AUI74705.1|1559862_1560702_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AUI74706.1|1560694_1561663_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
AUI74707.1|1561679_1561958_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74708.1|1561965_1562964_-	peptide chain release factor 2	NA	NA	NA	NA	NA
AUI74709.1|1563149_1565549_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
AUI74710.1|1565688_1566234_-	ribosomal subunit interface protein	NA	NA	NA	NA	NA
AUI74711.1|1566314_1567010_-	competence protein	NA	NA	NA	NA	NA
AUI74712.1|1567006_1568293_-	competence protein ComF	NA	A0A1X9I5S6	Streptococcus_phage	43.8	2.9e-82
AUI74713.1|1568337_1569000_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	43.8	3.4e-39
AUI74714.1|1569026_1570184_-	undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
AUI74715.1|1570291_1571923_-	ribonuclease Y	NA	NA	NA	NA	NA
AUI74716.1|1572041_1573139_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	62.1	3.2e-119
AUI74717.1|1573322_1573883_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
AUI74718.1|1573905_1575024_-	transcriptional regulator	NA	NA	NA	NA	NA
AUI74719.1|1575091_1575820_-	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AUI74720.1|1575820_1577077_-	peptidase M16	NA	L7RBE7	Acanthamoeba_polyphaga_moumouvirus	29.1	1.5e-14
AUI74721.1|1577073_1578288_-|protease	protease	protease	NA	NA	NA	NA
AUI74722.1|1578274_1580692_-	cell division protein FtsK	NA	Q853W3	Mycobacterium_phage	48.0	1.7e-83
AUI74723.1|1580712_1581102_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74724.1|1581101_1581662_-	RNA methyltransferase	NA	NA	NA	NA	NA
AUI74725.1|1581712_1582912_-	AI-2E family transporter	NA	NA	NA	NA	NA
AUI74726.1|1583380_1586137_-	haloacid dehalogenase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	29.6	1.1e-75
AUI74727.1|1586289_1587318_+	3-carboxymuconate cyclase	NA	NA	NA	NA	NA
AUI74728.1|1587424_1588117_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74729.1|1590036_1590933_-	RNA pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	31.0	3.6e-07
AUI74730.1|1590916_1591729_-	NAD kinase	NA	NA	NA	NA	NA
AUI74731.1|1591725_1592358_-	GTP pyrophosphokinase	NA	NA	NA	NA	NA
AUI74732.1|1592481_1593096_+	adenylate cyclase	NA	NA	NA	NA	NA
AUI74733.1|1593174_1593792_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AUI74734.1|1594119_1595298_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
AUI74735.1|1596107_1596848_-	adaptor protein MecA	NA	NA	NA	NA	NA
AUI74736.1|1596939_1597338_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
AUI74737.1|1597569_1599303_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
AUI74738.1|1599302_1599569_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AUI74739.1|1599682_1599877_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74740.1|1600041_1600761_+|transposase	transposase	transposase	NA	NA	NA	NA
AUI74741.1|1600890_1603080_+|protease	Clp protease ClpE	protease	A0A1C3S747	Escherichia_phage	40.5	8.8e-124
>prophage 15
CP015496	Lactobacillus helveticus strain FAM8105 chromosome, complete genome	2209387	1610117	1677511	2209387	transposase	Streptococcus_phage(21.43%)	54	NA	NA
AUI74748.1|1610117_1610702_-|transposase	transposase	transposase	NA	NA	NA	NA
AUI74749.1|1610750_1611206_-|transposase	transposase	transposase	NA	NA	NA	NA
AUI74750.1|1611209_1611479_-|transposase	transposase	transposase	NA	NA	NA	NA
AUI74751.1|1613169_1613541_+|transposase	transposase	transposase	NA	NA	NA	NA
AUI75268.1|1613552_1613783_+|transposase	transposase	transposase	NA	NA	NA	NA
AUI74752.1|1613757_1615095_+|transposase	transposase	transposase	A0A218MNE7	uncultured_virus	26.7	1.7e-37
AUI74753.1|1615687_1618552_-	peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	27.0	1.9e-33
AUI74754.1|1618968_1620147_+|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.2	2.0e-37
AUI74755.1|1621337_1621544_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74756.1|1621625_1621910_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74757.1|1621948_1623112_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
AUI74758.1|1623111_1624323_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
AUI74759.1|1624322_1625483_-	3-ketoacyl-CoA thiolase	NA	NA	NA	NA	NA
AUI75269.1|1625716_1627045_-|transposase	transposase	transposase	A0A286QMQ9	Streptococcus_phage	41.3	3.5e-59
AUI74760.1|1627109_1628009_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	48.1	6.4e-73
AUI74761.1|1628070_1628994_-	ribonuclease BN-like family protein	NA	NA	NA	NA	NA
AUI74762.1|1629002_1629830_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
AUI74763.1|1629962_1631369_-|transposase	transposase	transposase	NA	NA	NA	NA
AUI74764.1|1631579_1632026_+	flavodoxin	NA	NA	NA	NA	NA
AUI74765.1|1632018_1632558_+	teichoic acid glycosylation protein	NA	NA	NA	NA	NA
AUI74766.1|1632581_1633724_-	UDP-N-acetylglucosamine 2-epimerase	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	30.3	5.5e-29
AUI75270.1|1633831_1634020_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74767.1|1634187_1635516_-	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
AUI74768.1|1635512_1636745_-	helicase	NA	A0A1B1IS59	uncultured_Mediterranean_phage	28.5	1.2e-34
AUI74769.1|1636744_1637449_-	lysozyme	NA	NA	NA	NA	NA
AUI75271.1|1638790_1639360_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	26.5	2.3e-07
AUI74770.1|1639466_1640828_-	hemolysin	NA	NA	NA	NA	NA
AUI74771.1|1641642_1641915_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74772.1|1642040_1642526_-	PTS glucose transporter subunit IIABC	NA	NA	NA	NA	NA
AUI74773.1|1647218_1648067_-	patatin family protein	NA	NA	NA	NA	NA
AUI74774.1|1648233_1649511_+|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.1	1.5e-46
AUI74775.1|1649609_1652009_-	phosphoketolase	NA	NA	NA	NA	NA
AUI74776.1|1652305_1653070_+	decarboxylase	NA	NA	NA	NA	NA
AUI74777.1|1653075_1653441_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74778.1|1653527_1653851_-	DNA methyltransferase	NA	NA	NA	NA	NA
AUI74779.1|1653850_1655254_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
AUI74780.1|1655246_1655708_-	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
AUI74781.1|1655694_1656933_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.8	4.7e-98
AUI74782.1|1656907_1658185_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
AUI74783.1|1658196_1658991_-	Fe-S cluster assembly ATPase SufC	NA	A0A1M7XV31	Cedratvirus	27.6	7.3e-12
AUI74784.1|1660043_1660862_+	sugar-phosphatase	NA	NA	NA	NA	NA
AUI74785.1|1660951_1661245_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74786.1|1662648_1662843_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74787.1|1663641_1664568_-	purine nucleosidase	NA	NA	NA	NA	NA
AUI74788.1|1664685_1666701_-	potassium transporter Kup	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	35.2	1.9e-64
AUI74789.1|1666761_1667454_-	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
AUI74790.1|1667453_1668380_-	ribokinase	NA	NA	NA	NA	NA
AUI74791.1|1668493_1669297_-	DUF4931 domain-containing protein	NA	NA	NA	NA	NA
AUI74792.1|1669517_1670924_+|transposase	transposase	transposase	NA	NA	NA	NA
AUI74793.1|1671078_1671348_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74794.1|1671360_1672704_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74795.1|1672852_1674154_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUI74796.1|1674352_1675630_+|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.4	1.6e-45
AUI74797.1|1676326_1677511_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	58.5	1.3e-121
>prophage 16
CP015496	Lactobacillus helveticus strain FAM8105 chromosome, complete genome	2209387	1681195	1756069	2209387	transposase,tRNA	Bacillus_phage(14.29%)	56	NA	NA
AUI74802.1|1681195_1682374_+|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
AUI74803.1|1684551_1685184_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.5	6.2e-38
AUI74804.1|1685214_1686123_-	MFS transporter	NA	NA	NA	NA	NA
AUI74805.1|1686781_1687960_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
AUI74806.1|1688122_1688701_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74807.1|1688868_1690638_-	multidrug ABC transporter permease	NA	W8CYL7	Bacillus_phage	28.5	1.4e-55
AUI74808.1|1690637_1692368_-	multidrug ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.7	2.9e-29
AUI74809.1|1692346_1692808_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUI74810.1|1692953_1693772_+	glutamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUI74811.1|1693814_1694483_-	GMP synthase	NA	NA	NA	NA	NA
AUI74812.1|1694495_1695287_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74813.1|1695443_1697066_-	ABC-F family ATPase	NA	A0A2K9L3Z8	Tupanvirus	24.9	1.4e-46
AUI74814.1|1697170_1698253_-	peptidase M42	NA	NA	NA	NA	NA
AUI74815.1|1698379_1699585_+	multidrug transporter	NA	NA	NA	NA	NA
AUI74816.1|1699608_1701078_-	MFS transporter	NA	NA	NA	NA	NA
AUI74817.1|1701368_1701899_+	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AUI74818.1|1701911_1703240_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	35.9	2.0e-62
AUI74819.1|1704162_1705353_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	57.7	3.1e-123
AUI74820.1|1707038_1708364_-|transposase	transposase	transposase	G3MB42	Bacillus_virus	35.8	4.0e-55
AUI74821.1|1708393_1709002_-	resolvase	NA	A0A1V0SJI5	Klosneuvirus	43.2	1.5e-33
AUI74822.1|1709104_1709605_-	acetyltransferase	NA	NA	NA	NA	NA
AUI74823.1|1709815_1711222_-|transposase	transposase	transposase	NA	NA	NA	NA
AUI74824.1|1712493_1712922_-	hypothetical protein	NA	NA	NA	NA	NA
AUI75272.1|1714862_1715642_+|transposase	transposase	transposase	W5R8L2	Staphylococcus_phage	37.5	1.3e-37
AUI74825.1|1715759_1716317_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74826.1|1716498_1716750_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74827.1|1716795_1717143_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AUI74828.1|1717216_1717678_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74829.1|1718920_1719172_+	hypothetical protein	NA	A0A1V0SHK8	Klosneuvirus	52.2	4.3e-11
AUI74830.1|1719545_1720331_+	hydrolase	NA	NA	NA	NA	NA
AUI74831.1|1720351_1721530_+	aspartate aminotransferase	NA	NA	NA	NA	NA
AUI74832.1|1721548_1722511_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AUI74833.1|1723980_1725333_-	23S rRNA (uracil-5-)-methyltransferase RumA	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	48.2	1.9e-116
AUI74834.1|1725698_1727075_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
AUI74835.1|1727111_1727453_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74836.1|1728670_1730077_+|transposase	transposase	transposase	NA	NA	NA	NA
AUI74837.1|1730217_1730922_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74838.1|1730994_1731648_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74839.1|1731714_1732635_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	25.8	2.7e-18
AUI74840.1|1732659_1734090_-|tRNA	aspartyl/glutamyl-tRNA amidotransferase subunit B	tRNA	NA	NA	NA	NA
AUI74841.1|1734094_1735534_-|tRNA	aspartyl/glutamyl-tRNA amidotransferase subunit A	tRNA	NA	NA	NA	NA
AUI74842.1|1735533_1735842_-|tRNA	asparaginyl/glutamyl-tRNA amidotransferase subunit C	tRNA	NA	NA	NA	NA
AUI75273.1|1735855_1736983_-	sex pheromone biosynthesis protein	NA	NA	NA	NA	NA
AUI74843.1|1737016_1739023_-	DNA ligase (NAD(+)) LigA	NA	A0A0K2QQN8	Ralstonia_phage	36.1	7.1e-104
AUI74844.1|1739063_1741301_-	ATP-dependent DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.5	5.2e-132
AUI74845.1|1741386_1742034_-	N-acetylmuramidase	NA	S5M633	Brevibacillus_phage	47.7	1.0e-27
AUI74846.1|1742271_1742742_-	SprT family protein	NA	NA	NA	NA	NA
AUI74847.1|1742729_1743428_-	glycosyl transferase	NA	NA	NA	NA	NA
AUI74848.1|1743430_1744861_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
AUI74849.1|1744865_1746020_-	CDP-glycerol--glycerophosphate glycerophosphotransferase	NA	NA	NA	NA	NA
AUI74850.1|1748958_1750200_-|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	57.4	5.3e-118
AUI74851.1|1750396_1751227_-	NAD(+) synthase	NA	G3MA24	Bacillus_virus	51.1	1.3e-67
AUI74852.1|1751223_1752702_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	47.6	1.3e-115
AUI74853.1|1752789_1753890_-	galactosyltransferase	NA	NA	NA	NA	NA
AUI74854.1|1753897_1754626_-	acetylglucosaminyldiphospho-UDP acetyl-beta-D-mannosaminyltransferase	NA	NA	NA	NA	NA
AUI74855.1|1754878_1756069_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	59.5	2.4e-128
>prophage 17
CP015496	Lactobacillus helveticus strain FAM8105 chromosome, complete genome	2209387	1768628	1829676	2209387	transposase,integrase	Corynebacterium_phage(38.46%)	50	1768492:1768551	1794411:1796009
1768492:1768551	attL	TCTAAGTGTATAATTTTTTGCGGTAAGTTGAATAATTAATTAAAAAAGCTCAAATCCTTT	NA	NA	NA	NA
AUI74862.1|1768628_1770035_+|transposase	transposase	transposase	NA	NA	NA	NA
AUI74863.1|1771186_1771579_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74864.1|1771789_1772968_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
AUI74865.1|1773051_1773270_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74866.1|1773368_1773767_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74867.1|1774072_1775314_-|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	58.3	4.3e-120
AUI74868.1|1775579_1776734_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
AUI74869.1|1776750_1777464_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUI74870.1|1777682_1777928_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74871.1|1778289_1779492_-|integrase	integrase	integrase	A0A1W6JQD3	Staphylococcus_phage	24.7	6.5e-12
AUI74872.1|1779555_1779750_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74873.1|1779795_1780839_-	replication initiation protein	NA	A0A2L0HGV8	Cattle_blood-associated_circovirus	32.2	1.2e-09
AUI74874.1|1780852_1781191_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74875.1|1781187_1781589_-	hypothetical protein	NA	NA	NA	NA	NA
AUI75276.1|1781785_1782157_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74876.1|1782379_1782724_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74877.1|1782720_1783794_-	cell division protein FtsK	NA	NA	NA	NA	NA
AUI74878.1|1783796_1784111_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74879.1|1784994_1786173_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
AUI74880.1|1787477_1791824_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74881.1|1794547_1795954_+|transposase	transposase	transposase	NA	NA	NA	NA
AUI74882.1|1796946_1798131_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	59.1	8.1e-124
1794411:1796009	attR	TCTAAGTGTATAATTTTTTGCGGTAAGTTGAATAATTAATTAAAAAAGCTCAAATCCTTTGAAATTGGACTTGAGCTCAAACAAAAAGACCAGTAGTCTGATGTTAACGAAAAAAACACATTAGAAGCTGGTCTTTTATGGAATCTATTATAACTGATATCGTAAAAATTATTAAGTCTGAAAATAATGTTATTGCCCGTGAAAAGGCATTAATGTGCTATTTCTTTGATCTGATTAGAGAATTGATGACAGCAGCACTAGAAGAAGTTGATGCCGGCTTAGTTGAAGAGACTAAAAAGCAAGGCTATCAGATCGAGAAGAAAAATAAGCGTTCAGTTGTGACTGCCTTTGGTGAAATCAGCTATTGGCGCAGAAGATATGCTTGTCCTGGCAAAAAGGCTAAATATCCACTGGATAAGCTGATGGGCTATGACAAATATAAGCGTTACAGTGTTTTGGCAGTGAAGGATATTTTGCAGGTTAGCGCCGTGGCAACTTACCGCAATACTGCTTTAGCTGTTAATACTCTCTCCTGTTTCAATATTAGCCATAGTCAAGTTGGCAAGCTGATTGTGCAAGCAGGCAAACAGATTAAAGTACAGCAGCAGTCTGAGGAAAGATACGATGGTATTACTCAAAAGAAAAAGGTGCCAGTGCTTTATCTTGAAGGCGATGGCGTTGTGATTAAAGGCACCAAGAAGCGACTGGAATTTCATCGCTATCAAGTCTGCGAGGATATTATTAATTTAAGCAAGACGCGCAGAAAGAGAGTACAGGCCAAAGAGTTTGTTTCTTTAAGCCGCTTGGATGCTTTACAAGAAATTAAAGCTTATTTAGCCAATACCTATGACTTAAGCGATACTTTAATCATCAGTAATGCCGATGGCGGTGCTGGCTATGCCAAGAAAGACTTTGATGAAATAGTTGGCTATTGCCGGCAGCACGAGCACTTCTTAGACGTCTTCCACTTGAACAAAAAGATTAAAGATCGTCTAAGCTTCATGCCACCCATGCCAGGCAAATTGATCAGTGCAGTTGAGTTTAAATATGACCGTCACTTAACTGATGTGATTTTAGACACGATTGAAAGCAATCTGATTGATGAGCTGAATACGCCAGAAAATCATGAGAATTTAAGGCGCCTGCGCAGCTATCTTCATCGTCGCTGGGTGGATATTAAGCCGTTTAAGATGCGTCATTTGTCAGTAATTAAGGCAATTGGCTGCTGTGAGAGCAATCACCGCAAGTATACTTATCGCGTCAAAGGGCAAGGAAAATACTGGTCAGAAGATGGTGCCGAAGGAATTCTGCGTGTGCTGACTTGCATTAAAAACAAAGAGCTGGAATACTGGCTAAGCAGTGAGTTTGCAGGTGGACAGCTCGATATTGGTGATCAGGAAGAATTGAAAGGTGCAGTTCGTGCCAGCCTAAGAAAGACGCATGAAGCTCATCTGGGCATTCATCACGGCGCCATTGAAAGCTTAACAGCAGGACATAGCTATTTAAACGATTTTAGCAGAAAAATAAATCAAATAAATATTTAAGAAATTAAGGTCAGACTAATGGTTAATAGCCTACCGCAAAAATATTGACACTTAC	NA	NA	NA	NA
AUI74883.1|1798258_1798459_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74884.1|1798484_1799030_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74885.1|1799279_1800458_+|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
AUI74886.1|1800611_1801361_+	TIGR02452 family protein	NA	G3MBH6	Bacillus_virus	32.1	5.6e-14
AUI74887.1|1801378_1801750_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74888.1|1801742_1801964_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74889.1|1802018_1803209_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	58.7	1.9e-125
AUI74890.1|1805015_1806293_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.4	8.6e-47
AUI74891.1|1807112_1807340_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74892.1|1808261_1809449_-	acetate kinase	NA	NA	NA	NA	NA
AUI74893.1|1809599_1810778_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
AUI75277.1|1811078_1811561_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74894.1|1811799_1812192_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74895.1|1812145_1812613_-	hypothetical protein	NA	NA	NA	NA	NA
AUI75278.1|1812594_1813197_+	amino acid permease	NA	NA	NA	NA	NA
AUI74896.1|1813707_1814001_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74897.1|1814074_1815886_-	glutamine--fructose-6-phosphate aminotransferase	NA	M1I1B8	Acanthocystis_turfacea_Chlorella_virus	34.5	9.6e-84
AUI74898.1|1816080_1818705_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
AUI74899.1|1819078_1820485_+|transposase	transposase	transposase	NA	NA	NA	NA
AUI74900.1|1820626_1822000_+	amino acid permease	NA	NA	NA	NA	NA
AUI74901.1|1822037_1822553_-	acetyltransferase	NA	NA	NA	NA	NA
AUI74902.1|1822628_1823807_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.2	3.3e-37
AUI74903.1|1824091_1824922_+	transcriptional regulator	NA	NA	NA	NA	NA
AUI74904.1|1824966_1825335_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74905.1|1825338_1826259_-	PTS mannose family transporter subunit IID	NA	NA	NA	NA	NA
AUI74906.1|1826287_1827100_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
AUI74907.1|1827118_1828129_-	PTS mannose transporter subunit EIIAB	NA	NA	NA	NA	NA
AUI74908.1|1828269_1829676_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 18
CP015496	Lactobacillus helveticus strain FAM8105 chromosome, complete genome	2209387	1838977	1912506	2209387	transposase,protease,integrase,tRNA	Corynebacterium_phage(23.53%)	55	1870882:1870941	1921088:1922688
AUI74911.1|1838977_1840285_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.8	1.4e-92
AUI74912.1|1840508_1841060_-	acetyltransferase	NA	NA	NA	NA	NA
AUI74913.1|1841059_1841668_-	hypothetical protein	NA	M1Q152	Streptococcus_phage	38.5	4.7e-35
AUI74914.1|1841797_1842595_+	esterase	NA	NA	NA	NA	NA
AUI74915.1|1842591_1842699_+	regulator	NA	NA	NA	NA	NA
AUI74916.1|1842750_1843452_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUI74917.1|1843535_1844918_+	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUI74918.1|1844963_1845998_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74919.1|1846261_1847962_+|transposase	transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	4.6e-88
AUI74920.1|1847965_1851502_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74921.1|1851506_1852079_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUI74922.1|1852214_1853165_-	serine hydrolase	NA	NA	NA	NA	NA
AUI74923.1|1853177_1854101_-	magnesium transporter CorA	NA	NA	NA	NA	NA
AUI74924.1|1854239_1855541_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUI74925.1|1855592_1856888_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AUI74926.1|1856871_1857696_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AUI74927.1|1857699_1858566_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AUI74928.1|1858565_1859651_-	sugar ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.9	9.3e-26
AUI74929.1|1859880_1861059_+|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
AUI74930.1|1861271_1862699_-	peptidase C69	NA	NA	NA	NA	NA
AUI74931.1|1862740_1863595_-	DNA nuclease	NA	NA	NA	NA	NA
AUI74932.1|1863685_1864639_-	DNA polymerase III subunit epsilon	NA	A0A0N9SJX9	Paenibacillus_phage	35.0	1.4e-06
AUI74933.1|1864647_1865469_-	Sir2 family NAD-dependent protein deacetylase	NA	NA	NA	NA	NA
AUI74934.1|1865735_1866977_-|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	57.2	6.3e-119
AUI74935.1|1867157_1867565_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74936.1|1867652_1868393_-	hypothetical protein	NA	A0A0A7NTY4	Lactobacillus_phage	83.1	6.8e-121
AUI74937.1|1869242_1870847_-	ABC transporter	NA	A0A285PWH2	Cedratvirus	24.9	1.2e-05
1870882:1870941	attL	CCTAAGTGTATAATTTTTTGCGGTAAGTTGAATAAATAATTAAAAAAGCTCAAATCCTTT	NA	NA	NA	NA
AUI74938.1|1871018_1872425_+|transposase	transposase	transposase	NA	NA	NA	NA
AUI74939.1|1872574_1873489_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
AUI74940.1|1873578_1874580_+	adenosine deaminase	NA	NA	NA	NA	NA
AUI74941.1|1874627_1875131_+	nucleoside 2-deoxyribosyltransferase	NA	K4I206	Lactobacillus_phage	29.3	1.4e-13
AUI74942.1|1875545_1875950_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74943.1|1876133_1877435_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUI74944.1|1877487_1878060_-	elongation factor P	NA	NA	NA	NA	NA
AUI74945.1|1878094_1879009_-	type I pantothenate kinase	NA	NA	NA	NA	NA
AUI74946.1|1879067_1879628_+	arylesterase	NA	NA	NA	NA	NA
AUI74947.1|1881174_1883481_-	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
AUI74948.1|1883630_1884317_+|protease	metalloprotease	protease	NA	NA	NA	NA
AUI74949.1|1884378_1885029_+	fructose-2,6-bisphosphatase	NA	A0A1X9IGJ2	Lactococcus_phage	31.3	1.4e-08
AUI74950.1|1885245_1887045_-	ABC transporter	NA	NA	NA	NA	NA
AUI74951.1|1887057_1887807_-	bacitracin ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.5	2.9e-34
AUI74952.1|1888157_1889336_+|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.0e-38
AUI74953.1|1889357_1890605_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74954.1|1890693_1891365_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74955.1|1891788_1892793_-	L-asparaginase 1	NA	NA	NA	NA	NA
AUI74956.1|1894856_1895363_+	transcriptional regulator	NA	NA	NA	NA	NA
AUI74957.1|1896555_1897431_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	50.3	7.1e-77
AUI74958.1|1897595_1899701_-	ornithine decarboxylase	NA	NA	NA	NA	NA
AUI74959.1|1899925_1901377_+	amino acid permease	NA	NA	NA	NA	NA
AUI74960.1|1904819_1906286_-	poly-gamma-glutamate biosynthesis protein	NA	NA	NA	NA	NA
AUI75279.1|1906309_1907257_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74961.1|1907469_1908648_+|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.2	3.3e-37
AUI74962.1|1909125_1910184_+|integrase	integrase	integrase	H7BUM7	unidentified_phage	32.7	1.1e-47
AUI74963.1|1910196_1911174_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74964.1|1911327_1912506_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.3e-36
1921088:1922688	attR	AAAGGATTTGAGCTTTTTTAATTATTTATTCAACTTACCGCAAAAAATTATACACTTAGGCAGATTTGCAGATTAAAATAGCCAAAATTTTTGGCTCTATAATTTTTCCTGTTGATGACTTATCTATATGATAAGCTGTTAACAGGTTTTTTATTGCATAAAAAAGGAGGACATAGTCCCCTGTAATAAAAAATCTATTCCATTAAACATTTTATAAATAAAGGTGTGTTTCTATGTCCTCTTTTAATAATTGTATTAAATTTGATCTTGATATTAAAGAAAAAAATATTGTTCTCAAAGACTATTTCTACAAAATGGTCCAGATGAAAAAGCACAAAATCTATGAAGCAGAATTGATTCAGCCTGCTTGTCCTTACTGTGGCTCCTTGGCTCTCCTGCATAATGGACATCTGGTTACCAACATTCGCTATTTAACAGCTAATGCAAGTTTGCCTGTCATTATCAGATTAGCTAAGCAACGAGTTAAATGTCGCGATTGTGATCACTGGTCCATGGCTCAATCTGAATTAGTAAACAAATACTGTTCTATTTCTAATGCTTCCAAGCTTAAAGTATTATCAGCTTTAACTGAAGACCGATCTATGACCAGCATTGCCAGAGAAAACAATGTTTCGATCAATACCGTCCAGAGAGTGCTGGGCAACTGTTCACACCGATTTATTGACAGCTGCGAATATTTGCCAGCTCATCTAGCTTTTGATGAGTTCAAAGGAGTCGACCGCCAGTTGCACTTTATCTGCTTGGATGGCGATAATCATCAGGTCGTTCAGATTCTTAGAACTCGCTACAAGAAGACGCTGCTTAAGTATTTTGGACGTTTTTCGCCCCAAGCTAGAGCTAACGTTAAGACGGTCACGATGGATCTTAATTTTTACTATCAAAATATCGTCAGAGCTTGTTTTCCTAACGCTCAGATTGTCATCGATCGTTTTCATATGATTCAAATGCTTACGCGTTCTTTCAACTCACTGAGAGTCCAAGTCATGAAGACCTTTGATAAAAGATCCAGACAGTATCAGCTGTTCAAATCTCCCTGGAAATTATACTTGAAGAAGTTTGATGAGCTTGAAAAAATTCATCCTCGCTACAACTGGCATTACAAAGACTGCTTAACTCAAGCACAAGTAGTTACAGAAGGCATTAACACCAGCACTGCTTTAGAGAATTCATATAACCTGATGCAAAGCTTTATTCAAGCCGTTGAAACTGGCAATACGCATGAGCTCAAATCGTTAATCAACTGCCAAGATCAAATTGGAACTTTAATGCACAAAACACTATTAACCTTTAAGCATAATCTAACAGCTGTGCTTAACGGAGCAGCTCTGCCTTATTCTAACGGCTGTCTTGAAGGCTTCAATCGCAAAATCAAACAAATCGAACGAACAGCTTTTGGCTATTCCAATTTTACCAATCTCTTAACCAGAATTCGTTTGGAAGAAGATCTGTACAAAGAAAAAGAACCAAACAGCCTTTTAATGACTGCCTGATTCTATTCATTTACTCTCTATCAACAGGATTTGACAAAGAGCCAAATTTTTTCTTTTTGCCAAGTGGCTGCCAATCTAGCTGCACATTGT	NA	NA	NA	NA
>prophage 19
CP015496	Lactobacillus helveticus strain FAM8105 chromosome, complete genome	2209387	1919603	1969746	2209387	transposase	Corynebacterium_phage(25.0%)	49	NA	NA
AUI74972.1|1919603_1921010_-|transposase	transposase	transposase	NA	NA	NA	NA
AUI74973.1|1921320_1922598_+|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.4	2.5e-46
AUI74974.1|1922608_1923400_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AUI74975.1|1923399_1924188_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AUI74976.1|1924198_1925086_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AUI74977.1|1925097_1926159_-	transcriptional regulator	NA	NA	NA	NA	NA
AUI74978.1|1926639_1927905_+	GTPase HflX	NA	NA	NA	NA	NA
AUI74979.1|1927926_1928940_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74980.1|1929150_1930083_-	hydrolase	NA	A0A0A8WIF2	Clostridium_phage	38.1	2.8e-15
AUI74981.1|1930230_1930476_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74982.1|1931110_1931887_-	hydrolase	NA	A0A1J0GW44	Streptomyces_phage	44.4	5.3e-15
AUI74983.1|1932104_1932467_-	ATPase	NA	NA	NA	NA	NA
AUI74984.1|1932803_1934366_-|transposase	transposase	transposase	NA	NA	NA	NA
AUI74985.1|1934319_1934970_-|transposase	transposase	transposase	A0A7Q0	Microcystis_virus	45.2	5.2e-40
AUI74986.1|1935035_1935356_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74987.1|1935403_1935613_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74988.1|1935707_1936892_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	58.8	2.0e-122
AUI74989.1|1937019_1937289_-	ATPase	NA	NA	NA	NA	NA
AUI74990.1|1937382_1937934_-	glycosidase	NA	M9MUG9	Rhodococcus_phage	42.1	1.5e-16
AUI74991.1|1938123_1938669_-	guanylate kinase	NA	NA	NA	NA	NA
AUI74992.1|1938763_1939063_+	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
AUI74993.1|1939155_1940661_+	hypothetical protein	NA	NA	NA	NA	NA
AUI74994.1|1940675_1941317_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74995.1|1941561_1942755_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	57.0	2.3e-118
AUI74996.1|1942838_1944017_+|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
AUI74997.1|1944388_1945567_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.2	3.3e-37
AUI74998.1|1945823_1946168_-	hypothetical protein	NA	NA	NA	NA	NA
AUI74999.1|1946280_1946817_-	hypothetical protein	NA	NA	NA	NA	NA
AUI75000.1|1946992_1948183_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	55.6	1.6e-116
AUI75001.1|1948472_1949750_+|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.4	8.6e-47
AUI75002.1|1949997_1950483_-	hypothetical protein	NA	NA	NA	NA	NA
AUI75003.1|1950485_1951256_-	hypothetical protein	NA	NA	NA	NA	NA
AUI75004.1|1951266_1952808_-	multidrug ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.2	1.1e-43
AUI75005.1|1952816_1953194_-	hypothetical protein	NA	NA	NA	NA	NA
AUI75006.1|1953358_1953883_+	ribosomal-protein-serine acetyltransferase	NA	NA	NA	NA	NA
AUI75007.1|1955755_1955980_-	hypothetical protein	NA	NA	NA	NA	NA
AUI75008.1|1956190_1957468_+|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.4	8.6e-47
AUI75009.1|1957518_1958760_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
AUI75010.1|1958891_1960070_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
AUI75011.1|1960311_1962108_+	oligoendopeptidase F	NA	NA	NA	NA	NA
AUI75012.1|1962431_1962689_+	hypothetical protein	NA	NA	NA	NA	NA
AUI75013.1|1962672_1962882_-	hypothetical protein	NA	NA	NA	NA	NA
AUI75014.1|1962909_1963350_+	hypothetical protein	NA	NA	NA	NA	NA
AUI75015.1|1963606_1964983_-	sodium:dicarboxylate symporter	NA	NA	NA	NA	NA
AUI75016.1|1965420_1966215_-	ABC transporter	NA	NA	NA	NA	NA
AUI75017.1|1966214_1966862_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.1	2.1e-17
AUI75018.1|1966893_1967811_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUI75019.1|1968073_1968346_-	transcriptional regulator	NA	NA	NA	NA	NA
AUI75020.1|1968567_1969746_+|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
>prophage 20
CP015496	Lactobacillus helveticus strain FAM8105 chromosome, complete genome	2209387	1996079	2037452	2209387	transposase	Corynebacterium_phage(12.5%)	34	NA	NA
AUI75046.1|1996079_1997405_-|transposase	transposase	transposase	G3MB42	Bacillus_virus	36.3	2.1e-56
AUI75047.1|1997434_1998043_-	resolvase	NA	A0A1V0SJI5	Klosneuvirus	43.2	2.0e-33
AUI75048.1|1998220_1998463_-	hypothetical protein	NA	NA	NA	NA	NA
AUI75049.1|1998564_1999977_+	dipeptidase	NA	NA	NA	NA	NA
AUI75050.1|2000021_2000696_-	peptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	1.7e-33
AUI75051.1|2000697_2001759_-	ABC transporter permease	NA	NA	NA	NA	NA
AUI75052.1|2001759_2002287_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUI75053.1|2002397_2002997_-	phosphoglycerate mutase	NA	NA	NA	NA	NA
AUI75054.1|2003152_2003908_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUI75055.1|2003904_2004666_-	hypothetical protein	NA	NA	NA	NA	NA
AUI75056.1|2004724_2005369_+	hypothetical protein	NA	NA	NA	NA	NA
AUI75057.1|2005813_2006992_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
AUI75058.1|2008830_2011365_-	peptidase	NA	A0A0P0IY26	Acinetobacter_phage	26.0	3.8e-70
AUI75059.1|2011590_2011950_+	aggregation promoting factor surface protein	NA	A0A0E3XCL7	Enterococcus_phage	67.1	1.5e-20
AUI75060.1|2012014_2013292_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.6	3.9e-47
AUI75283.1|2013483_2014434_-	cytochrome C5	NA	NA	NA	NA	NA
AUI75284.1|2014614_2015862_+	multidrug transporter	NA	NA	NA	NA	NA
AUI75061.1|2015993_2017178_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	59.6	3.6e-124
AUI75062.1|2017349_2017712_+	hypothetical protein	NA	NA	NA	NA	NA
AUI75063.1|2018408_2019587_+|transposase	transposase	transposase	A0A0N9STL0	Staphylococcus_phage	31.2	7.0e-27
AUI75064.1|2021136_2022840_+|transposase	transposase	transposase	A0ZS58	Staphylococcus_virus	36.9	3.5e-88
AUI75065.1|2022841_2025010_-	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A0D3MSW9	Lactococcus_phage	47.5	1.9e-171
AUI75066.1|2025002_2025425_-	ribonucleotide reductase assembly protein NrdI	NA	A0A217ER62	Bacillus_phage	33.3	3.3e-11
AUI75067.1|2025408_2026431_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A160DHK0	Gordonia_phage	53.7	2.8e-96
AUI75068.1|2026759_2027938_+|transposase	transposase	transposase	A0A0N9STL0	Staphylococcus_phage	30.3	3.7e-28
AUI75069.1|2028058_2028472_-	hypothetical protein	NA	NA	NA	NA	NA
AUI75070.1|2028719_2029277_-	serine acetyltransferase	NA	NA	NA	NA	NA
AUI75071.1|2029242_2030427_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
AUI75072.1|2030448_2031360_-	cysteine synthase	NA	A0A1W6JIM2	Lactococcus_phage	41.7	2.8e-60
AUI75073.1|2032635_2032854_-	ubiquitin	NA	NA	NA	NA	NA
AUI75074.1|2032954_2033806_-	hypothetical protein	NA	NA	NA	NA	NA
AUI75075.1|2033938_2035213_-	MFS transporter	NA	NA	NA	NA	NA
AUI75076.1|2035308_2036157_+	transcriptional activator, Rgg/GadR/MutR family domain-containing protein	NA	NA	NA	NA	NA
AUI75077.1|2036273_2037452_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
>prophage 21
CP015496	Lactobacillus helveticus strain FAM8105 chromosome, complete genome	2209387	2060058	2113779	2209387	transposase,integrase	Streptococcus_phage(35.71%)	40	2059924:2059983	2121516:2122891
2059924:2059983	attL	TTTGGAGACTGTAAAATAGTTTGTGTAAGGATGAATGATTCCTTAAATTAATTTCTTAAA	NA	NA	NA	NA
AUI75099.1|2060058_2061237_+|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
AUI75100.1|2061288_2061534_+	hypothetical protein	NA	NA	NA	NA	NA
AUI75101.1|2063119_2063728_-	resolvase	NA	A0A1V0SJI5	Klosneuvirus	43.2	4.0e-34
AUI75285.1|2064337_2064637_+	hypothetical protein	NA	A0A0A8WIK3	Clostridium_phage	40.0	5.2e-11
AUI75102.1|2065673_2066096_+|transposase	transposase	transposase	NA	NA	NA	NA
AUI75103.1|2066289_2067177_+	sugar transporter	NA	NA	NA	NA	NA
AUI75104.1|2067229_2068417_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.4	1.5e-45
AUI75105.1|2069507_2071775_-	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.1	1.2e-59
AUI75106.1|2072239_2072758_-	acetyltransferase	NA	NA	NA	NA	NA
AUI75107.1|2073101_2074328_-|transposase	transposase	transposase	A0A0A8WEF4	Clostridium_phage	25.6	1.5e-08
AUI75108.1|2074385_2074709_-	hypothetical protein	NA	NA	NA	NA	NA
AUI75109.1|2074965_2075715_-	hypothetical protein	NA	NA	NA	NA	NA
AUI75110.1|2076143_2077190_-	fucose-binding lectin II	NA	NA	NA	NA	NA
AUI75111.1|2077277_2079698_-	hypothetical protein	NA	NA	NA	NA	NA
AUI75112.1|2080161_2081556_-|transposase	transposase	transposase	NA	NA	NA	NA
AUI75113.1|2082385_2083282_+	ABC transporter	NA	NA	NA	NA	NA
AUI75114.1|2083269_2084934_+	cobalt ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.0	2.4e-20
AUI75115.1|2084941_2085652_+	hypothetical protein	NA	NA	NA	NA	NA
AUI75116.1|2086759_2087095_+	ethanolamine utilization protein EutP	NA	NA	NA	NA	NA
AUI75117.1|2087091_2087304_-	hypothetical protein	NA	NA	NA	NA	NA
AUI75118.1|2087557_2088835_+|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	32.1	6.6e-47
AUI75119.1|2088976_2090326_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	50.3	7.0e-124
AUI75120.1|2090695_2090908_+	hypothetical protein	NA	NA	NA	NA	NA
AUI75121.1|2091487_2092207_+|transposase	transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	24.4	6.4e-07
AUI75122.1|2092510_2093350_-	nicotinate-nucleotide diphosphorylase (carboxylating)	NA	NA	NA	NA	NA
AUI75123.1|2093373_2094534_-	MFS transporter	NA	NA	NA	NA	NA
AUI75124.1|2094738_2096016_+|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.2	5.6e-46
AUI75125.1|2097339_2097750_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AUI75126.1|2098590_2099832_-	MFS transporter	NA	NA	NA	NA	NA
AUI75127.1|2100236_2101514_+|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.4	8.6e-47
AUI75128.1|2103724_2104498_-	phosphatase	NA	NA	NA	NA	NA
AUI75129.1|2106177_2106987_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AUI75130.1|2106989_2107175_+	hypothetical protein	NA	NA	NA	NA	NA
AUI75131.1|2107268_2107955_+	cobalamin biosynthesis protein CobQ	NA	NA	NA	NA	NA
AUI75286.1|2108015_2108858_-|integrase	integrase	integrase	A0A1B1P773	Bacillus_phage	43.0	3.4e-52
AUI75132.1|2109495_2109978_-	hypothetical protein	NA	M9MUG9	Rhodococcus_phage	42.2	5.0e-16
AUI75133.1|2110136_2111108_-	multidrug DMT transporter permease	NA	NA	NA	NA	NA
AUI75134.1|2111175_2111820_-	hypothetical protein	NA	NA	NA	NA	NA
AUI75287.1|2111837_2112338_-	hypothetical protein	NA	NA	NA	NA	NA
AUI75135.1|2112921_2113779_-|transposase	transposase	transposase	NA	NA	NA	NA
2121516:2122891	attR	TTTAAGAAATTAATTTAAGGAATCATTCATCCTTACACAAACTATTTTACAGTCTCCAAATCATGTCCGAGATAAACAGAAAAACCTAACATTTTAATCCTCTAAAGTAATAATATTTTCTTTTATGTCTATAAGTAAAACGGTTTCTAAATTATCATATCACATTTTTGTCTTGCTTTTTTTAGAGAAATACTGTTAAATATATATCAAATAAATATCAAATAAATTAAAAAGCTATGAAAAAGACGAGTAAATAATCTATTTCTCTACAGTGAATTAGTGTTAGTGCGAAACTAATAGACCCTGGATTATTGAAAAACACTTTTAGCAGCTCACCGAAATAACAATTCTTAAAGTAGGTTGAGACGTCTCCGGCACGTTACCACACCGGTGGGGCATGATTGTGCTCCATAAAGAGGTCTATATAATTAGACAATATGGGTGGTACCGCGGAAAAAAGCCTTTCGTCCCTGGATTATAGGGAGCGAAGGGCTTTTTCTTTACTCTCAAATATTTTCGAGAAAGAGGATTTATTATTATGACACTTATTTTACCTAAAGACTACCGCCCTACATTAACTGTCCGTGATACTGAAGCAGCGATTGTTTTCATCCGTGAAACCTTCCAAGACAAATTAGCATCTATTCTTGGCGTCCAAAGAATGTCTGCTCCAATGTTCGTTGAACAAAAAACTGGTTTGAACGACAACTTAAACGGTGTTGAACGTCCTGTTGCTTTCGACATGAAGGCTATGCCTAAAGAAGATACGATTGAAATTGTCCACTCCCTTGCTAAGTGGAAGCGACTCGCCCTTAAGAAGTACGGCTTTGGCATACACGAAGGTCTTTATACTAATATGAACGCCATTCGCCGCGACGAAGATTTAGACAACTTCCACTCCATTTACGTTGACCAATGGGATTGGGAAAAAATCATTCGCAAGGAAGAACGCAATACCGATACTTTGGAAATCACCGTTAACAAGATTTTTAGAGCAATTAAAGAAACTGAAAAATTAGTATCTGCACGCCACCCTGGTTCTACCTACCGTCTTGGTGACCACGTTTCATTTATTACTACACAAGAGCTTGAAGACCGCTGGCCTGATCTTTCACCAGACGAACGCGAAAATCAAATCGCTAAAGAAGAAAAAGTTGTCTTCATCATGAAGATCGGTGATAAGTTAAAGCGTAGCGGTAAACCTCACGACGGTCGTGCACCTGACTACGATGACTGGCAATTAAACGGTGATTTAGTTTTCTGGTATGAACCTCTTCAAAGCAAGATTGAAATTTCTTCAATGGGTATCCGAGTCAGTGAAGAGAGCTTAAAGGAACAACTTAAGAAGGCTCACTGCGAAGAACGCGCTAAATTGC	NA	NA	NA	NA
>prophage 22
CP015496	Lactobacillus helveticus strain FAM8105 chromosome, complete genome	2209387	2120261	2182479	2209387	transposase,holin,protease	Corynebacterium_phage(28.57%)	46	NA	NA
AUI75142.1|2120261_2121440_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
AUI75143.1|2122053_2123067_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	41.4	2.1e-64
AUI75144.1|2123556_2124735_-|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
AUI75145.1|2126896_2127613_-	ABC transporter	NA	A0A1V0SGN0	Hokovirus	29.2	3.2e-06
AUI75146.1|2127609_2128341_-	hypothetical protein	NA	NA	NA	NA	NA
AUI75147.1|2128395_2128686_-	hypothetical protein	NA	NA	NA	NA	NA
AUI75148.1|2129420_2130812_-	amino acid permease	NA	NA	NA	NA	NA
AUI75149.1|2131861_2133235_-	amino acid permease	NA	NA	NA	NA	NA
AUI75150.1|2133280_2134633_-	amino acid permease	NA	NA	NA	NA	NA
AUI75151.1|2134724_2135489_-	hypothetical protein	NA	NA	NA	NA	NA
AUI75152.1|2135582_2136224_-	signal peptidase I	NA	NA	NA	NA	NA
AUI75153.1|2136330_2138454_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	40.4	2.9e-116
AUI75154.1|2138738_2139668_-	acyltransferase	NA	NA	NA	NA	NA
AUI75155.1|2139636_2140962_-	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
AUI75156.1|2144302_2144539_+	hypothetical protein	NA	NA	NA	NA	NA
AUI75157.1|2144577_2146098_-	sugar transporter	NA	NA	NA	NA	NA
AUI75158.1|2148871_2149279_-	hypothetical protein	NA	NA	NA	NA	NA
AUI75159.1|2149687_2150395_-	hypothetical protein	NA	NA	NA	NA	NA
AUI75160.1|2150443_2150644_-	transcriptional regulator	NA	NA	NA	NA	NA
AUI75161.1|2150855_2151800_-	penicillin-binding protein	NA	Q19XB5	Mycobacterium_phage	26.7	2.9e-07
AUI75162.1|2151799_2153086_-	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
AUI75163.1|2153078_2153318_-	D-alanine--poly(phosphoribitol) ligase subunit 2	NA	NA	NA	NA	NA
AUI75164.1|2153376_2154615_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	27.4	2.0e-24
AUI75165.1|2154614_2156129_-	D-alanine--poly(phosphoribitol) ligase subunit 1	NA	A0A2K9KZV5	Tupanvirus	28.4	2.6e-34
AUI75166.1|2156144_2156297_-	cytochrome C554	NA	NA	NA	NA	NA
AUI75167.1|2156518_2157697_+|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
AUI75168.1|2157854_2158151_-	hypothetical protein	NA	NA	NA	NA	NA
AUI75169.1|2158170_2159307_-	hypothetical protein	NA	NA	NA	NA	NA
AUI75170.1|2162750_2164607_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.6	6.8e-69
AUI75171.1|2164760_2165930_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AUI75172.1|2166058_2166367_+	prevent-host-death protein	NA	NA	NA	NA	NA
AUI75173.1|2166353_2166623_+	toxin YoeB	NA	NA	NA	NA	NA
AUI75174.1|2166660_2168229_-	ABC transporter	NA	A0A1V0SE00	Indivirus	27.7	3.4e-13
AUI75175.1|2168233_2168863_-	hypothetical protein	NA	NA	NA	NA	NA
AUI75176.1|2168954_2169812_+	transcriptional regulator	NA	NA	NA	NA	NA
AUI75177.1|2169808_2170090_+	hypothetical protein	NA	NA	NA	NA	NA
AUI75288.1|2170243_2170387_+|holin	holin	holin	NA	NA	NA	NA
AUI75178.1|2171177_2171834_-	hypothetical protein	NA	NA	NA	NA	NA
AUI75179.1|2171922_2173026_+	hypothetical protein	NA	NA	NA	NA	NA
AUI75180.1|2175422_2176028_-	DUF3816 domain-containing protein	NA	NA	NA	NA	NA
AUI75181.1|2176135_2176963_-	aldo/keto reductase	NA	NA	NA	NA	NA
AUI75182.1|2177080_2177800_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
AUI75183.1|2178896_2179544_+	deoxynucleoside kinase	NA	Q5ULP7	Lactobacillus_virus	47.9	1.1e-47
AUI75184.1|2179568_2180255_+	deoxynucleoside kinase	NA	Q5ULP7	Lactobacillus_virus	50.6	5.4e-56
AUI75185.1|2180302_2181103_-	hydrolase	NA	NA	NA	NA	NA
AUI75186.1|2181300_2182479_+|transposase	transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.4e-38
