The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP015444	Lactobacillus helveticus strain FAM8627 chromosome, complete genome	2035631	10558	82773	2035631	transposase,integrase	Streptococcus_phage(15.38%)	48	56806:56833	85497:85524
AUJ27041.1|10558_11737_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ27042.1|15149_15353_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27043.1|15330_15975_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27044.1|15980_17951_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27045.1|19486_19852_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27046.1|19990_22012_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27047.1|22023_22479_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
AUJ27048.1|22509_23904_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	50.6	3.7e-120
AUJ27049.1|24140_25070_+	phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUJ27050.1|26629_27559_+	fatty acid-binding protein DegV	NA	NA	NA	NA	NA
AUJ27051.1|27677_28556_+	fructokinase	NA	NA	NA	NA	NA
AUJ27052.1|28929_29190_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27053.1|29350_31072_+|transposase	transposase	transposase	A0ZS58	Staphylococcus_virus	36.7	1.4e-87
AUJ27054.1|31063_32293_-	esterase	NA	NA	NA	NA	NA
AUJ27055.1|32376_33081_-	methyltransferase	NA	G3MA03	Bacillus_virus	43.6	1.6e-18
AUJ27056.1|33449_33686_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27057.1|34272_34473_-	transcriptional regulator	NA	NA	NA	NA	NA
AUJ27058.1|35275_36034_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
AUJ27059.1|37061_37286_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27060.1|37295_37883_+	transcriptional regulator	NA	NA	NA	NA	NA
AUJ27061.1|40868_42269_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27062.1|42365_43139_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27063.1|43177_43738_-	ATP:cob(I)alamin adenosyltransferase	NA	NA	NA	NA	NA
AUJ27064.1|43738_44263_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27065.1|44264_44675_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27066.1|44694_46929_-	ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent	NA	A0A222ZQ84	Mycobacterium_phage	33.2	6.5e-90
AUJ27067.1|47183_48218_+	AI-2E family transporter	NA	NA	NA	NA	NA
AUJ27068.1|48214_48787_+	esterase	NA	NA	NA	NA	NA
AUJ27069.1|48816_48999_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27070.1|49176_49461_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27071.1|49834_50596_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.6	6.5e-18
AUJ27072.1|50603_51488_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUJ27073.1|51484_52477_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUJ27074.1|52671_53850_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ27075.1|54204_54912_+	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
AUJ27076.1|55552_56737_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	60.1	3.9e-126
56806:56833	attL	CCGGCACTTCAGTGCCGGTGTAGTTCAT	NA	NA	NA	NA
AUJ27077.1|58656_59514_+	2,5-diketo-D-gluconic acid reductase	NA	A0A2H4PQR8	Staphylococcus_phage	43.1	5.0e-59
AUJ27078.1|62792_63806_-	lactate dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	35.6	1.3e-50
AUJ27079.1|63932_64775_+	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
AUJ27080.1|65245_66073_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	63.5	3.4e-97
AUJ27081.1|67090_69922_+	NgoFVII family restriction endonuclease	NA	A0A0K2CZF8	Paenibacillus_phage	24.9	1.6e-29
AUJ27082.1|69961_71065_-	penicillin-binding protein	NA	NA	NA	NA	NA
AUJ27083.1|71261_71675_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	38.9	1.0e-09
AUJ27084.1|77490_77649_+	branched-chain amino acid transporter	NA	NA	NA	NA	NA
AUJ27085.1|77882_78932_+|integrase	integrase	integrase	H7BWC8	unidentified_phage	35.9	4.7e-51
AUJ28645.1|78996_79269_-	transcriptional regulator	NA	NA	NA	NA	NA
AUJ27086.1|79472_81470_-	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
AUJ27087.1|81582_82773_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	59.0	3.9e-126
85497:85524	attR	ATGAACTACACCGGCACTGAAGTGCCGG	NA	NA	NA	NA
>prophage 2
CP015444	Lactobacillus helveticus strain FAM8627 chromosome, complete genome	2035631	86821	150539	2035631	transposase	Bacillus_phage(18.75%)	59	NA	NA
AUJ27093.1|86821_88147_-|transposase	transposase	transposase	G3MB42	Bacillus_virus	36.0	2.8e-56
AUJ27094.1|88175_88784_-	resolvase	NA	A0A1V0SJI5	Klosneuvirus	43.2	1.2e-33
AUJ27095.1|89040_89439_-	enterocin immunity protein	NA	NA	NA	NA	NA
AUJ27096.1|89441_90230_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27097.1|90527_90737_-	ATP-binding protein	NA	NA	NA	NA	NA
AUJ27098.1|90953_91703_-	aspartate racemase	NA	NA	NA	NA	NA
AUJ27099.1|91711_93283_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
AUJ27100.1|93333_94482_-	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	31.7	2.0e-18
AUJ27101.1|94485_95172_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	37.6	9.6e-37
AUJ28648.1|95349_97209_-	ABC transporter	NA	W8CYL7	Bacillus_phage	26.0	6.2e-46
AUJ27102.1|97218_98943_-	ABC transporter	NA	W8CYL7	Bacillus_phage	27.1	8.9e-39
AUJ27103.1|99057_99840_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27104.1|99848_100949_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
AUJ27105.1|100998_101262_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27106.1|101254_102139_-	chromosome partitioning protein ParB	NA	S5VTK0	Leptospira_phage	29.5	5.1e-14
AUJ27107.1|102116_102896_-	sporulation initiation inhibitor Soj	NA	Q8JL10	Natrialba_phage	31.5	4.3e-25
AUJ27108.1|102911_103751_-	nucleoid occlusion protein	NA	S5VSZ7	Leptospira_phage	42.5	2.1e-17
AUJ27109.1|103765_104488_-	16S rRNA (guanine(527)-N(7))-methyltransferase	NA	NA	NA	NA	NA
AUJ27110.1|104649_105186_+	CvpA family protein	NA	NA	NA	NA	NA
AUJ27111.1|105227_106157_-	thiamine biosynthesis protein ApbE	NA	NA	NA	NA	NA
AUJ27112.1|106165_106957_-	protein tyrosine phosphatase	NA	NA	NA	NA	NA
AUJ27113.1|107049_107598_-	NADPH-dependent FMN reductase	NA	A0A2P0ZL82	Lactobacillus_phage	38.8	1.1e-27
AUJ27114.1|107611_108151_-	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
AUJ27115.1|108285_108510_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27116.1|108622_109921_-	MFS transporter	NA	NA	NA	NA	NA
AUJ27117.1|110076_111483_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ27118.1|111693_112317_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ27119.1|112443_112686_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27120.1|112787_114200_+	dipeptidase	NA	NA	NA	NA	NA
AUJ27121.1|114244_114919_-	peptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	1.7e-33
AUJ27122.1|115982_116510_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ27123.1|116620_117220_-	phosphoglycerate mutase	NA	NA	NA	NA	NA
AUJ27124.1|117363_118119_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUJ27125.1|118115_118877_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27126.1|118935_119580_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27127.1|121357_123892_-	peptidase	NA	A0A0P0IY26	Acinetobacter_phage	25.9	1.9e-69
AUJ27128.1|124098_124458_+	aggregation promoting factor surface protein	NA	A0A0E3XCL7	Enterococcus_phage	65.7	1.6e-19
AUJ28649.1|124521_125472_-	cytochrome C5	NA	NA	NA	NA	NA
AUJ27129.1|128371_128734_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27130.1|130711_131092_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27131.1|131127_131718_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27132.1|131714_132041_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27133.1|132074_132269_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27134.1|132793_133480_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27135.1|133510_134017_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27136.1|134035_135091_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27137.1|135191_137216_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27138.1|139151_140411_-|transposase	transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.4	5.4e-09
AUJ27139.1|141886_142252_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27140.1|142248_142737_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27141.1|143160_143355_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27142.1|143787_144606_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ28650.1|144725_145904_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ27143.1|145926_146205_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27144.1|146485_146860_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27145.1|147679_148138_+	hypothetical protein	NA	A0A0B5CYL8	Listeria_phage	54.3	2.8e-32
AUJ27146.1|149162_149393_+	hypothetical protein	NA	A0A0B5CYL8	Listeria_phage	61.4	1.6e-15
AUJ27147.1|149921_150269_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ28651.1|150308_150539_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
CP015444	Lactobacillus helveticus strain FAM8627 chromosome, complete genome	2035631	191079	251223	2035631	transposase,integrase,tRNA	Bacillus_virus(22.22%)	47	223662:223681	251385:251404
AUJ27178.1|191079_192237_+|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	57.6	1.6e-116
AUJ27179.1|192503_193325_+	Sir2 family NAD-dependent protein deacetylase	NA	NA	NA	NA	NA
AUJ27180.1|193333_194287_+	DNA polymerase III subunit epsilon	NA	A0A0K2SUJ2	Clostridium_phage	33.1	1.5e-11
AUJ27181.1|194377_195232_+	DNA nuclease	NA	NA	NA	NA	NA
AUJ27182.1|195273_196701_+	peptidase C69	NA	NA	NA	NA	NA
AUJ27183.1|196923_197781_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ27184.1|197924_199010_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.2	3.2e-26
AUJ27185.1|199009_199876_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
AUJ27186.1|199879_200704_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
AUJ27187.1|200687_201983_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AUJ27188.1|203474_204392_+	magnesium transporter CorA	NA	NA	NA	NA	NA
AUJ27189.1|204404_205355_+	serine hydrolase	NA	NA	NA	NA	NA
AUJ27190.1|205490_206063_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ27191.1|206067_209676_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27192.1|209833_210868_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27193.1|210913_212296_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUJ27194.1|212379_213081_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUJ27195.1|213132_213240_-	regulator	NA	NA	NA	NA	NA
AUJ27196.1|213236_214034_-	esterase	NA	NA	NA	NA	NA
AUJ27197.1|214187_215366_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ27198.1|215541_216150_+	hypothetical protein	NA	M1Q152	Streptococcus_phage	39.1	3.6e-35
AUJ27199.1|216149_216701_+	acetyltransferase	NA	NA	NA	NA	NA
AUJ27200.1|216924_218232_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.1	6.2e-93
223662:223681	attL	TTAGCTCAGTTGGTAGAGCG	NA	NA	NA	NA
AUJ27201.1|224702_225050_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27202.1|225052_225250_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27203.1|225312_226332_+	PTS mannose transporter subunit EIIAB	NA	NA	NA	NA	NA
AUJ27204.1|226386_227199_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
AUJ27205.1|227227_228148_+	PTS mannose family transporter subunit IID	NA	NA	NA	NA	NA
AUJ27206.1|228151_228520_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27207.1|228564_229395_-	transcriptional regulator	NA	NA	NA	NA	NA
AUJ27208.1|230108_231482_-	amino acid permease	NA	NA	NA	NA	NA
AUJ27209.1|231795_234420_+	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
AUJ27210.1|234617_236429_+	glutamine--fructose-6-phosphate aminotransferase	NA	Q76DQ7	Chlorella_virus	37.4	1.6e-91
AUJ27211.1|236502_236796_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27212.1|237879_238263_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27213.1|239665_240850_+	acetate kinase	NA	NA	NA	NA	NA
AUJ27214.1|240953_241685_+	carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AUJ27215.1|241771_241999_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27216.1|242160_242574_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AUJ27217.1|244231_245422_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	57.9	4.3e-125
AUJ27218.1|245476_245698_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27219.1|245690_246062_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27220.1|246079_246829_-	TIGR02452 family protein	NA	NA	NA	NA	NA
AUJ27221.1|247029_247329_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27222.1|248073_249399_+|transposase	transposase	transposase	G3MB42	Bacillus_virus	36.3	2.1e-56
AUJ27223.1|249609_249873_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27224.1|250173_251223_+|integrase	integrase	integrase	H7BWC8	unidentified_phage	35.9	4.7e-51
251385:251404	attR	TTAGCTCAGTTGGTAGAGCG	NA	NA	NA	NA
>prophage 4
CP015444	Lactobacillus helveticus strain FAM8627 chromosome, complete genome	2035631	254246	317016	2035631	transposase,integrase,tRNA	Bacillus_virus(14.29%)	47	245490:245508	317085:317103
245490:245508	attL	CCCGGCACTTCAGTGCCGG	NA	NA	NA	NA
AUJ27228.1|254246_255488_+|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	57.0	1.3e-119
AUJ27229.1|255898_257653_+|transposase	transposase	transposase	A0ZS58	Staphylococcus_virus	36.7	1.1e-87
AUJ27230.1|257599_257998_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27231.1|258096_258297_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27232.1|258407_258800_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27233.1|260488_261184_+	hypothetical protein	NA	A0A249XZV3	Enterococcus_phage	50.7	4.9e-12
AUJ27234.1|261321_262380_+	surface exclusion protein	NA	NA	NA	NA	NA
AUJ27235.1|262449_263028_+	phosphoglycerate mutase	NA	A0A1X9IGJ2	Lactococcus_phage	37.1	1.1e-22
AUJ28652.1|263586_264246_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AUJ27236.1|269847_270963_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27237.1|271051_271753_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ27238.1|271816_272203_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A0F7LBI5	uncultured_marine_virus	47.2	7.1e-13
AUJ27239.1|272313_273504_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	56.7	2.9e-121
AUJ27240.1|273753_274482_+	acetylglucosaminyldiphospho-UDP acetyl-beta-D-mannosaminyltransferase	NA	NA	NA	NA	NA
AUJ27241.1|274489_275590_+	galactosyltransferase	NA	NA	NA	NA	NA
AUJ27242.1|275677_277156_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	47.6	1.3e-115
AUJ27243.1|277152_277983_+	NAD(+) synthase	NA	G3MA24	Bacillus_virus	51.1	1.3e-67
AUJ27244.1|278179_279421_+|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	57.4	5.3e-118
AUJ27245.1|282416_283571_+	CDP-glycerol--glycerophosphate glycerophosphotransferase	NA	NA	NA	NA	NA
AUJ27246.1|283575_285006_+	capsular biosynthesis protein	NA	NA	NA	NA	NA
AUJ27247.1|285008_285707_+	glycosyl transferase	NA	L7RBS6	Acanthamoeba_polyphaga_moumouvirus	27.6	2.1e-07
AUJ27248.1|285694_286165_+	SprT family protein	NA	NA	NA	NA	NA
AUJ27249.1|286402_287050_+	N-acetylmuramidase	NA	S5M633	Brevibacillus_phage	47.7	1.0e-27
AUJ27250.1|287135_289382_+	ATP-dependent DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.5	5.3e-132
AUJ27251.1|289422_291429_+	DNA ligase (NAD(+)) LigA	NA	A0A0K2QQN8	Ralstonia_phage	36.1	7.1e-104
AUJ28653.1|291462_292590_+	sex pheromone biosynthesis protein	NA	NA	NA	NA	NA
AUJ27252.1|292603_292912_+|tRNA	asparaginyl/glutamyl-tRNA amidotransferase subunit C	tRNA	NA	NA	NA	NA
AUJ27253.1|292911_294351_+|tRNA	aspartyl/glutamyl-tRNA amidotransferase subunit A	tRNA	NA	NA	NA	NA
AUJ27254.1|294355_295786_+|tRNA	aspartyl/glutamyl-tRNA amidotransferase subunit B	tRNA	NA	NA	NA	NA
AUJ27255.1|295810_296731_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	25.8	2.7e-18
AUJ27256.1|296797_297451_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27257.1|297523_298228_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27258.1|298441_299299_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ27259.1|299383_299725_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27260.1|299761_301138_-	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
AUJ27261.1|301503_302856_+	23S rRNA (uracil-5-)-methyltransferase RumA	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	48.2	1.9e-116
AUJ27262.1|303315_304251_+|integrase	integrase	integrase	H7BVY4	unidentified_phage	31.3	1.6e-29
AUJ27263.1|304336_305299_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AUJ27264.1|305317_306496_-	aspartate aminotransferase	NA	NA	NA	NA	NA
AUJ28654.1|306516_307302_-	hydrolase	NA	NA	NA	NA	NA
AUJ27265.1|307622_307928_-	hypothetical protein	NA	A0A1V0SHK8	Klosneuvirus	53.7	4.0e-11
AUJ27266.1|308266_309049_+|integrase	integrase	integrase	H7BVY4	unidentified_phage	31.3	1.0e-21
AUJ27267.1|309375_309579_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.9	1.6e-19
AUJ27268.1|309789_310236_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27269.1|311576_312077_+	acetyltransferase	NA	NA	NA	NA	NA
AUJ27270.1|312816_314142_+|transposase	transposase	transposase	G3MB42	Bacillus_virus	36.0	4.7e-56
AUJ27271.1|315825_317016_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	57.7	1.6e-124
317085:317103	attR	CCGGCACTGAAGTGCCGGG	NA	NA	NA	NA
>prophage 5
CP015444	Lactobacillus helveticus strain FAM8627 chromosome, complete genome	2035631	333630	402520	2035631	transposase,protease	Streptococcus_phage(15.38%)	57	NA	NA
AUJ27284.1|333630_334488_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ27285.1|335086_335827_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.4	3.2e-38
AUJ27286.1|335838_336657_+	glutamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUJ27287.1|336656_337298_+	glutamine ABC transporter permease	NA	NA	NA	NA	NA
AUJ27288.1|337312_337966_+	glutamine ABC transporter permease	NA	NA	NA	NA	NA
AUJ27289.1|339965_341267_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUJ27290.1|341416_342760_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27291.1|342778_343048_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27292.1|344812_345616_+	DUF4931 domain-containing protein	NA	NA	NA	NA	NA
AUJ27293.1|346624_347317_+	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
AUJ27294.1|347377_349393_+	potassium transporter Kup	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	34.6	8.5e-65
AUJ27295.1|349510_350437_+	purine nucleosidase	NA	NA	NA	NA	NA
AUJ27296.1|351235_351430_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27297.1|352836_353160_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27298.1|353224_354043_-	sugar-phosphatase	NA	NA	NA	NA	NA
AUJ27299.1|355164_355959_+	Fe-S cluster assembly ATPase SufC	NA	A0A1M7XV31	Cedratvirus	27.6	7.3e-12
AUJ27300.1|355970_357248_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
AUJ27301.1|357222_358461_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.8	1.0e-97
AUJ27302.1|358447_358909_+	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
AUJ27303.1|358901_360305_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
AUJ27304.1|360304_360628_+	DNA methyltransferase	NA	NA	NA	NA	NA
AUJ27305.1|360714_361080_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27306.1|361085_361841_-	decarboxylase	NA	NA	NA	NA	NA
AUJ27307.1|362129_364529_+	phosphoketolase	NA	NA	NA	NA	NA
AUJ27308.1|364595_365444_+	patatin family protein	NA	NA	NA	NA	NA
AUJ27309.1|368606_368879_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27310.1|369694_371056_+	hemolysin	NA	NA	NA	NA	NA
AUJ27311.1|371163_371733_+	hypoxanthine phosphoribosyltransferase	NA	A0A2K9L634	Tupanvirus	27.6	3.7e-10
AUJ27312.1|373112_373817_+	lysozyme	NA	NA	NA	NA	NA
AUJ27313.1|373816_375049_+	helicase	NA	A0A1B1IS59	uncultured_Mediterranean_phage	28.5	1.2e-34
AUJ27314.1|375045_376374_+	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
AUJ28655.1|376541_376730_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27315.1|376837_377980_+	UDP-N-acetylglucosamine 2-epimerase	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	30.3	1.2e-28
AUJ27316.1|378003_378543_-	teichoic acid glycosylation protein	NA	NA	NA	NA	NA
AUJ27317.1|378535_378982_-	flavodoxin	NA	NA	NA	NA	NA
AUJ27318.1|379124_379952_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
AUJ27319.1|379960_380884_+	ribonuclease BN-like family protein	NA	NA	NA	NA	NA
AUJ27320.1|380945_381845_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	48.1	6.4e-73
AUJ27321.1|383470_384631_+	3-ketoacyl-CoA thiolase	NA	NA	NA	NA	NA
AUJ27322.1|384630_385842_+	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
AUJ27323.1|385841_387005_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
AUJ27324.1|387043_387328_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27325.1|388319_389657_-|transposase	transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
AUJ28656.1|389631_389862_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ27326.1|389901_390249_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ27327.1|390486_391575_-|transposase	transposase	transposase	A0A1X9I5Z0	Streptococcus_phage	38.8	7.6e-52
AUJ27328.1|391928_392198_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ27329.1|392201_392657_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ27330.1|392705_393290_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ27331.1|394003_395386_-	23S rRNA (uracil-5-)-methyltransferase RumA	NA	A0A2K5B251	Erysipelothrix_phage	33.2	3.9e-69
AUJ27332.1|395507_396323_+	recombination regulator RecX	NA	NA	NA	NA	NA
AUJ27333.1|396333_396816_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27334.1|396817_397279_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27335.1|397386_398259_+	magnesium/cobalt efflux protein	NA	NA	NA	NA	NA
AUJ27336.1|398258_399830_+	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	26.2	5.5e-35
AUJ27337.1|399897_400179_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27338.1|400330_402520_-|protease	Clp protease ClpE	protease	A0A1C3S747	Escherichia_phage	40.6	2.3e-124
>prophage 6
CP015444	Lactobacillus helveticus strain FAM8627 chromosome, complete genome	2035631	558119	626803	2035631	transposase,integrase,tRNA,protease	unidentified_phage(20.0%)	60	584918:584934	627148:627164
AUJ27465.1|558119_559298_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ28659.1|560235_561084_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27466.1|561138_562155_-|integrase	integrase	integrase	H7BWC8	unidentified_phage	36.1	2.6e-46
AUJ27467.1|562211_562637_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27468.1|562780_563197_+	dolichyl-phosphate beta-D-mannosyltransferase	NA	NA	NA	NA	NA
AUJ27469.1|563193_564120_+	bactoprenol glucosyl transferase	NA	V5USA4	Oenococcus_phage	49.0	2.2e-76
AUJ27470.1|566221_567412_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	57.2	2.6e-122
AUJ27471.1|568132_570772_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	43.2	4.8e-161
AUJ27472.1|570772_572047_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AUJ27473.1|572036_572714_+	hydrolase	NA	NA	NA	NA	NA
AUJ27474.1|572752_573376_+	DNA repair protein RadC	NA	NA	NA	NA	NA
AUJ27475.1|573471_574476_+	rod shape-determining protein	NA	NA	NA	NA	NA
AUJ27476.1|574521_575373_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AUJ27477.1|575372_575912_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AUJ27478.1|576180_576513_+	DUF3397 domain-containing protein	NA	NA	NA	NA	NA
AUJ27479.1|578044_579433_+|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	46.7	6.9e-58
AUJ27480.1|579538_579970_+	cell division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
AUJ28660.1|579974_580922_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase	NA	NA	NA	NA	NA
AUJ27481.1|580935_581298_+	cell division protein FtsL	NA	NA	NA	NA	NA
AUJ27482.1|583452_584421_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
AUJ27483.1|584430_585810_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
584918:584934	attL	CAACTAAAGATGATATT	NA	NA	NA	NA
AUJ27484.1|585811_586918_+	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
AUJ27485.1|586934_587792_+	cell division protein FtsQ	NA	NA	NA	NA	NA
AUJ27486.1|587854_589213_+	cell division protein FtsA	NA	NA	NA	NA	NA
AUJ27487.1|589227_590547_+	cell division protein FtsZ	NA	NA	NA	NA	NA
AUJ27488.1|590564_591002_+	cell division protein SepF	NA	NA	NA	NA	NA
AUJ27489.1|591001_591304_+	cell division protein	NA	NA	NA	NA	NA
AUJ27490.1|591303_592104_+	RNA-binding protein	NA	NA	NA	NA	NA
AUJ27491.1|592079_592922_+	cell division protein DivIVA	NA	NA	NA	NA	NA
AUJ27492.1|593098_595882_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	27.9	1.5e-88
AUJ27493.1|595881_596085_+	cold-shock protein	NA	NA	NA	NA	NA
AUJ27494.1|596104_596674_+	ADP-ribose pyrophosphatase	NA	NA	NA	NA	NA
AUJ27495.1|596676_596985_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27496.1|597002_597698_+	5'-methylthioadenosine nucleosidase	NA	NA	NA	NA	NA
AUJ27497.1|597699_598857_+	cysteine desulfurase	NA	H7BUW1	unidentified_phage	37.5	1.8e-27
AUJ27498.1|598904_599246_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27499.1|599253_600381_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AUJ27500.1|600473_601133_+	phosphoglycerate mutase	NA	NA	NA	NA	NA
AUJ27501.1|601132_601777_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27502.1|601776_604128_+	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	26.9	4.8e-59
AUJ27503.1|605171_606851_-	ribonuclease J	NA	NA	NA	NA	NA
AUJ27504.1|606857_607079_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27505.1|607433_607988_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	39.7	3.6e-10
AUJ27506.1|608239_610084_+	GTP-binding protein TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	41.5	3.6e-22
AUJ27507.1|610179_611361_+	cell division protein FtsW	NA	NA	NA	NA	NA
AUJ27508.1|611357_611702_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27509.1|611698_612247_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
AUJ27510.1|612249_612744_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	36.2	9.7e-23
AUJ27511.1|612727_613762_+	peptide-binding protein	NA	NA	NA	NA	NA
AUJ27512.1|613851_614553_+	competence protein	NA	NA	NA	NA	NA
AUJ27513.1|614521_616810_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	31.0	8.2e-24
AUJ27514.1|616806_617793_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
AUJ27515.1|617853_618111_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
AUJ28661.1|618309_618579_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
AUJ27516.1|618735_620508_+	RNase J family beta-CASP ribonuclease	NA	NA	NA	NA	NA
AUJ27517.1|620510_621344_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27518.1|621383_622349_-|integrase	integrase	integrase	H7BWC8	unidentified_phage	35.5	2.9e-47
AUJ27519.1|622732_623923_+	translation elongation factor Tu	NA	A0A076FFS6	Aureococcus_anophage	27.3	5.2e-30
AUJ27520.1|624067_625399_+	trigger factor	NA	NA	NA	NA	NA
AUJ27521.1|625528_626803_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	55.6	2.3e-132
627148:627164	attR	CAACTAAAGATGATATT	NA	NA	NA	NA
>prophage 7
CP015444	Lactobacillus helveticus strain FAM8627 chromosome, complete genome	2035631	631724	706569	2035631	transposase	Streptococcus_phage(20.0%)	54	NA	NA
AUJ27525.1|631724_631865_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ27526.1|631989_632232_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27527.1|632477_633704_+|transposase	transposase	transposase	A0A1X9I619	Streptococcus_phage	38.4	1.8e-65
AUJ27528.1|635168_636485_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
AUJ27529.1|636504_637215_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
AUJ27530.1|637217_638372_+	N-acetyldiaminopimelate deacetylase	NA	NA	NA	NA	NA
AUJ27531.1|638373_639309_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
AUJ27532.1|639301_640081_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
AUJ27533.1|640101_641268_+	amino acid aminotransferase	NA	NA	NA	NA	NA
AUJ27534.1|641279_642338_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AUJ27535.1|642415_643810_+	hypothetical protein	NA	A0A1B1P773	Bacillus_phage	43.0	5.7e-52
AUJ28662.1|643929_645012_+	penicillin-binding protein	NA	NA	NA	NA	NA
AUJ27536.1|645083_645644_+	ADP-ribose pyrophosphatase	NA	NA	NA	NA	NA
AUJ27537.1|645687_647298_-	beta-carotene 15,15'-monooxygenase	NA	NA	NA	NA	NA
AUJ27538.1|647904_648420_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27539.1|648482_649412_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUJ27540.1|649550_650471_+	aldo/keto reductase	NA	NA	NA	NA	NA
AUJ27541.1|650639_652346_+|transposase	transposase	transposase	A0ZS58	Staphylococcus_virus	36.7	6.0e-88
AUJ27542.1|653926_654562_-	transcriptional regulator	NA	NA	NA	NA	NA
AUJ27543.1|656703_657258_-	isochorismatase	NA	G3MA16	Bacillus_virus	41.8	4.7e-34
AUJ28663.1|658967_660146_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ27544.1|660412_661117_+	ADP-ribose pyrophosphatase	NA	G3MA14	Bacillus_virus	25.9	2.5e-08
AUJ27545.1|663610_664852_+|transposase	transposase	transposase	A0A0P0IJS6	Lactobacillus_phage	56.8	7.4e-120
AUJ27546.1|665011_665950_-	PTS beta-glucoside transporter subunit IIC	NA	NA	NA	NA	NA
AUJ27547.1|668507_668996_+	nitroreductase	NA	NA	NA	NA	NA
AUJ27548.1|669147_669750_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
AUJ27549.1|669825_671112_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	51.7	2.3e-108
AUJ27550.1|672335_674063_+|transposase	transposase	transposase	A0ZS58	Staphylococcus_virus	37.1	8.0e-88
AUJ27551.1|674028_674604_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27552.1|676556_677513_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	60.5	3.6e-114
AUJ27553.1|677527_678046_+	diacylglycerol kinase	NA	G3MBI7	Bacillus_virus	40.1	7.6e-26
AUJ27554.1|679642_682060_+	ATPase P	NA	E4ZFI9	Streptococcus_phage	20.4	1.2e-17
AUJ27555.1|682411_683272_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUJ27556.1|683284_684346_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.2	1.4e-29
AUJ27557.1|684338_685040_+	methionine ABC transporter permease	NA	NA	NA	NA	NA
AUJ27558.1|686514_686739_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27559.1|686926_688330_+	class II fumarate hydratase	NA	NA	NA	NA	NA
AUJ27560.1|688341_689718_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	32.1	2.9e-56
AUJ27561.1|690073_690334_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27562.1|691004_691307_+	mucus-binding protein	NA	NA	NA	NA	NA
AUJ27563.1|691354_691522_+	mucus-binding protein	NA	NA	NA	NA	NA
AUJ27564.1|692704_693082_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27565.1|693088_693589_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27566.1|693595_693940_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27567.1|694075_695191_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	56.2	1.3e-112
AUJ27568.1|695476_696160_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27569.1|696175_696391_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27570.1|696387_698922_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27571.1|699083_700010_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
AUJ27572.1|700539_702417_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27573.1|702583_702817_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27574.1|702836_703106_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27575.1|703705_705019_+	aminopeptidase	NA	R4TV59	Phaeocystis_globosa_virus	32.3	8.5e-58
AUJ28664.1|705390_706569_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
CP015444	Lactobacillus helveticus strain FAM8627 chromosome, complete genome	2035631	773919	833439	2035631	transposase,integrase,tRNA	Staphylococcus_phage(15.38%)	57	802976:803000	832484:832508
AUJ27628.1|773919_775119_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	34.1	8.6e-49
AUJ27629.1|775156_775849_-	hemolysin III	NA	NA	NA	NA	NA
AUJ28666.1|775965_776796_+	fatty acid-binding protein DegV	NA	A0A0N9SI50	Staphylococcus_phage	45.9	5.3e-21
AUJ27630.1|776798_777029_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27631.1|777076_778669_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AUJ27632.1|778692_779544_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
AUJ27633.1|779533_780286_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	38.7	2.6e-27
AUJ27634.1|780346_781195_+	DNA protecting protein DprA	NA	S6BFL3	Thermus_phage	36.8	4.9e-30
AUJ27635.1|781266_783381_+	DNA topoisomerase I	NA	E3T4K4	Cafeteria_roenbergensis_virus	37.7	3.8e-100
AUJ27636.1|783402_784719_+|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
AUJ27637.1|784718_785627_+	tyrosine recombinase XerC	NA	A0A1P8DJJ6	Virus_Rctr41k	25.1	2.3e-14
AUJ27638.1|785635_786160_+	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
AUJ27639.1|786170_787574_+	HslU--HslV peptidase ATPase subunit	NA	A0A1B2IB03	Erwinia_phage	24.9	7.5e-28
AUJ27640.1|787726_788626_+	aldose epimerase	NA	NA	NA	NA	NA
AUJ27641.1|789693_790509_-|integrase	integrase	integrase	NA	NA	NA	NA
AUJ27642.1|790789_791173_+	chromosome condensation protein CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	36.5	3.1e-08
AUJ27643.1|791174_791552_+	camphor resistance protein CrcB	NA	NA	NA	NA	NA
AUJ27644.1|791632_792490_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ27645.1|792735_793116_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27646.1|793116_794703_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.1	5.9e-13
AUJ27647.1|797423_797666_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27648.1|797721_797991_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27649.1|798238_798469_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27650.1|800090_801317_+|transposase	transposase	transposase	A0A1X9I619	Streptococcus_phage	38.1	5.2e-65
AUJ28667.1|802209_802989_+|transposase	transposase	transposase	NA	NA	NA	NA
802976:803000	attL	AACGATTTAACTAGCACCACGCGTA	NA	NA	NA	NA
AUJ27651.1|803191_805288_+	ornithine decarboxylase	NA	NA	NA	NA	NA
AUJ27652.1|805304_806564_+	aluminum resistance protein	NA	NA	NA	NA	NA
AUJ28668.1|807621_809394_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	38.8	7.7e-78
AUJ27653.1|809502_809952_+	transcriptional regulator	NA	NA	NA	NA	NA
AUJ27654.1|810915_811530_+	acetyltransferase	NA	A0A1V0SJ47	Klosneuvirus	37.7	2.1e-06
AUJ27655.1|811654_812752_+	penicillin-binding protein	NA	NA	NA	NA	NA
AUJ27656.1|812818_813640_+	pyridoxal kinase	NA	NA	NA	NA	NA
AUJ27657.1|813646_814204_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27658.1|814285_815491_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ28669.1|815539_816790_-	MATE family efflux transporter	NA	NA	NA	NA	NA
AUJ27659.1|817031_818318_+	peptidase T	NA	NA	NA	NA	NA
AUJ28670.1|818323_818536_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27660.1|818580_818775_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27661.1|819077_819428_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27662.1|819518_820151_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27663.1|821573_822155_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27664.1|822220_823402_-	permease	NA	NA	NA	NA	NA
AUJ27665.1|823490_824201_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AUJ27666.1|824262_824616_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ28671.1|824787_825264_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AUJ27667.1|825260_825542_+	acyltransferase	NA	NA	NA	NA	NA
AUJ27668.1|825577_825949_+	cytidine deaminase	NA	NA	NA	NA	NA
AUJ27669.1|825964_826726_+	phosphorylase	NA	NA	NA	NA	NA
AUJ27670.1|826728_827352_+	ADP-ribose pyrophosphatase	NA	NA	NA	NA	NA
AUJ27671.1|827742_828102_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27672.1|828211_828703_+	DUF5067 domain-containing protein	NA	NA	NA	NA	NA
AUJ27673.1|829207_829666_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ28672.1|829742_830591_+|integrase	integrase	integrase	A0A1B1P773	Bacillus_phage	46.3	6.1e-57
AUJ27674.1|830868_831147_+	prevent-host-death family protein	NA	NA	NA	NA	NA
AUJ27675.1|831146_831494_+	addiction module toxin RelE	NA	NA	NA	NA	NA
AUJ27676.1|831878_832382_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27677.1|832581_833439_+|transposase	transposase	transposase	NA	NA	NA	NA
832484:832508	attR	TACGCGTGGTGCTAGTTAAATCGTT	NA	NA	NA	NA
>prophage 9
CP015444	Lactobacillus helveticus strain FAM8627 chromosome, complete genome	2035631	839287	891926	2035631	transposase,integrase	Lactobacillus_virus(18.18%)	50	841278:841293	896829:896844
AUJ27683.1|839287_840478_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	56.7	4.9e-121
AUJ27684.1|840874_841309_+	histidine kinase	NA	NA	NA	NA	NA
841278:841293	attL	TCAAAGATTTGAAAGA	NA	NA	NA	NA
AUJ27685.1|841305_841734_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27686.1|842057_843563_+	ABC-F type ribosomal protection protein	NA	A0A2K9L3Z8	Tupanvirus	25.5	4.9e-25
AUJ27687.1|844089_845268_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ27688.1|846168_847854_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27689.1|849338_851285_-	peptidase M13	NA	E3T4I7	Cafeteria_roenbergensis_virus	29.3	1.8e-59
AUJ27690.1|851494_851860_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
AUJ27691.1|852134_853481_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
AUJ27692.1|853512_854700_+	amidohydrolase	NA	NA	NA	NA	NA
AUJ27693.1|855089_855389_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ28673.1|855734_856019_+	homocysteine methyltransferase	NA	NA	NA	NA	NA
AUJ28674.1|857399_858674_+	DNA replication initiation protein	NA	NA	NA	NA	NA
AUJ27694.1|860474_861008_+	hypoxanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
AUJ27695.1|861164_861395_+	replication-associated protein RepA	NA	NA	NA	NA	NA
AUJ27696.1|861529_862081_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27697.1|862235_863426_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	59.0	6.6e-126
AUJ27698.1|863614_863854_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27699.1|864886_865222_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27700.1|865604_866984_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
AUJ27701.1|867053_868094_+	hypothetical protein	NA	A0A1B1P773	Bacillus_phage	44.4	1.2e-35
AUJ27702.1|868078_868288_+|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	53.2	6.8e-10
AUJ27703.1|868341_869745_-	dipeptidase PepV	NA	NA	NA	NA	NA
AUJ27704.1|869795_870962_+	serine hydrolase	NA	NA	NA	NA	NA
AUJ27705.1|871074_873813_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
AUJ27706.1|873848_874061_-	transcriptional regulator	NA	NA	NA	NA	NA
AUJ27707.1|874123_874447_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27708.1|874622_875378_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27709.1|875536_875980_+	acetyltransferase	NA	NA	NA	NA	NA
AUJ27710.1|876069_876483_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27711.1|876484_876922_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ27712.1|877099_877375_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27713.1|877440_878094_-	endonuclease III	NA	NA	NA	NA	NA
AUJ27714.1|878533_878884_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AUJ27715.1|879938_881276_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AUJ27716.1|881265_882357_+	dihydropteroate synthase	NA	NA	NA	NA	NA
AUJ27717.1|882368_882905_+	phosphohydrolase	NA	NA	NA	NA	NA
AUJ27718.1|883062_883347_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27719.1|883774_884041_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ27720.1|884193_884391_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27721.1|884839_885499_+	polar amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUJ27722.1|885479_886154_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUJ27723.1|886163_886904_+	glutamine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.2	4.1e-33
AUJ27724.1|886915_887776_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUJ27725.1|887921_888356_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27726.1|888337_888625_+|transposase	transposase	transposase	A0A0C5AJ29	Paenibacillus_phage	45.1	2.7e-09
AUJ28675.1|888705_889626_+|integrase	integrase	integrase	A0A0C5AC89	Paenibacillus_phage	39.2	1.6e-34
AUJ27727.1|889739_890240_+	DNA methyltransferase	NA	A0A1S5PRR3	Streptococcus_phage	45.4	1.6e-33
AUJ27728.1|890551_891190_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27729.1|891305_891926_+|integrase	integrase	integrase	E2ELN7	Clostridium_phage	36.4	4.3e-20
896829:896844	attR	TCAAAGATTTGAAAGA	NA	NA	NA	NA
>prophage 10
CP015444	Lactobacillus helveticus strain FAM8627 chromosome, complete genome	2035631	973595	1044958	2035631	transposase,tRNA,protease	Streptococcus_phage(17.65%)	54	NA	NA
AUJ27801.1|973595_975659_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AUJ27802.1|975651_976569_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
AUJ27803.1|976822_977575_-	DNA repair protein RecO	NA	NA	NA	NA	NA
AUJ27804.1|977575_978481_-	GTPase Era	NA	NA	NA	NA	NA
AUJ27805.1|978480_979005_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
AUJ27806.1|979007_979967_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	46.1	1.7e-47
AUJ27807.1|979992_980436_-	hypothetical protein	NA	A0A292GL36	Xanthomonas_phage	32.9	1.5e-11
AUJ27808.1|980546_980723_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AUJ27809.1|980978_981815_+	transcriptional regulator	NA	NA	NA	NA	NA
AUJ27810.1|982168_982618_+	peptidase M23	NA	NA	NA	NA	NA
AUJ27811.1|982818_983697_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27812.1|984878_985736_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ27813.1|986376_986988_-	transcriptional regulator	NA	NA	NA	NA	NA
AUJ27814.1|987167_988334_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AUJ27815.1|988454_988991_-	holo-ACP synthase CitX	NA	NA	NA	NA	NA
AUJ27816.1|992293_993148_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ27817.1|993276_995550_+	proton-efflux P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	26.8	2.7e-43
AUJ27818.1|995618_996116_-	lactocepin S-layer protein	NA	NA	NA	NA	NA
AUJ27819.1|996258_997116_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ28677.1|998871_999630_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
AUJ27820.1|999645_1000575_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	59.9	4.4e-101
AUJ27821.1|1000718_1001246_-	adenine phosphoribosyltransferase	NA	NA	NA	NA	NA
AUJ27822.1|1001350_1003624_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	35.9	1.3e-77
AUJ27823.1|1003744_1004434_-	class A sortase	NA	NA	NA	NA	NA
AUJ27824.1|1004436_1006275_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.1	4.0e-21
AUJ27825.1|1006443_1006659_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27826.1|1007513_1008668_-	molecular chaperone DnaJ	NA	A0A0P0YNN4	Yellowstone_lake_phycodnavirus	30.2	9.6e-21
AUJ27827.1|1008749_1010576_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.3	5.4e-143
AUJ27828.1|1010593_1011193_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AUJ27829.1|1011208_1012258_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
AUJ27830.1|1012427_1013390_-	riboflavin biosynthesis protein RibF	NA	A0A1V0SD03	Indivirus	30.1	6.1e-05
AUJ27831.1|1013395_1014289_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
AUJ27832.1|1014340_1014706_-	ribosome-binding factor A	NA	NA	NA	NA	NA
AUJ27833.1|1014725_1017338_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.5	9.7e-21
AUJ27834.1|1017342_1017654_-	50S ribosomal protein L7	NA	NA	NA	NA	NA
AUJ28678.1|1017656_1017932_-	DNA-binding protein	NA	NA	NA	NA	NA
AUJ28679.1|1017962_1019144_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
AUJ27835.1|1019163_1019640_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
AUJ27836.1|1019749_1024060_-	PolC-type DNA polymerase III	NA	A0A0A7RWA3	Clostridium_phage	34.1	1.2e-18
AUJ27837.1|1024065_1025763_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AUJ27838.1|1025805_1027062_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
AUJ27839.1|1027072_1027888_-	CDP-diglyceride synthetase	NA	NA	NA	NA	NA
AUJ27840.1|1027889_1028624_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	39.0	2.5e-22
AUJ27841.1|1028626_1029184_-	ribosome recycling factor	NA	NA	NA	NA	NA
AUJ27842.1|1029183_1029909_-	UMP kinase	NA	NA	NA	NA	NA
AUJ27843.1|1030047_1031073_-	translation elongation factor Ts	NA	NA	NA	NA	NA
AUJ27844.1|1031106_1031880_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
AUJ27845.1|1032041_1033073_-	methyltransferase	NA	NA	NA	NA	NA
AUJ27846.1|1033138_1033753_+	acyl-phosphate glycerol 3-phosphate acyltransferase	NA	NA	NA	NA	NA
AUJ27847.1|1033807_1034989_+	cyclopropane-fatty-acyl-phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	36.1	4.7e-47
AUJ27848.1|1035046_1036990_-	peptidase M13	NA	E3T4I7	Cafeteria_roenbergensis_virus	28.4	7.2e-61
AUJ27849.1|1039929_1041120_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	57.7	1.3e-121
AUJ27850.1|1042231_1043491_+|transposase	transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	22.0	1.0e-07
AUJ27851.1|1043731_1044958_+|transposase	transposase	transposase	A0A1X9I619	Streptococcus_phage	37.9	1.1e-64
>prophage 11
CP015444	Lactobacillus helveticus strain FAM8627 chromosome, complete genome	2035631	1083139	1200192	2035631	transposase,integrase,tRNA	Streptococcus_phage(14.29%)	87	1093861:1093900	1108397:1108436
AUJ27884.1|1083139_1084066_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	30.2	6.1e-10
AUJ27885.1|1084097_1086497_-	primosomal protein N'	NA	NA	NA	NA	NA
AUJ27886.1|1086547_1086772_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AUJ27887.1|1086774_1087389_-	guanylate kinase	NA	A0A212Q4J6	Cowpox_virus	29.8	6.2e-19
AUJ27888.1|1087960_1089643_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AUJ27889.1|1089653_1090466_-	cell division protein FtsJ	NA	NA	NA	NA	NA
AUJ27890.1|1090466_1091336_-	geranyl transferase	NA	NA	NA	NA	NA
AUJ27891.1|1091338_1091581_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
AUJ27892.1|1092915_1093764_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	43.1	1.9e-42
1093861:1093900	attL	CGTAAATTGCAATAATAAATTGAACGCTTAAGCTGCTTGA	NA	NA	NA	NA
AUJ27893.1|1093929_1094937_-|integrase	integrase	integrase	H7BWC8	unidentified_phage	36.1	8.0e-48
AUJ27894.1|1095074_1095923_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	43.1	1.9e-42
AUJ27895.1|1095981_1096374_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
AUJ27896.1|1096381_1096807_-	alkaline-shock protein	NA	NA	NA	NA	NA
AUJ27897.1|1096824_1097394_-	elongation factor P	NA	NA	NA	NA	NA
AUJ27898.1|1097477_1098587_-	X-Pro dipeptidase	NA	NA	NA	NA	NA
AUJ27899.1|1098696_1098987_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
AUJ27900.1|1099005_1099317_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
AUJ27901.1|1100988_1102014_+	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
AUJ27902.1|1102057_1102735_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27903.1|1102800_1102980_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
AUJ27904.1|1103050_1104847_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27905.1|1104969_1106190_-	lysin	NA	X2CXX8	Lactobacillus_phage	50.9	1.7e-60
AUJ27906.1|1106648_1107545_+	lipase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	26.6	1.8e-11
AUJ27907.1|1107553_1107910_+	arsenate reductase	NA	M1PLC0	Streptococcus_phage	38.6	5.0e-13
AUJ27908.1|1107996_1108221_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27909.1|1108624_1111006_+	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
1108397:1108436	attR	TCAAGCAGCTTAAGCGTTCAATTTATTATTGCAATTTACG	NA	NA	NA	NA
AUJ27910.1|1111057_1111483_-	peptide-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
AUJ27911.1|1111475_1111757_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27912.1|1111871_1112735_-	sugar transporter	NA	NA	NA	NA	NA
AUJ27913.1|1113057_1114020_-	mucus-binding protein	NA	NA	NA	NA	NA
AUJ27914.1|1114443_1115622_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ27915.1|1116759_1119948_-	carbamoyl phosphate synthase large subunit	NA	NA	NA	NA	NA
AUJ27916.1|1121024_1122302_-	dihydroorotase	NA	NA	NA	NA	NA
AUJ27917.1|1122301_1123258_-	aspartate carbamoyltransferase	NA	M1HGA5	Paramecium_bursaria_Chlorella_virus	34.1	1.6e-26
AUJ27918.1|1123402_1123945_-	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AUJ27919.1|1124111_1125035_-	dihydroorotate dehydrogenase B catalytic subunit	NA	NA	NA	NA	NA
AUJ27920.1|1125289_1125994_+	orotidine 5'-phosphate decarboxylase	NA	NA	NA	NA	NA
AUJ27921.1|1125995_1126619_+	orotate phosphoribosyltransferase	NA	A0A0B5IW17	Pandoravirus	32.9	9.1e-26
AUJ28684.1|1126843_1127122_-	damage-inducible protein J	NA	NA	NA	NA	NA
AUJ27922.1|1129049_1131671_+	ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	30.0	1.1e-83
AUJ27923.1|1131865_1133125_+|transposase	transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.7	2.3e-07
AUJ27924.1|1133365_1134592_+|transposase	transposase	transposase	A0A1X9I619	Streptococcus_phage	37.9	1.5e-64
AUJ27925.1|1134867_1136100_-	MFS transporter	NA	NA	NA	NA	NA
AUJ27926.1|1136471_1137797_-|transposase	transposase	transposase	G3MB42	Bacillus_virus	36.3	1.2e-56
AUJ27927.1|1137826_1138435_-	resolvase	NA	A0A1V0SJI5	Klosneuvirus	43.2	1.5e-33
AUJ27928.1|1139980_1142164_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ28685.1|1142214_1143393_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ27929.1|1143512_1144502_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27930.1|1144718_1145576_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ27931.1|1147051_1147471_+	DDE endonuclease	NA	NA	NA	NA	NA
AUJ27932.1|1147542_1147857_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ27933.1|1147873_1148170_+	DNA methyltransferase	NA	NA	NA	NA	NA
AUJ27934.1|1148216_1149077_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUJ27935.1|1149089_1149830_-	glutamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	9.1e-25
AUJ27936.1|1149839_1150514_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUJ27937.1|1150494_1151154_-	polar amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUJ27938.1|1151306_1151540_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ28686.1|1151927_1152095_-	quaternary ammonium transporter	NA	NA	NA	NA	NA
AUJ27939.1|1152193_1153945_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUJ27940.1|1154287_1154797_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27941.1|1154836_1155184_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27942.1|1155256_1155469_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ27943.1|1155720_1156950_-	MFS transporter	NA	NA	NA	NA	NA
AUJ27944.1|1157206_1158613_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ27945.1|1159944_1161396_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27946.1|1161716_1162895_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ27947.1|1162988_1163459_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ27948.1|1163561_1164188_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27949.1|1164837_1165185_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ28687.1|1165224_1165455_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ27950.1|1165429_1166767_+|transposase	transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
AUJ27951.1|1166866_1167652_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27952.1|1169316_1170027_-	oxidoreductase	NA	NA	NA	NA	NA
AUJ27953.1|1170046_1170454_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27954.1|1170472_1171645_-	MFS transporter permease	NA	NA	NA	NA	NA
AUJ27955.1|1174184_1174784_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27956.1|1174840_1175323_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ27957.1|1175443_1176439_-	galactose mutarotase	NA	NA	NA	NA	NA
AUJ27958.1|1176558_1178022_-	galactose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
AUJ27959.1|1178043_1179210_-	galactokinase	NA	NA	NA	NA	NA
AUJ27960.1|1185655_1186885_-	MFS transporter	NA	NA	NA	NA	NA
AUJ27961.1|1191607_1192693_+	BMP family ABC transporter substrate-binding protein	NA	A0A0A7DN02	Lactobacillus_phage	49.3	5.2e-77
AUJ27962.1|1192761_1194306_+	heme ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.9	5.2e-14
AUJ27963.1|1194286_1195450_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AUJ27964.1|1195439_1196396_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
AUJ27965.1|1197465_1198725_+|transposase	transposase	transposase	Q6V7R1	Burkholderia_virus	22.4	1.4e-09
AUJ27966.1|1198965_1200192_+|transposase	transposase	transposase	A0A1X9I619	Streptococcus_phage	38.4	1.8e-65
>prophage 12
CP015444	Lactobacillus helveticus strain FAM8627 chromosome, complete genome	2035631	1238984	1305283	2035631	transposase,tRNA,protease,bacteriocin,integrase	Bacillus_phage(36.36%)	60	1252323:1252339	1279717:1279733
AUJ27993.1|1238984_1239665_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AUJ27994.1|1239685_1240246_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
AUJ27995.1|1240308_1240458_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
AUJ27996.1|1240534_1242643_-	cell division protein FtsI	NA	NA	NA	NA	NA
AUJ27997.1|1242733_1245325_+	ABC transporter permease	NA	NA	NA	NA	NA
AUJ27998.1|1245432_1246356_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AUJ27999.1|1246421_1247816_-	hypothetical protein	NA	A0A1B1P773	Bacillus_phage	43.0	5.7e-52
AUJ28000.1|1247889_1248162_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUJ28001.1|1248154_1248496_-	addiction module toxin RelE	NA	NA	NA	NA	NA
AUJ28002.1|1248694_1249609_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
AUJ28003.1|1249672_1250149_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
AUJ28004.1|1250225_1252640_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
1252323:1252339	attL	CTTCTTGATCTTTTCAT	NA	NA	NA	NA
AUJ28005.1|1252643_1253693_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.3	1.2e-33
AUJ28006.1|1253977_1254328_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ28007.1|1254438_1255206_-	rRNA methyltransferase	NA	NA	NA	NA	NA
AUJ28691.1|1255303_1255576_+	acylphosphatase	NA	NA	NA	NA	NA
AUJ28008.1|1255622_1256585_+	insertase	NA	NA	NA	NA	NA
AUJ28009.1|1256632_1257121_+|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
AUJ28010.1|1257157_1258717_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AUJ28011.1|1258703_1259420_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	30.1	1.8e-25
AUJ28012.1|1259582_1260137_-	DNA-binding protein	NA	NA	NA	NA	NA
AUJ28013.1|1260138_1261290_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ28014.1|1261295_1261643_-	ribosome silencing factor	NA	NA	NA	NA	NA
AUJ28015.1|1261664_1262258_-	HD domain-containing protein	NA	NA	NA	NA	NA
AUJ28016.1|1262238_1262895_-	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
AUJ28017.1|1262905_1264015_-	ribosome biogenesis GTPase YqeH	NA	NA	NA	NA	NA
AUJ28018.1|1264007_1264532_-	HAD family hydrolase	NA	NA	NA	NA	NA
AUJ28019.1|1264677_1265034_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AUJ28020.1|1265077_1265278_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AUJ28021.1|1265299_1265779_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	38.7	4.0e-13
AUJ28693.1|1266023_1267262_-	aryl-sulfate sulfotransferase	NA	NA	NA	NA	NA
AUJ28692.1|1267429_1267711_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ28022.1|1267808_1269059_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ28023.1|1269175_1270225_+|integrase	integrase	integrase	H7BWC8	unidentified_phage	34.3	2.7e-46
AUJ28024.1|1270419_1270950_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ28025.1|1271100_1271622_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ28026.1|1271779_1273714_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	33.4	1.6e-97
AUJ28694.1|1274004_1274913_-	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	28.1	9.2e-27
AUJ28027.1|1274944_1276276_-	chromosome replication initiation protein	NA	NA	NA	NA	NA
AUJ28028.1|1276278_1276746_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AUJ28029.1|1276748_1277351_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
AUJ28030.1|1277347_1278178_-	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	25.9	7.1e-18
AUJ28031.1|1278186_1280850_-	DNA polymerase I	NA	F8WQ35	Bacillus_phage	30.6	8.9e-62
1279717:1279733	attR	CTTCTTGATCTTTTCAT	NA	NA	NA	NA
AUJ28695.1|1282471_1282753_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
AUJ28032.1|1283756_1284248_-	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
AUJ28033.1|1284263_1286693_-	hypothetical protein	NA	A0A2R2ZGW0	Clostridioides_phage	23.5	4.8e-30
AUJ28034.1|1286835_1287549_-	type I-B CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
AUJ28035.1|1287535_1288438_-	type I-B CRISPR-associated protein Cas7/Cst2/DevR	NA	NA	NA	NA	NA
AUJ28036.1|1288456_1290214_-	type I-B CRISPR-associated protein Cas8b1/Cst1	NA	NA	NA	NA	NA
AUJ28037.1|1290231_1290987_-	CRISPR-associated endoribonuclease Cas6	NA	NA	NA	NA	NA
AUJ28038.1|1294279_1295161_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ28039.1|1295178_1295493_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUJ28040.1|1295899_1296877_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
AUJ28041.1|1297014_1298529_+	aminopeptidase	NA	NA	NA	NA	NA
AUJ28042.1|1298617_1299595_+	cell surface protein	NA	NA	NA	NA	NA
AUJ28043.1|1299648_1300962_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
AUJ28044.1|1301105_1301624_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ28045.1|1303353_1303701_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ28696.1|1303740_1303971_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ28046.1|1303945_1305283_+|transposase	transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
>prophage 13
CP015444	Lactobacillus helveticus strain FAM8627 chromosome, complete genome	2035631	1564463	1607350	2035631	bacteriocin,transposase,tRNA,protease	Agrobacterium_phage(12.5%)	32	NA	NA
AUJ28264.1|1564463_1566944_-|protease	ATP-dependent Clp protease ATP-binding protein ClpC	protease	A0A223W0B1	Agrobacterium_phage	33.4	1.6e-118
AUJ28265.1|1567048_1567504_-	histidine kinase	NA	NA	NA	NA	NA
AUJ28266.1|1567868_1568351_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ28267.1|1568662_1570213_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	35.6	1.5e-82
AUJ28268.1|1570228_1571254_-|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
AUJ28269.1|1571331_1572222_-	Hsp33 family molecular chaperone	NA	NA	NA	NA	NA
AUJ28270.1|1572274_1574440_-	cell division protein FtsH	NA	A0A0P0BXI2	Ostreococcus_lucimarinus_virus	41.0	1.1e-107
AUJ28271.1|1574534_1575791_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
AUJ28272.1|1575831_1576194_-	RNA-binding protein	NA	NA	NA	NA	NA
AUJ28273.1|1576193_1576571_-	septation inhibitor protein	NA	NA	NA	NA	NA
AUJ28274.1|1576636_1576879_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ28275.1|1576890_1580388_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
AUJ28276.1|1580389_1580947_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AUJ28277.1|1581081_1582053_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
AUJ28278.1|1582230_1582938_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ28706.1|1582989_1583475_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ28279.1|1583719_1584850_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.7	1.6e-28
AUJ28280.1|1584852_1585209_-	holo-ACP synthase	NA	NA	NA	NA	NA
AUJ28281.1|1585291_1586803_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	39.1	8.6e-70
AUJ28282.1|1586816_1588184_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
AUJ28283.1|1588310_1588556_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
AUJ28284.1|1588740_1589571_+	sugar-phosphatase	NA	NA	NA	NA	NA
AUJ28285.1|1589757_1590948_-|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	56.9	1.5e-122
AUJ28286.1|1591286_1592363_-	cell surface protein	NA	NA	NA	NA	NA
AUJ28287.1|1592458_1593424_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
AUJ28288.1|1593803_1594667_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AUJ28289.1|1598012_1599248_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.2	1.2e-101
AUJ28290.1|1599618_1600476_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ28291.1|1600571_1601798_-|transposase	transposase	transposase	A0A1X9I619	Streptococcus_phage	38.4	1.8e-65
AUJ28292.1|1604109_1605135_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ28293.1|1605749_1606391_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ28294.1|1606492_1607350_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 14
CP015444	Lactobacillus helveticus strain FAM8627 chromosome, complete genome	2035631	1725629	1845284	2035631	transposase,integrase,protease	Bacillus_phage(15.38%)	115	1784691:1784719	1820939:1820967
AUJ28390.1|1725629_1726865_+|protease	serine protease	protease	NA	NA	NA	NA
AUJ28391.1|1726901_1727639_-	glutamine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.7	4.5e-32
AUJ28392.1|1727631_1729116_-	ABC transporter permease	NA	NA	NA	NA	NA
AUJ28393.1|1729239_1730064_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ28394.1|1730076_1730760_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ28395.1|1730910_1731897_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	34.1	1.2e-32
AUJ28396.1|1731998_1732430_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ28397.1|1732432_1733071_-	NAD-dependent dehydratase	NA	NA	NA	NA	NA
AUJ28398.1|1733089_1733746_-	oxidoreductase	NA	NA	NA	NA	NA
AUJ28399.1|1733757_1734573_-	glycosyl transferase	NA	NA	NA	NA	NA
AUJ28400.1|1734734_1735679_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ28401.1|1735725_1736484_-	ribonuclease	NA	C1KFJ1	Lactobacillus_virus	33.1	1.1e-28
AUJ28402.1|1736571_1737498_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AUJ28403.1|1737517_1738975_+	cardiolipin synthase	NA	NA	NA	NA	NA
AUJ28404.1|1738969_1739449_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ28405.1|1739540_1740245_+	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
AUJ28406.1|1740296_1740815_+	cysteine methyltransferase	NA	A0A1S5V092	Saudi_moumouvirus	42.2	2.3e-14
AUJ28407.1|1740801_1741590_+	hypothetical protein	NA	A0A068EP98	Bacillus_phage	40.8	1.0e-37
AUJ28408.1|1741626_1741989_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ28409.1|1742058_1742691_+	3-methyladenine DNA glycosylase	NA	NA	NA	NA	NA
AUJ28410.1|1743018_1744632_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUJ28411.1|1744631_1745387_+	ABC transporter	NA	G9BWD6	Planktothrix_phage	37.2	1.4e-28
AUJ28412.1|1745439_1746357_-	restriction endonuclease	NA	NA	NA	NA	NA
AUJ28413.1|1746357_1747005_-	hydrolase	NA	NA	NA	NA	NA
AUJ28414.1|1747226_1748084_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ28415.1|1748142_1748376_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ28416.1|1748350_1748677_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ28417.1|1748673_1749156_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ28418.1|1749152_1749485_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ28419.1|1750861_1751722_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ28420.1|1752047_1752317_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ28421.1|1752300_1752705_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ28422.1|1752907_1754014_+	cation transporter	NA	NA	NA	NA	NA
AUJ28423.1|1754080_1754641_+	hypothetical protein	NA	A0A1X9IGG1	Lactococcus_phage	33.7	1.2e-13
AUJ28424.1|1754655_1755552_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
AUJ28425.1|1756725_1757139_+	hypothetical protein	NA	A0A0C5AEA5	Paenibacillus_phage	49.4	5.6e-16
AUJ28426.1|1757220_1758162_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ28427.1|1758320_1759670_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.1	3.3e-12
AUJ28428.1|1759673_1760327_+	ABC transporter permease	NA	NA	NA	NA	NA
AUJ28429.1|1760335_1761220_+	proline iminopeptidase	NA	NA	NA	NA	NA
AUJ28709.1|1762759_1763239_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
AUJ28430.1|1763704_1764946_-|protease	serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.4	1.1e-17
AUJ28431.1|1765032_1765830_-	MBL fold hydrolase	NA	A0A2I7SDH3	Paenibacillus_phage	34.6	2.0e-30
AUJ28432.1|1765845_1766670_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ28433.1|1766672_1768022_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ28710.1|1768011_1769868_-	PAS domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	33.5	3.9e-32
AUJ28434.1|1769934_1770651_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.8	6.7e-41
AUJ28435.1|1770978_1771200_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ28436.1|1771732_1772635_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ28437.1|1773463_1774870_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ28438.1|1775143_1776265_-	s-layer protein	NA	NA	NA	NA	NA
AUJ28439.1|1776393_1777152_+	acyl-phosphate glycerol 3-phosphate acyltransferase	NA	NA	NA	NA	NA
AUJ28440.1|1777201_1777591_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ28441.1|1778923_1779760_+	glycosyl transferase	NA	NA	NA	NA	NA
AUJ28442.1|1779778_1780735_+	glucosyltransferase	NA	NA	NA	NA	NA
AUJ28443.1|1781698_1782568_+	phospho-beta-glycosidase	NA	NA	NA	NA	NA
AUJ28444.1|1782656_1782875_+	steroid-binding protein	NA	NA	NA	NA	NA
AUJ28445.1|1783026_1783635_+	transcriptional regulator	NA	NA	NA	NA	NA
AUJ28446.1|1783872_1784220_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ28711.1|1784259_1784490_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ28447.1|1784464_1785802_+|transposase	transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
1784691:1784719	attL	TGGATCATATCCAACATGCTTACAAATGT	NA	NA	NA	NA
AUJ28448.1|1786920_1787958_-|integrase	integrase	integrase	H7BWC8	unidentified_phage	36.2	1.8e-50
AUJ28449.1|1788314_1789232_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUJ28450.1|1789263_1789911_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.3	7.5e-15
AUJ28451.1|1789910_1790705_+	ABC transporter	NA	NA	NA	NA	NA
AUJ28452.1|1791139_1792522_+	sodium:dicarboxylate symporter	NA	NA	NA	NA	NA
AUJ28453.1|1792972_1793155_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ28712.1|1793285_1794464_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ28454.1|1796008_1796281_+	enterocin immunity protein	NA	NA	NA	NA	NA
AUJ28455.1|1797178_1798975_-	oligoendopeptidase F	NA	NA	NA	NA	NA
AUJ28456.1|1799136_1800378_+	LytR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ28457.1|1800446_1800671_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ28458.1|1800764_1801955_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	57.2	3.4e-122
AUJ28459.1|1802552_1803107_-	ribosomal-protein-serine acetyltransferase	NA	NA	NA	NA	NA
AUJ28460.1|1803240_1803618_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ28461.1|1803626_1805168_+	multidrug ABC transporter ATP-binding protein	NA	A0A2H4UUX5	Bodo_saltans_virus	28.0	3.7e-44
AUJ28462.1|1805178_1805949_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ28463.1|1805951_1806437_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ28464.1|1806640_1807357_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ28465.1|1808986_1809523_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ28713.1|1809767_1810946_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ28466.1|1811012_1811357_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ28467.1|1811667_1812852_+|transposase	transposase	transposase	Q5ULQ4	Lactobacillus_virus	58.3	8.9e-123
AUJ28468.1|1813097_1813739_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ28469.1|1813753_1815259_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ28470.1|1815351_1815651_-	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
AUJ28471.1|1815745_1816291_+	guanylate kinase	NA	A0A218KC48	Bacillus_phage	31.7	9.4e-11
AUJ28472.1|1816480_1817032_+	glycosidase	NA	A0A1V0DZX6	Clostridioides_phage	46.0	6.6e-20
AUJ28473.1|1817124_1817397_+	ATPase	NA	NA	NA	NA	NA
AUJ28714.1|1817438_1817822_+	ATPase	NA	NA	NA	NA	NA
AUJ28474.1|1817994_1818720_+	hydrolase	NA	A0A1V0DZX6	Clostridioides_phage	47.2	5.6e-19
AUJ28475.1|1818873_1819806_+	hydrolase	NA	M9MUG9	Rhodococcus_phage	38.5	9.1e-14
AUJ28476.1|1820285_1820744_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ28477.1|1821293_1822559_-	GTPase HflX	NA	NA	NA	NA	NA
1820939:1820967	attR	ACATTTGTAAGCATGTTGGATATGATCCA	NA	NA	NA	NA
AUJ28478.1|1823034_1824096_+	transcriptional regulator	NA	A0A1X9I5X1	Streptococcus_phage	31.1	1.1e-15
AUJ28479.1|1824107_1824995_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AUJ28480.1|1825005_1825794_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AUJ28481.1|1825793_1826564_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AUJ28482.1|1826682_1827333_+	multidrug MFS transporter	NA	NA	NA	NA	NA
AUJ28483.1|1827347_1827797_+	UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase	NA	NA	NA	NA	NA
AUJ28484.1|1827809_1828304_+	glycosyltransferase	NA	NA	NA	NA	NA
AUJ28485.1|1828303_1829272_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ28486.1|1829342_1830458_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ28487.1|1830450_1831437_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ28488.1|1831461_1831926_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ28489.1|1832012_1832633_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ28490.1|1832644_1833766_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ28715.1|1833831_1834854_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ28491.1|1834897_1835755_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ28492.1|1835896_1837006_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	71.9	2.7e-158
AUJ28493.1|1837011_1838439_+	flippase	NA	NA	NA	NA	NA
AUJ28494.1|1838440_1839454_+	acetyltransferase	NA	NA	NA	NA	NA
AUJ28495.1|1839646_1840042_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ28716.1|1840156_1841335_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ28496.1|1843583_1845284_-|transposase	transposase	transposase	A0ZS58	Staphylococcus_virus	37.3	4.6e-88
>prophage 15
CP015444	Lactobacillus helveticus strain FAM8627 chromosome, complete genome	2035631	1853380	1916831	2035631	transposase,integrase	Streptococcus_phage(27.27%)	54	1857803:1857819	1911075:1911091
AUJ28502.1|1853380_1853569_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ28503.1|1853555_1853789_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ28504.1|1853877_1854096_-	ubiquitin	NA	NA	NA	NA	NA
AUJ28505.1|1854106_1854664_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ28506.1|1854843_1855893_-|integrase	integrase	integrase	H7BWC8	unidentified_phage	35.9	4.7e-51
AUJ28719.1|1856340_1857519_-|transposase	transposase	transposase	NA	NA	NA	NA
1857803:1857819	attL	TATTAGTAATTGATTCA	NA	NA	NA	NA
AUJ28507.1|1858224_1859796_-	ABC transporter ATP-binding protein/permease	NA	A0A076FI99	Aureococcus_anophage	23.6	4.5e-13
AUJ28508.1|1859802_1861389_-	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	21.8	5.4e-14
AUJ28509.1|1861399_1862242_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ28510.1|1862274_1863309_-	adenylyltransferase	NA	A0A1V0SCZ9	Indivirus	37.8	2.1e-06
AUJ28511.1|1863391_1864570_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ28512.1|1864683_1865700_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ28513.1|1865701_1866334_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ28514.1|1867021_1868359_-|transposase	transposase	transposase	S5VTD3	Leptospira_phage	34.4	7.4e-49
AUJ28720.1|1868333_1868564_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ28515.1|1868603_1868951_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ28516.1|1871215_1871494_-	RelB	NA	NA	NA	NA	NA
AUJ28517.1|1871597_1872206_+|integrase	integrase	integrase	D2XR58	Bacillus_phage	31.2	1.2e-17
AUJ28518.1|1872156_1872489_+	hypothetical protein	NA	NA	NA	NA	NA
AUJ28519.1|1872539_1872995_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ28520.1|1874310_1875717_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ28521.1|1876222_1876696_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
AUJ28522.1|1876849_1879135_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
AUJ28523.1|1879352_1880018_+	5,10-methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
AUJ28524.1|1880445_1881042_-|transposase	transposase	transposase	NA	NA	NA	NA
AUJ28525.1|1881257_1882334_+	guanine permease	NA	NA	NA	NA	NA
AUJ28526.1|1882336_1882894_+	adenine phosphoribosyltransferase	NA	NA	NA	NA	NA
AUJ28527.1|1883086_1884346_+|transposase	transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.4	5.4e-09
AUJ28528.1|1884586_1885813_+|transposase	transposase	transposase	A0A1X9I619	Streptococcus_phage	38.4	1.8e-65
AUJ28529.1|1886696_1887239_-	biotin biosynthesis protein BioY	NA	NA	NA	NA	NA
AUJ28530.1|1887312_1888302_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
AUJ28531.1|1888349_1889108_-	enoyl-[acyl-carrier-protein] reductase	NA	NA	NA	NA	NA
AUJ28532.1|1889166_1889937_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
AUJ28533.1|1889929_1890772_-	acetyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
AUJ28534.1|1890752_1892132_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AUJ28535.1|1892145_1892562_-	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
AUJ28536.1|1892566_1893037_-	acetyl-CoA carboxylase, biotin carboxyl carrier protein	NA	NA	NA	NA	NA
AUJ28537.1|1893040_1894270_-	beta-ketoacyl-[acyl-carrier-protein] synthase II	NA	NA	NA	NA	NA
AUJ28538.1|1894291_1895023_-	beta-ketoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.0	1.2e-13
AUJ28539.1|1895022_1895940_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
AUJ28540.1|1895949_1896192_-	acyl carrier protein	NA	NA	NA	NA	NA
AUJ28541.1|1896250_1897234_-	3-oxoacyl-ACP synthase	NA	NA	NA	NA	NA
AUJ28542.1|1897230_1897698_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AUJ28543.1|1897727_1898174_-	3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ	NA	NA	NA	NA	NA
AUJ28544.1|1899876_1900125_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ28545.1|1902104_1902491_+|transposase	transposase	transposase	NA	NA	NA	NA
AUJ28546.1|1902730_1903618_+	sugar transporter	NA	NA	NA	NA	NA
AUJ28547.1|1905899_1908167_-	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.1	2.4e-60
AUJ28548.1|1908631_1909150_-	acetyltransferase	NA	NA	NA	NA	NA
AUJ28549.1|1909493_1910720_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.0	2.0e-37
AUJ28550.1|1910777_1911101_-	hypothetical protein	NA	NA	NA	NA	NA
1911075:1911091	attR	TATTAGTAATTGATTCA	NA	NA	NA	NA
AUJ28551.1|1911357_1912107_-	hypothetical protein	NA	NA	NA	NA	NA
AUJ28552.1|1912535_1913582_-	fucose-binding lectin II	NA	NA	NA	NA	NA
AUJ28553.1|1915436_1916831_-|transposase	transposase	transposase	NA	NA	NA	NA
