The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028583	Klebsiella pneumoniae strain WCHKP36 chromosome, complete genome	5444817	451531	520909	5444817	head,tail,portal,integrase,protease,terminase,capsid,tRNA	uncultured_Caudovirales_phage(61.11%)	75	469139:469156	485134:485151
AWA09555.1|451531_452479_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
AWA09556.1|452493_453003_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
AWA09557.1|453131_454256_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
AWA09558.1|454227_454701_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
AWA09559.1|454726_455269_+	hypothetical protein	NA	NA	NA	NA	NA
AWA09560.1|455273_455846_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
AWA09561.1|455849_456668_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
AWA09562.1|456664_456922_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
AWA14170.1|456897_457452_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AWA09563.1|463247_463469_-	hypothetical protein	NA	NA	NA	NA	NA
AWA09564.1|463762_466873_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
AWA09565.1|466885_468025_-	MexX family efflux pump subunit	NA	NA	NA	NA	NA
AWA09566.1|468403_469054_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
469139:469156	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
AWA09567.1|469329_470556_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
AWA09568.1|470648_471590_+	hypothetical protein	NA	NA	NA	NA	NA
AWA09569.1|471771_472056_+	transcriptional regulator	NA	NA	NA	NA	NA
AWA09570.1|472066_472846_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
AWA09571.1|472969_473164_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AWA14171.1|473297_473567_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
AWA09572.1|473559_473748_+	hypothetical protein	NA	NA	NA	NA	NA
AWA09573.1|473740_474055_+	hypothetical protein	NA	NA	NA	NA	NA
AWA09574.1|474051_474420_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
AWA09575.1|474416_474782_+	hypothetical protein	NA	NA	NA	NA	NA
AWA09576.1|474781_476917_+	DNA primase	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
AWA09577.1|477259_477595_+	hypothetical protein	NA	NA	NA	NA	NA
AWA09578.1|477643_478156_-	hypothetical protein	NA	NA	NA	NA	NA
AWA09579.1|478419_479586_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
AWA09580.1|479637_480198_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
AWA09581.1|480199_481441_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
AWA09582.1|481437_481773_+|head,tail	head-tail adaptor	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
AWA09583.1|481769_482069_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
AWA09584.1|482068_482512_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
AWA09585.1|482638_482830_+|terminase	terminase	terminase	NA	NA	NA	NA
AWA09586.1|482787_483144_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
AWA09587.1|483127_484789_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
AWA09588.1|484791_484983_+	hypothetical protein	NA	NA	NA	NA	NA
AWA09589.1|485136_485433_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
485134:485151	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
AWA09590.1|485457_486423_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
AWA09591.1|486580_486775_-	hypothetical protein	NA	NA	NA	NA	NA
AWA09592.1|486780_487662_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AWA09593.1|487673_489125_-	sodium/panthothenate symporter	NA	NA	NA	NA	NA
AWA09594.1|489114_489357_-	hypothetical protein	NA	NA	NA	NA	NA
AWA09595.1|489467_490817_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AWA09596.1|490827_491295_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
AWA09597.1|491317_491770_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AWA09598.1|491993_492602_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
AWA09599.1|492601_493603_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
AWA09600.1|493831_494023_+	hypothetical protein	NA	NA	NA	NA	NA
AWA09601.1|494102_496043_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
AWA09602.1|496164_496371_-	hypothetical protein	NA	NA	NA	NA	NA
AWA09603.1|496348_497392_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
AWA09604.1|497462_498455_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AWA09605.1|498454_498943_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AWA09606.1|498950_499532_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AWA09607.1|499534_501004_+	ribonuclease G	NA	NA	NA	NA	NA
AWA09608.1|501041_504839_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
AWA09609.1|504927_506373_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AWA09610.1|506408_507338_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
AWA09611.1|507469_507673_+	protein AaeX	NA	NA	NA	NA	NA
AWA09612.1|507680_508613_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
AWA09613.1|508618_510586_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
AWA09614.1|510665_510941_+	hypothetical protein	NA	NA	NA	NA	NA
AWA09615.1|510991_511258_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AWA09616.1|511356_511620_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AWA09617.1|511995_512466_-	arginine repressor	NA	NA	NA	NA	NA
AWA09618.1|512880_513819_+	malate dehydrogenase	NA	NA	NA	NA	NA
AWA09619.1|513955_515014_-|protease	serine endoprotease DegS	protease	NA	NA	NA	NA
AWA09620.1|515101_516469_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
AWA09621.1|516642_517041_-	DUF1043 domain-containing protein	NA	NA	NA	NA	NA
AWA09622.1|517231_518359_+	cell division protein ZapE	NA	NA	NA	NA	NA
AWA09623.1|518624_519053_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
AWA09624.1|519068_519461_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
AWA09625.1|519570_519774_-	hypothetical protein	NA	NA	NA	NA	NA
AWA09626.1|519772_520411_+	stringent starvation protein A	NA	NA	NA	NA	NA
AWA09627.1|520414_520909_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
>prophage 2
CP028583	Klebsiella pneumoniae strain WCHKP36 chromosome, complete genome	5444817	1238371	1264426	5444817	transposase,integrase	Salmonella_phage(44.12%)	39	1229467:1229481	1266961:1266975
1229467:1229481	attL	GCCAGCACCCGCGCG	NA	NA	NA	NA
AWA10320.1|1238371_1239352_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AWA10321.1|1239397_1240396_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	94.5	2.2e-183
AWA10322.1|1240398_1241028_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
AWA10323.1|1241150_1241393_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
AWA10324.1|1241425_1241935_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
AWA10325.1|1241942_1242143_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
AWA10326.1|1242106_1242445_+	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
AWA10327.1|1242512_1242746_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
AWA10328.1|1242745_1242973_+	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
AWA10329.1|1242969_1243821_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
AWA10330.1|1243817_1246202_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
AWA10331.1|1246431_1246683_+	hypothetical protein	NA	NA	NA	NA	NA
AWA10332.1|1246682_1248167_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AWA10333.1|1248263_1248602_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	1.8e-44
AWA14198.1|1248594_1248798_-	hypothetical protein	NA	NA	NA	NA	NA
AWA10334.1|1248797_1249418_-	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	40.7	1.0e-29
AWA10335.1|1249414_1249708_-	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	86.6	2.7e-44
AWA14199.1|1249707_1250175_-	hypothetical protein	NA	A0A2R2Z312	Escherichia_phage	51.7	1.3e-37
AWA10336.1|1250468_1251113_-	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	79.3	8.0e-110
AWA10337.1|1251109_1251301_-	hypothetical protein	NA	NA	NA	NA	NA
AWA10338.1|1251284_1251695_-	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	45.1	4.3e-16
AWA10339.1|1251887_1252235_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	6.5e-50
AWA10340.1|1252354_1253140_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
AWA10341.1|1253136_1253904_-	primosomal protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
AWA10342.1|1253903_1254113_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
AWA10343.1|1254259_1254493_-	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
AWA10344.1|1254647_1255229_+	XRE family transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
AWA10345.1|1255595_1255895_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
AWA10346.1|1255891_1256713_+	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	80.2	1.8e-130
AWA10347.1|1256709_1257591_+	recombinase RecT	NA	T1SBJ5	Salmonella_phage	84.3	8.9e-136
AWA10348.1|1257639_1257888_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	76.8	4.9e-31
AWA10349.1|1257997_1258291_+	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
AWA10350.1|1258283_1258442_+	DUF1317 domain-containing protein	NA	T1SAR0	Salmonella_phage	78.8	1.1e-17
AWA10351.1|1258438_1259101_+	hypothetical protein	NA	A0A059VF56	Pseudomonas_phage	46.6	1.2e-47
AWA10352.1|1259097_1259691_+	adenine methylase	NA	T1SA14	Salmonella_phage	91.9	6.3e-109
AWA10353.1|1259687_1259930_+	hypothetical protein	NA	NA	NA	NA	NA
AWA10354.1|1259872_1261123_-	DUF4102 domain-containing protein	NA	A0A1X9TCT6	Enterobacter_phage	84.4	5.8e-205
AWA10355.1|1261314_1262892_-	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
AWA10356.1|1262959_1264426_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
1266961:1266975	attR	GCCAGCACCCGCGCG	NA	NA	NA	NA
>prophage 3
CP028583	Klebsiella pneumoniae strain WCHKP36 chromosome, complete genome	5444817	1335776	1444974	5444817	coat,lysis,tail,head,transposase,plate,portal,holin,terminase,capsid,tRNA	Salmonella_phage(60.0%)	114	NA	NA
AWA10419.1|1335776_1336514_-|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
AWA10420.1|1336645_1337977_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
AWA10421.1|1338022_1338406_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
AWA10422.1|1338719_1339409_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
AWA10423.1|1339466_1340552_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AWA10424.1|1340755_1341181_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
AWA10425.1|1341250_1341949_+	DTW domain-containing protein	NA	NA	NA	NA	NA
AWA10426.1|1341983_1344635_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AWA10427.1|1344755_1346111_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AWA10428.1|1346152_1346476_+	hypothetical protein	NA	NA	NA	NA	NA
AWA10429.1|1346479_1347778_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	3.1e-44
AWA10430.1|1353743_1356317_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
AWA10431.1|1356446_1357178_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AWA10432.1|1357174_1358155_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AWA10433.1|1358286_1359024_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AWA10434.1|1359294_1359630_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AWA14201.1|1359736_1359784_+	hypothetical protein	NA	NA	NA	NA	NA
AWA10435.1|1359884_1361045_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AWA10436.1|1361041_1361914_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
AWA10437.1|1361976_1363098_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AWA10438.1|1363107_1364178_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
AWA10439.1|1364520_1365030_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
AWA10440.1|1365022_1366246_+	diguanylate cyclase	NA	NA	NA	NA	NA
AWA10441.1|1366259_1366742_+	hypothetical protein	NA	NA	NA	NA	NA
AWA10442.1|1366750_1368121_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
AWA10443.1|1368177_1368636_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
AWA10444.1|1368755_1369103_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AWA10445.1|1369142_1369910_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AWA10446.1|1369941_1370490_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AWA10447.1|1370508_1370757_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AWA10448.1|1371016_1372381_-	signal recognition particle protein	NA	NA	NA	NA	NA
AWA10449.1|1372544_1373336_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
AWA10450.1|1373355_1374642_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AWA10451.1|1374761_1375352_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AWA10452.1|1375476_1376355_+	NAD(+) kinase	NA	NA	NA	NA	NA
AWA10453.1|1376441_1378103_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AWA10454.1|1378250_1378592_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AWA10455.1|1378658_1378949_-	RnfH family protein	NA	NA	NA	NA	NA
AWA10456.1|1378938_1379415_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AWA10457.1|1379525_1380008_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
AWA10458.1|1380611_1380989_+	hypothetical protein	NA	NA	NA	NA	NA
AWA10459.1|1381016_1381235_-	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
AWA10460.1|1381301_1382396_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
AWA10461.1|1382392_1382878_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
AWA10462.1|1382874_1385505_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
AWA10463.1|1385497_1385617_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AWA10464.1|1385631_1385931_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
AWA10465.1|1385983_1386499_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
AWA10466.1|1386508_1387681_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
AWA10467.1|1387829_1388903_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
AWA10468.1|1388954_1390073_-	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
AWA10469.1|1390082_1392032_-|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
AWA14202.1|1392033_1392705_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
AWA10470.1|1392697_1393606_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
AWA10471.1|1393592_1393955_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
AWA10472.1|1393951_1394524_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
AWA10473.1|1394618_1395485_+	hypothetical protein	NA	NA	NA	NA	NA
AWA10474.1|1395507_1395954_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
AWA10475.1|1395946_1396369_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
AWA10476.1|1396331_1396535_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	77.6	3.0e-23
AWA10477.1|1396464_1396893_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
AWA10478.1|1396889_1397273_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
AWA10479.1|1397277_1397787_-	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
AWA14203.1|1397767_1397983_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
AWA10480.1|1397986_1398190_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
AWA10481.1|1398189_1398654_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
AWA10482.1|1398749_1399403_-	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
AWA10483.1|1399406_1400459_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
AWA10484.1|1400475_1401309_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
AWA10485.1|1401449_1403213_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
AWA10486.1|1403212_1404256_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
AWA14204.1|1404312_1404582_-	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
AWA10487.1|1405103_1406105_+	hypothetical protein	NA	NA	NA	NA	NA
AWA10488.1|1406104_1407184_+	hypothetical protein	NA	NA	NA	NA	NA
AWA10489.1|1407170_1407854_+	hypothetical protein	NA	NA	NA	NA	NA
AWA10490.1|1407949_1408183_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
AWA10491.1|1408194_1408383_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
AWA10492.1|1408490_1409975_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AWA10493.1|1409974_1410226_-	hypothetical protein	NA	NA	NA	NA	NA
AWA14205.1|1410378_1410636_+	lF-82	NA	NA	NA	NA	NA
AWA10494.1|1410713_1411298_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.6	2.2e-90
AWA10495.1|1411294_1412770_+|terminase	terminase	terminase	Q858H3	Salmonella_phage	93.1	6.4e-280
AWA10496.1|1412813_1413185_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	91.9	3.7e-59
AWA10497.1|1413234_1413477_+	hypothetical protein	NA	NA	NA	NA	NA
AWA10498.1|1413938_1414145_+	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
AWA10499.1|1414159_1415842_+|tail	phage tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.4	1.5e-264
AWA10500.1|1415838_1416135_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
AWA10501.1|1416137_1416818_+	peptidase	NA	G9L6C4	Escherichia_phage	84.0	6.1e-76
AWA10502.1|1416832_1417819_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	94.2	2.5e-179
AWA10503.1|1417872_1418310_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.7	1.3e-66
AWA10504.1|1418320_1418662_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	2.4e-36
AWA10505.1|1418712_1419036_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
AWA10506.1|1419035_1419641_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	77.0	4.0e-87
AWA10507.1|1419640_1422118_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.4	0.0e+00
AWA10508.1|1422117_1422582_+	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
AWA10509.1|1422581_1423121_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	8.0e-71
AWA10510.1|1423131_1425666_+	hypothetical protein	NA	Q858G0	Salmonella_phage	84.1	0.0e+00
AWA10511.1|1425665_1427576_+	hypothetical protein	NA	Q858F9	Salmonella_phage	82.7	5.4e-287
AWA10512.1|1427575_1430332_+	hypothetical protein	NA	Q858F8	Salmonella_phage	95.4	0.0e+00
AWA10513.1|1430328_1430523_+	hypothetical protein	NA	Q858F7	Salmonella_phage	67.2	6.5e-15
AWA10514.1|1430557_1430710_-	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	83.7	2.5e-14
AWA10515.1|1430808_1431105_-	hypothetical protein	NA	T1SA06	Salmonella_phage	63.9	6.9e-24
AWA10516.1|1433932_1434196_+	hypothetical protein	NA	NA	NA	NA	NA
AWA10517.1|1434236_1435370_-	hypothetical protein	NA	NA	NA	NA	NA
AWA14206.1|1435358_1435445_+	ABC transporter	NA	NA	NA	NA	NA
AWA10518.1|1435483_1436464_-|transposase	IS5 family transposase ISKpn26	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
AWA10519.1|1437332_1438595_-|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AWA10520.1|1439485_1439626_-	ABC transporter	NA	NA	NA	NA	NA
AWA10521.1|1439703_1441020_+	right-handed parallel beta-helix repeat-containing protein	NA	A0A0K2FI18	Enterobacter_phage	32.3	2.3e-34
AWA10522.1|1441106_1441511_+	hypothetical protein	NA	T1SA79	Salmonella_phage	81.1	8.7e-54
AWA10523.1|1441497_1441803_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	2.7e-39
AWA10524.1|1441792_1442422_+	endolysin	NA	Q858F0	Salmonella_phage	76.9	1.8e-90
AWA10525.1|1442418_1442919_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	76.9	1.3e-59
AWA10526.1|1443105_1444974_-	phosphatase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
>prophage 4
CP028583	Klebsiella pneumoniae strain WCHKP36 chromosome, complete genome	5444817	1777325	1784230	5444817		Planktothrix_phage(33.33%)	6	NA	NA
AWA14222.1|1777325_1778189_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	7.4e-10
AWA10812.1|1778199_1778973_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
AWA14223.1|1779213_1780107_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
AWA10813.1|1780352_1781714_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
AWA10814.1|1782032_1782755_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AWA10815.1|1782751_1784230_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.9e-29
>prophage 5
CP028583	Klebsiella pneumoniae strain WCHKP36 chromosome, complete genome	5444817	1827575	1839250	5444817	transposase	Escherichia_phage(33.33%)	10	NA	NA
AWA10844.1|1827575_1828982_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
AWA10845.1|1829208_1830624_+	mannose-1-phosphate guanylyltransferase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
AWA10846.1|1830645_1832016_+	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	25.9	6.4e-32
AWA14226.1|1832170_1833235_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	9.8e-105
AWA10847.1|1833248_1834118_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	66.7	1.7e-110
AWA10848.1|1834149_1835040_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
AWA10849.1|1835054_1835609_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	2.9e-52
AWA10850.1|1835788_1836955_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	9.1e-112
AWA10851.1|1837317_1838229_+	acyltransferase	NA	NA	NA	NA	NA
AWA10852.1|1838269_1839250_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 6
CP028583	Klebsiella pneumoniae strain WCHKP36 chromosome, complete genome	5444817	2831555	2842442	5444817		Escherichia_phage(87.5%)	9	NA	NA
AWA11774.1|2831555_2834663_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
AWA11775.1|2834717_2835983_+	MFS transporter	NA	NA	NA	NA	NA
AWA11776.1|2836013_2837102_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
AWA11777.1|2837188_2837449_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
AWA11778.1|2837746_2838607_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AWA11779.1|2838627_2839389_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AWA11780.1|2839649_2840552_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
AWA11781.1|2840563_2841829_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
AWA11782.1|2841821_2842442_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 7
CP028583	Klebsiella pneumoniae strain WCHKP36 chromosome, complete genome	5444817	3025843	3163617	5444817	lysis,tail,head,transposase,plate,integrase,protease,holin,terminase	uncultured_Caudovirales_phage(21.43%)	158	3051413:3051430	3172057:3172074
AWA11954.1|3025843_3026929_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AWA11955.1|3026892_3028647_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AWA11956.1|3030318_3033744_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
AWA11957.1|3033727_3034867_-	hypothetical protein	NA	NA	NA	NA	NA
AWA11958.1|3034863_3035121_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
AWA11959.1|3035165_3037583_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
AWA11960.1|3037570_3038101_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AWA11961.1|3038168_3038699_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AWA11962.1|3038767_3039298_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AWA11963.1|3039365_3039896_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AWA11964.1|3039964_3040495_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AWA11965.1|3040558_3041338_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AWA11966.1|3041338_3043717_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.8	9.2e-18
AWA11967.1|3043709_3046364_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	2.5e-96
AWA11968.1|3046628_3047120_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AWA11969.1|3047124_3048831_-	OmpA family protein	NA	NA	NA	NA	NA
AWA11970.1|3048827_3049517_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AWA14277.1|3049513_3050854_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AWA11971.1|3050866_3052411_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
3051413:3051430	attL	ATCTTTCACCGCGCCGCC	NA	NA	NA	NA
AWA11972.1|3052453_3052945_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AWA11973.1|3054432_3054576_-	ABC transporter	NA	NA	NA	NA	NA
AWA11974.1|3054989_3055238_+	damage-inducible protein DinI	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
AWA11975.1|3055460_3055745_-	hypothetical protein	NA	NA	NA	NA	NA
AWA11976.1|3055849_3056059_-	hypothetical protein	NA	NA	NA	NA	NA
AWA11977.1|3056055_3056787_-	hypothetical protein	NA	NA	NA	NA	NA
AWA14278.1|3056797_3057526_-	hypothetical protein	NA	NA	NA	NA	NA
AWA11978.1|3059876_3060074_-	hypothetical protein	NA	NA	NA	NA	NA
AWA11979.1|3060073_3060940_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
AWA11980.1|3060939_3061713_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
AWA11981.1|3061709_3062906_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
AWA11982.1|3062905_3063259_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
AWA11983.1|3063260_3063914_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
AWA11984.1|3063967_3064534_-	hypothetical protein	NA	NA	NA	NA	NA
AWA11985.1|3064570_3064756_+	hypothetical protein	NA	NA	NA	NA	NA
AWA11986.1|3064808_3065150_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
AWA11987.1|3065149_3066172_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
AWA11988.1|3066174_3066477_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
AWA11989.1|3066477_3067077_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
AWA11990.1|3067076_3069080_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
AWA11991.1|3069069_3069222_-	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
AWA11992.1|3069257_3069683_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
AWA11993.1|3069686_3070127_-	DUF3277 domain-containing protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
AWA11994.1|3070137_3071283_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
AWA11995.1|3071286_3071727_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
AWA11996.1|3071821_3072208_-|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
AWA11997.1|3072207_3072714_-	hypothetical protein	NA	NA	NA	NA	NA
AWA11998.1|3072710_3073130_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
AWA11999.1|3073098_3073380_-	hypothetical protein	NA	NA	NA	NA	NA
AWA12000.1|3073419_3074361_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
AWA12001.1|3074372_3074867_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
AWA12002.1|3074870_3076073_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
AWA14279.1|3076124_3076673_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
AWA12003.1|3076728_3078180_-	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
AWA12004.1|3078417_3079818_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
AWA12005.1|3079768_3080521_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
AWA12006.1|3080622_3080943_-	negative regulator GrlR	NA	NA	NA	NA	NA
AWA12007.1|3081177_3081567_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
AWA12008.1|3081563_3082094_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
AWA12009.1|3082096_3082345_-|lysis	lysis protein	lysis	NA	NA	NA	NA
AWA12010.1|3082750_3083533_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
AWA12011.1|3083529_3084006_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
AWA12012.1|3084002_3084965_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
AWA12013.1|3084966_3086625_-	helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
AWA12014.1|3086933_3087227_-	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	97.6	2.8e-38
AWA12015.1|3087201_3087423_-	XRE family transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
AWA12016.1|3087520_3088189_+	LexA family transcriptional repressor	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
AWA12017.1|3088359_3088674_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
AWA12018.1|3088666_3088855_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
AWA12019.1|3089024_3089390_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
AWA12020.1|3089382_3089637_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
AWA12021.1|3089823_3090249_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
AWA12022.1|3090245_3090440_+	hypothetical protein	NA	NA	NA	NA	NA
AWA12023.1|3090436_3091264_+|protease	serine protease	protease	Q8W654	Enterobacteria_phage	84.0	5.5e-111
AWA12024.1|3091368_3091887_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
AWA12025.1|3091892_3092603_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
AWA12026.1|3092592_3092817_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
AWA12027.1|3092813_3093026_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
AWA12028.1|3093022_3093502_+	hypothetical protein	NA	NA	NA	NA	NA
AWA12029.1|3093680_3093923_+	AlpA family transcriptional regulator	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
AWA12030.1|3093903_3095085_-	DUF4102 domain-containing protein	NA	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
AWA12031.1|3095281_3095830_+|protease	protease	protease	NA	NA	NA	NA
AWA12032.1|3096028_3097561_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
AWA12033.1|3097777_3098539_-	3-oxoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
AWA12034.1|3098647_3099562_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWA12035.1|3099862_3100051_+	cold-shock protein	NA	NA	NA	NA	NA
AWA12036.1|3100121_3100430_-	anti-sigma regulatory factor	NA	NA	NA	NA	NA
AWA12037.1|3100435_3100573_+	glycosyl hydrolase family 2	NA	NA	NA	NA	NA
AWA12038.1|3100597_3101467_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	5.7e-50
AWA12039.1|3101545_3102748_-	MFS transporter	NA	NA	NA	NA	NA
AWA12040.1|3102820_3103957_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWA12041.1|3104129_3105014_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWA12042.1|3105138_3105972_-	hypothetical protein	NA	NA	NA	NA	NA
AWA12043.1|3106202_3106589_+	glyoxalase	NA	NA	NA	NA	NA
AWA12044.1|3106756_3108373_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWA12045.1|3108558_3109266_+	murein tripeptide amidase MpaA	NA	NA	NA	NA	NA
AWA12046.1|3109262_3110228_-	L-Ala-D/L-Glu epimerase	NA	NA	NA	NA	NA
AWA12047.1|3110330_3110837_+	thiol peroxidase	NA	NA	NA	NA	NA
AWA14280.1|3110907_3111930_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
AWA12048.1|3112061_3113603_-	transcriptional regulator TyrR	NA	NA	NA	NA	NA
AWA12049.1|3113775_3115089_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AWA12050.1|3115220_3116102_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWA12051.1|3116191_3117253_-	TIGR01620 family protein	NA	NA	NA	NA	NA
AWA12052.1|3117249_3118647_-	YcjX family protein	NA	NA	NA	NA	NA
AWA12053.1|3118749_3118968_-	phage shock protein D	NA	NA	NA	NA	NA
AWA12054.1|3118996_3119356_-	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
AWA12055.1|3119355_3119580_-	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
AWA12056.1|3119635_3120304_-	phage shock protein PspA	NA	NA	NA	NA	NA
AWA12057.1|3120471_3121446_+	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
AWA12058.1|3121436_3122828_-	MFS transporter	NA	NA	NA	NA	NA
AWA12059.1|3122853_3124023_-	amidohydrolase	NA	NA	NA	NA	NA
AWA12060.1|3124194_3126504_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWA12061.1|3126482_3127313_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWA12062.1|3127423_3128329_+	NAD-dependent dehydratase	NA	NA	NA	NA	NA
AWA12063.1|3128662_3130306_+	peptide ABC transporter substrate-binding protein SapA	NA	NA	NA	NA	NA
AWA12064.1|3130302_3131268_+	peptide ABC transporter permease SapB	NA	NA	NA	NA	NA
AWA12065.1|3131472_3132144_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
AWA14281.1|3132330_3133158_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
AWA12066.1|3133233_3134499_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
AWA12067.1|3134500_3134920_-	translesion error-prone DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
AWA12068.1|3134999_3136484_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AWA12069.1|3136483_3136735_-	hypothetical protein	NA	NA	NA	NA	NA
AWA12070.1|3137381_3137804_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
AWA12071.1|3138396_3139101_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWA12072.1|3139716_3140064_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AWA14282.1|3140227_3141019_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AWA12073.1|3142000_3142705_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWA12074.1|3142741_3143029_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	95.4	4.4e-36
AWA12075.1|3143025_3143565_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
AWA12076.1|3143561_3143873_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	3.8e-49
AWA12077.1|3144339_3145386_-|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
AWA14283.1|3145611_3146301_-	antiterminator	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
AWA12078.1|3146300_3146441_-	YlcG family protein	NA	NA	NA	NA	NA
AWA12079.1|3146437_3147076_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
AWA12080.1|3147068_3147737_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
AWA12081.1|3147733_3147901_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
AWA12082.1|3147881_3148349_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
AWA12083.1|3148869_3149898_+	hypothetical protein	NA	NA	NA	NA	NA
AWA12084.1|3150105_3150351_-	hypothetical protein	NA	NA	NA	NA	NA
AWA12085.1|3150406_3150709_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWA12086.1|3150705_3151554_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
AWA12087.1|3151550_3152411_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
AWA12088.1|3152496_3152718_-	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
AWA12089.1|3152758_3152986_-	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
AWA14284.1|3153097_3153796_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
AWA12090.1|3153818_3153938_+	hypothetical protein	NA	NA	NA	NA	NA
AWA12091.1|3154083_3155160_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
AWA12092.1|3155241_3155445_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
AWA12093.1|3155873_3156068_+	hypothetical protein	NA	NA	NA	NA	NA
AWA12094.1|3156156_3156441_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
AWA12095.1|3156456_3157302_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
AWA12096.1|3157587_3158268_+	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
AWA12097.1|3158264_3158693_+	regulator	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
AWA12098.1|3158689_3159352_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
AWA12099.1|3159348_3159663_+	hypothetical protein	NA	K7PM28	Enterobacteria_phage	50.8	1.6e-10
AWA14285.1|3159559_3160747_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
AWA12100.1|3160923_3161814_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
AWA12101.1|3161813_3162806_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
AWA12102.1|3162807_3163617_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
3172057:3172074	attR	ATCTTTCACCGCGCCGCC	NA	NA	NA	NA
>prophage 8
CP028583	Klebsiella pneumoniae strain WCHKP36 chromosome, complete genome	5444817	3291289	3379168	5444817	head,tail,portal,integrase,holin,terminase,capsid,tRNA	Klebsiella_phage(45.45%)	96	3318092:3318106	3376979:3376993
AWA12222.1|3291289_3291790_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
AWA12223.1|3291906_3292353_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AWA14290.1|3292336_3293128_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWA12224.1|3293229_3294414_+	cyanate MFS transporter	NA	NA	NA	NA	NA
AWA12225.1|3294445_3295138_-	hypothetical protein	NA	NA	NA	NA	NA
AWA12226.1|3295283_3295793_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
AWA12227.1|3295779_3296136_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AWA12228.1|3296125_3296365_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AWA12229.1|3296665_3297679_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.4e-12
AWA12230.1|3297736_3297838_+	hypothetical protein	NA	NA	NA	NA	NA
AWA14291.1|3297837_3297912_+	hypothetical protein	NA	NA	NA	NA	NA
AWA12231.1|3298029_3298155_+	hypothetical protein	NA	NA	NA	NA	NA
AWA12232.1|3298214_3298478_-	DUF2534 domain-containing protein	NA	NA	NA	NA	NA
AWA12233.1|3298608_3299247_-	leucine efflux protein	NA	NA	NA	NA	NA
AWA12234.1|3299336_3300251_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
AWA12235.1|3300466_3300658_+	hypothetical protein	NA	NA	NA	NA	NA
AWA12236.1|3300912_3301956_-	type II asparaginase	NA	NA	NA	NA	NA
AWA12237.1|3302258_3303467_+	phosphodiesterase	NA	NA	NA	NA	NA
AWA12238.1|3303540_3305325_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
AWA12239.1|3305331_3306222_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWA12240.1|3306342_3307851_+	3,4-dihydroxybenzoate decarboxylase	NA	NA	NA	NA	NA
AWA12241.1|3308161_3308848_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AWA12242.1|3309245_3309425_-	hypothetical protein	NA	NA	NA	NA	NA
AWA12243.1|3309464_3310097_-	DNA-binding protein	NA	NA	NA	NA	NA
AWA12244.1|3310663_3310861_+	hypothetical protein	NA	NA	NA	NA	NA
AWA12245.1|3310976_3311987_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AWA12246.1|3311983_3313390_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AWA12247.1|3313445_3314333_-	manganese catalase family protein	NA	NA	NA	NA	NA
AWA12248.1|3314349_3314856_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AWA12249.1|3314882_3315377_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AWA12250.1|3315467_3315653_-	stress-induced acidophilic repeat motif-containing protein	NA	NA	NA	NA	NA
AWA12251.1|3316274_3317468_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
AWA12252.1|3317580_3317808_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
3318092:3318106	attL	TGGCTGGCGTTCTTT	NA	NA	NA	NA
AWA12253.1|3318244_3318568_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AWA12254.1|3318560_3318953_+	amino acid-binding protein	NA	NA	NA	NA	NA
AWA12255.1|3318949_3319663_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AWA12256.1|3319935_3320088_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
AWA12257.1|3320242_3321739_-|tail	phage tail protein	tail	A0A0P0IDN1	Klebsiella_phage	63.7	1.4e-125
AWA12258.1|3321807_3334512_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	47.1	0.0e+00
AWA12259.1|3334574_3335168_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	76.6	8.0e-80
AWA12260.1|3335194_3335617_-	hypothetical protein	NA	J9Q806	Salmonella_phage	50.0	5.9e-29
AWA12261.1|3335658_3336369_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	90.3	1.9e-136
AWA12262.1|3336370_3337126_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.5	4.6e-125
AWA12263.1|3337122_3337461_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	1.4e-57
AWA12264.1|3337460_3340796_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	88.3	0.0e+00
AWA12265.1|3340795_3341014_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	90.5	5.4e-34
AWA12266.1|3341028_3341394_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
AWA12267.1|3341451_3341913_-|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
AWA12268.1|3341944_3342346_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	2.3e-62
AWA12269.1|3342342_3342732_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
AWA12270.1|3342712_3343051_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	90.2	2.8e-53
AWA12271.1|3343047_3343365_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
AWA12272.1|3343345_3343606_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	60.5	7.4e-22
AWA12273.1|3343664_3344951_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.0	9.8e-216
AWA12274.1|3345028_3345949_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
AWA12275.1|3345985_3347245_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.8	1.8e-222
AWA12276.1|3347244_3347424_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	3.1e-11
AWA12277.1|3347417_3349139_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.5e-190
AWA12278.1|3349138_3349573_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
AWA12279.1|3349821_3350253_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.6	1.8e-41
AWA12280.1|3350249_3350573_-	hypothetical protein	NA	NA	NA	NA	NA
AWA12281.1|3350524_3350887_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
AWA12282.1|3351213_3351438_+	hypothetical protein	NA	NA	NA	NA	NA
AWA12283.1|3351476_3351914_-	hypothetical protein	NA	NA	NA	NA	NA
AWA12284.1|3352863_3353214_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	38.1	7.9e-11
AWA12285.1|3353210_3353708_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.6	1.1e-77
AWA12286.1|3353707_3353923_-|holin	holin	holin	A5LH82	Enterobacteria_phage	88.7	2.7e-30
AWA12287.1|3356174_3356777_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.6	1.1e-76
AWA12288.1|3356793_3357825_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	4.7e-96
AWA12289.1|3357824_3358028_-	hypothetical protein	NA	NA	NA	NA	NA
AWA12290.1|3358024_3358417_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	8.0e-12
AWA12291.1|3358457_3358748_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	8.0e-17
AWA12292.1|3358759_3358993_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	3.7e-25
AWA12293.1|3359071_3360556_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AWA12294.1|3360555_3360807_-	hypothetical protein	NA	NA	NA	NA	NA
AWA12295.1|3361396_3362758_-	dGTPase	NA	NA	NA	NA	NA
AWA12296.1|3362931_3363645_-	hypothetical protein	NA	NA	NA	NA	NA
AWA14292.1|3363996_3364866_+	hypothetical protein	NA	NA	NA	NA	NA
AWA12297.1|3364954_3366346_+	hypothetical protein	NA	NA	NA	NA	NA
AWA12298.1|3366694_3367135_-	hypothetical protein	NA	NA	NA	NA	NA
AWA12299.1|3367148_3367613_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	72.2	4.1e-63
AWA14293.1|3367605_3368610_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	40.0	1.4e-31
AWA12300.1|3368669_3369224_-	hypothetical protein	NA	NA	NA	NA	NA
AWA12301.1|3369226_3369451_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	62.5	1.3e-19
AWA12302.1|3369539_3369977_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	62.2	1.3e-39
AWA12303.1|3370298_3370613_-	hypothetical protein	NA	NA	NA	NA	NA
AWA12304.1|3370775_3370994_+	hypothetical protein	NA	NA	NA	NA	NA
AWA12305.1|3371003_3371198_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWA12306.1|3371240_3371585_+	transcriptional regulator	NA	NA	NA	NA	NA
AWA12307.1|3371726_3373865_+	exonuclease	NA	S4TNL0	Salmonella_phage	42.7	5.6e-99
AWA12308.1|3373917_3374163_+	excisionase	NA	NA	NA	NA	NA
AWA12309.1|3374143_3375271_+|integrase	integrase	integrase	O21925	Phage_21	58.4	4.4e-119
AWA12310.1|3375388_3376639_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
AWA12311.1|3376879_3377530_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
3376979:3376993	attR	AAAGAACGCCAGCCA	NA	NA	NA	NA
AWA12312.1|3377546_3378005_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AWA14294.1|3378061_3379168_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 9
CP028583	Klebsiella pneumoniae strain WCHKP36 chromosome, complete genome	5444817	3595147	3688097	5444817	lysis,tail,head,plate,portal,integrase,protease,capsid,tRNA	Salmonella_phage(57.89%)	96	3633740:3633755	3690530:3690545
AWA12506.1|3595147_3596440_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
AWA12507.1|3596530_3597874_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
AWA12508.1|3597882_3598494_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AWA12509.1|3598616_3602870_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
AWA12510.1|3603005_3603500_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AWA12511.1|3604032_3605001_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
AWA12512.1|3605115_3606882_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
AWA12513.1|3606882_3608604_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
AWA12514.1|3608648_3609350_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AWA12515.1|3609703_3609922_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AWA12516.1|3610042_3612322_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AWA12517.1|3612352_3612670_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AWA12518.1|3612995_3613217_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AWA12519.1|3613171_3613354_-	hypothetical protein	NA	NA	NA	NA	NA
AWA12520.1|3613293_3615234_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AWA12521.1|3615230_3616346_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
AWA12522.1|3616492_3618151_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AWA12523.1|3618570_3619266_+	aquaporin Z	NA	NA	NA	NA	NA
AWA12524.1|3619381_3620281_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
AWA14303.1|3620424_3622077_+	hydroxylamine reductase	NA	NA	NA	NA	NA
AWA12525.1|3622087_3623056_+	NADH oxidoreductase	NA	NA	NA	NA	NA
AWA12526.1|3623006_3623210_+	hypothetical protein	NA	NA	NA	NA	NA
AWA12527.1|3623267_3623702_-	DoxX family protein	NA	NA	NA	NA	NA
AWA14304.1|3623853_3625572_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
AWA12528.1|3625610_3626612_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AWA12529.1|3626622_3628065_+	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
AWA12530.1|3628152_3629166_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AWA12531.1|3629162_3629993_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
AWA12532.1|3630024_3631164_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AWA12533.1|3631216_3631396_+	hypothetical protein	NA	NA	NA	NA	NA
AWA12534.1|3632041_3632557_+	lipoprotein	NA	NA	NA	NA	NA
AWA12535.1|3632783_3633512_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
AWA14305.1|3633532_3634264_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
3633740:3633755	attL	GACAGCCTGATCCCGG	NA	NA	NA	NA
AWA12536.1|3634270_3634987_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
AWA12537.1|3634986_3635655_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
AWA12538.1|3635838_3636570_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWA12539.1|3636612_3638085_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
AWA12540.1|3638081_3638798_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
AWA12541.1|3638876_3640004_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
AWA12542.1|3640045_3640534_-	DUF2593 domain-containing protein	NA	NA	NA	NA	NA
AWA12543.1|3640591_3641437_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AWA12544.1|3641433_3642387_-	putrescine ABC transporter permease	NA	NA	NA	NA	NA
AWA14306.1|3642397_3643531_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
AWA12545.1|3643694_3644807_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AWA12546.1|3645155_3645635_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AWA12547.1|3645723_3646626_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
AWA12548.1|3647447_3647735_-	hypothetical protein	NA	NA	NA	NA	NA
AWA12549.1|3647937_3648201_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
AWA12550.1|3648207_3648591_-	hypothetical protein	NA	NA	NA	NA	NA
AWA14307.1|3648857_3650543_+	transporter	NA	NA	NA	NA	NA
AWA12551.1|3650762_3650981_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AWA12552.1|3651072_3652173_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
AWA12553.1|3652169_3652655_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
AWA12554.1|3652651_3655279_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
AWA12555.1|3655271_3655391_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AWA12556.1|3655405_3655705_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
AWA12557.1|3655757_3656273_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
AWA12558.1|3656282_3657455_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
AWA12559.1|3658698_3658902_-	hypothetical protein	NA	NA	NA	NA	NA
AWA12560.1|3658898_3659630_-	hypothetical protein	NA	NA	NA	NA	NA
AWA12561.1|3659633_3662585_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
AWA14308.1|3662586_3663186_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
AWA12562.1|3663178_3664087_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
AWA12563.1|3664073_3664436_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.9	4.9e-48
AWA12564.1|3664432_3665005_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
AWA12565.1|3665099_3665792_+	hypothetical protein	NA	NA	NA	NA	NA
AWA12566.1|3665788_3666235_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
AWA12567.1|3666227_3666659_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
AWA12568.1|3666754_3667183_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
AWA12569.1|3667179_3667563_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
AWA12570.1|3667567_3668077_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
AWA12571.1|3668057_3668273_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
AWA12572.1|3668276_3668480_-|tail	phage tail protein	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
AWA12573.1|3668479_3668944_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
AWA12574.1|3669039_3669690_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	96.3	8.7e-112
AWA12575.1|3669693_3670752_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
AWA12576.1|3670768_3671602_-|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
AWA12577.1|3671744_3673511_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
AWA12578.1|3673510_3674536_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
AWA12579.1|3674597_3676340_-	hypothetical protein	NA	NA	NA	NA	NA
AWA12580.1|3676615_3677293_-	hypothetical protein	NA	NA	NA	NA	NA
AWA12581.1|3677407_3677713_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AWA14309.1|3677651_3677840_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
AWA12582.1|3677993_3680408_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AWA12583.1|3680404_3681262_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
AWA12584.1|3681258_3681486_-	hypothetical protein	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
AWA12585.1|3681485_3681719_-	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
AWA12586.1|3681786_3682128_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
AWA12587.1|3682091_3682292_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
AWA12588.1|3682299_3682809_-	hypothetical protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AWA12589.1|3682841_3683063_-	regulator	NA	NA	NA	NA	NA
AWA12590.1|3683208_3684087_+	Repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
AWA12591.1|3684098_3685043_+	hypothetical protein	NA	NA	NA	NA	NA
AWA12592.1|3685141_3686626_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AWA12593.1|3686625_3686877_-	hypothetical protein	NA	NA	NA	NA	NA
AWA12594.1|3687044_3688097_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
3690530:3690545	attR	GACAGCCTGATCCCGG	NA	NA	NA	NA
>prophage 10
CP028583	Klebsiella pneumoniae strain WCHKP36 chromosome, complete genome	5444817	4331795	4343448	5444817	integrase	Enterobacteria_phage(70.0%)	13	4332245:4332259	4355301:4355315
AWA13168.1|4331795_4332899_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
4332245:4332259	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
AWA13169.1|4332909_4334163_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
AWA13170.1|4334515_4335706_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
AWA13171.1|4335693_4336644_+	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
AWA13172.1|4336643_4337069_+	hypothetical protein	NA	NA	NA	NA	NA
AWA13173.1|4337636_4338203_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
AWA13174.1|4338220_4338466_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
AWA13175.1|4338462_4339200_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	59.4	1.9e-70
AWA13176.1|4339741_4340008_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
AWA13177.1|4340004_4340562_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
AWA13178.1|4340558_4340786_+	hypothetical protein	NA	NA	NA	NA	NA
AWA13179.1|4340782_4341103_+	hypothetical protein	NA	NA	NA	NA	NA
AWA13180.1|4341114_4343448_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
4355301:4355315	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 11
CP028583	Klebsiella pneumoniae strain WCHKP36 chromosome, complete genome	5444817	4812991	4822516	5444817	transposase	Enterobacteria_phage(83.33%)	10	NA	NA
AWA13585.1|4812991_4815325_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
AWA13586.1|4815339_4815660_-	hypothetical protein	NA	NA	NA	NA	NA
AWA13587.1|4815656_4815884_-	hypothetical protein	NA	NA	NA	NA	NA
AWA13588.1|4815880_4816429_-	Ash-like/host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
AWA13589.1|4817252_4817990_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
AWA13590.1|4817986_4818232_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
AWA13591.1|4818249_4818816_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
AWA13592.1|4819556_4820636_+	hypothetical protein	NA	NA	NA	NA	NA
AWA13593.1|4820636_4821173_+	hypothetical protein	NA	NA	NA	NA	NA
AWA13594.1|4821535_4822516_+|transposase	IS5 family transposase ISKpn26	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 1
CP028582	Klebsiella pneumoniae strain WCHKP36 plasmid pKPC2_020036, complete sequence	149258	1796	36848	149258	protease,integrase,transposase	Escherichia_phage(41.67%)	43	9236:9295	36091:36912
AWA08960.1|1796_2450_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWA08961.1|2669_3134_+	mRNA interferase PemK	NA	NA	NA	NA	NA
AWA08962.1|3130_3235_+	hypothetical protein	NA	NA	NA	NA	NA
AWA08963.1|4444_5149_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWA08964.1|5659_6535_+	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
AWA08965.1|6614_7538_+|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
9236:9295	attL	GGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATT	NA	NA	NA	NA
AWA08966.1|9288_9993_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWA08967.1|10285_10600_-|transposase	transposase	transposase	NA	NA	NA	NA
AWA08968.1|10538_11552_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AWA09120.1|11843_12398_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
AWA08969.1|12494_12947_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
AWA08970.1|13079_13553_+	trimethoprim-resistant dihydrofolate reductase DfrA27	NA	G3MBI7	Bacillus_virus	29.1	1.4e-15
AWA09121.1|13733_14579_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA16	NA	NA	NA	NA	NA
AWA08971.1|14695_15043_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AWA08972.1|15036_15876_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AWA08973.1|15805_15985_-	hypothetical protein	NA	NA	NA	NA	NA
AWA08974.1|16003_16504_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWA08975.1|16809_16923_-	NTP-binding protein	NA	NA	NA	NA	NA
AWA08976.1|17010_17775_+|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AWA08977.1|17816_18029_+	resolvase	NA	NA	NA	NA	NA
AWA08978.1|18041_19250_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AWA08979.1|19283_20717_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
AWA08980.1|21098_21305_-	hypothetical protein	NA	NA	NA	NA	NA
AWA09122.1|21309_21951_-	restriction endonuclease	NA	NA	NA	NA	NA
AWA08981.1|22006_22318_-	hypothetical protein	NA	NA	NA	NA	NA
AWA08982.1|22353_22668_-	IncN plasmid KikA protein	NA	NA	NA	NA	NA
AWA08983.1|22664_23009_-	hypothetical protein	NA	NA	NA	NA	NA
AWA09123.1|23024_23375_-	KorB	NA	NA	NA	NA	NA
AWA08984.1|23438_24173_+	traL protein	NA	NA	NA	NA	NA
AWA09124.1|24181_24463_+	transcriptional regulator	NA	NA	NA	NA	NA
AWA08985.1|24472_24766_+	conjugal transfer protein TraM	NA	NA	NA	NA	NA
AWA08986.1|24815_25133_+	type IV secretion system protein VirB3	NA	NA	NA	NA	NA
AWA08987.1|25132_27733_+	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
AWA08988.1|27750_28464_+	type IV secretion system protein	NA	NA	NA	NA	NA
AWA08989.1|28471_28699_+	entry exclusion protein	NA	NA	NA	NA	NA
AWA08990.1|28714_29755_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
AWA08991.1|29837_29984_+	conjugal transfer protein TraN	NA	NA	NA	NA	NA
AWA08992.1|29973_30672_+	type IV secretion system protein VirB8	NA	NA	NA	NA	NA
AWA08993.1|30745_31567_+	conjugal transfer protein TraO	NA	NA	NA	NA	NA
AWA08994.1|31566_32727_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
AWA08995.1|32768_33764_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AWA08996.1|33763_34297_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
AWA08997.1|36143_36848_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
36091:36912	attR	GGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCG	NA	NA	NA	NA
>prophage 2
CP028582	Klebsiella pneumoniae strain WCHKP36 plasmid pKPC2_020036, complete sequence	149258	43201	101017	149258	transposase	Escherichia_phage(36.0%)	67	NA	NA
AWA09004.1|43201_43462_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	46.2	4.1e-12
AWA09005.1|43648_43840_-	hypothetical protein	NA	NA	NA	NA	NA
AWA09006.1|43882_44389_-	antirestriction protein	NA	A0A1I9S7Y0	Rhodococcus_phage	31.8	4.8e-09
AWA09007.1|44793_45573_-	hypothetical protein	NA	NA	NA	NA	NA
AWA09008.1|45626_46046_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AWA09009.1|46056_46278_-	hypothetical protein	NA	NA	NA	NA	NA
AWA09010.1|46277_46955_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
AWA09011.1|47313_47985_+	DNA breaking-rejoining protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.7	5.1e-83
AWA09012.1|48164_48587_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	51.5	3.1e-30
AWA09013.1|48586_49858_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.0	6.1e-154
AWA09014.1|49993_50965_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.9	1.4e-113
AWA09015.1|50961_52167_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.2	1.1e-205
AWA09016.1|52529_53162_+	LacI family DNA-binding transcriptional regulator	NA	A0A1V0E035	Clostridioides_phage	31.9	2.5e-07
AWA09017.1|53215_53416_+	hypothetical protein	NA	NA	NA	NA	NA
AWA09018.1|53562_54513_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	55.6	6.6e-76
AWA09019.1|54509_55121_-	DUF2913 domain-containing protein	NA	NA	NA	NA	NA
AWA09125.1|55117_55513_-	hypothetical protein	NA	NA	NA	NA	NA
AWA09020.1|56026_57007_+|transposase	IS5 family transposase ISKpn26	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
AWA09126.1|57658_58216_+	hypothetical protein	NA	NA	NA	NA	NA
AWA09021.1|58684_59389_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWA09022.1|59521_60163_-	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
AWA09023.1|60312_60813_-	hypothetical protein	NA	NA	NA	NA	NA
AWA09024.1|60892_61597_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWA09025.1|61630_62122_-	hypothetical protein	NA	NA	NA	NA	NA
AWA09026.1|62228_62966_+	resolvase	NA	NA	NA	NA	NA
AWA09027.1|62962_63187_+	hypothetical protein	NA	NA	NA	NA	NA
AWA09028.1|63308_63485_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
AWA09029.1|63666_64671_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AWA09030.1|64749_65184_-	mercuric resistance operon regulatory protein	NA	NA	NA	NA	NA
AWA09031.1|65255_65606_+	mercuric transporter	NA	NA	NA	NA	NA
AWA09032.1|65619_65895_+	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AWA09127.1|65930_66353_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AWA09033.1|66404_68099_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AWA09034.1|68116_68479_+	transcriptional regulator	NA	NA	NA	NA	NA
AWA09035.1|68475_68712_+	mercury resistance protein	NA	NA	NA	NA	NA
AWA09036.1|68708_69416_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AWA09037.1|70727_71432_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWA09038.1|71471_71945_+	recombinase	NA	Q1MVP4	Enterobacteria_phage	99.3	3.3e-76
AWA09039.1|73007_74075_-|transposase	IS481-like element ISKpn28 family transposase	transposase	NA	NA	NA	NA
AWA09040.1|74146_74305_+	Hok/Gef family protein	NA	NA	NA	NA	NA
AWA09041.1|74997_75270_+	hypothetical protein	NA	NA	NA	NA	NA
AWA09042.1|75266_75617_+	hypothetical protein	NA	NA	NA	NA	NA
AWA09043.1|75631_75949_+	hypothetical protein	NA	NA	NA	NA	NA
AWA09044.1|76789_77146_+	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	7.5e-25
AWA09045.1|77206_77419_+	hypothetical protein	NA	NA	NA	NA	NA
AWA09046.1|77429_77654_+	hypothetical protein	NA	NA	NA	NA	NA
AWA09047.1|77734_78055_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	1.5e-08
AWA09048.1|78044_78323_+	XRE family transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
AWA09128.1|78768_79029_-	hypothetical protein	NA	NA	NA	NA	NA
AWA09049.1|78943_79162_-	hypothetical protein	NA	NA	NA	NA	NA
AWA09050.1|79259_80081_+	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.1	1.2e-44
AWA09051.1|80113_80443_+	hypothetical protein	NA	NA	NA	NA	NA
AWA09052.1|80475_80961_-	lytic transglycosylase	NA	NA	NA	NA	NA
AWA09053.1|81384_81768_+	conjugal transfer protein TraM	NA	NA	NA	NA	NA
AWA09129.1|82027_82705_+	conjugal transfer protein TrbJ	NA	NA	NA	NA	NA
AWA09054.1|82855_83026_+	conjugal transfer protein TraY	NA	NA	NA	NA	NA
AWA09055.1|83087_83456_+	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
AWA09056.1|83469_83775_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
AWA09057.1|84214_84919_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWA09058.1|86029_86734_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWA09059.1|87810_90627_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AWA09060.1|90659_91181_+	protein traS	NA	NA	NA	NA	NA
AWA09061.1|91202_91937_+	complement resistance protein TraT	NA	NA	NA	NA	NA
AWA09062.1|92073_92877_+	hypothetical protein	NA	NA	NA	NA	NA
AWA09063.1|92927_95144_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
AWA09064.1|95143_100279_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
AWA09065.1|100312_101017_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 3
CP028582	Klebsiella pneumoniae strain WCHKP36 plasmid pKPC2_020036, complete sequence	149258	117933	129092	149258		Escherichia_phage(50.0%)	11	NA	NA
AWA09088.1|117933_118635_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	1.6e-26
AWA09089.1|119071_119302_-	hypothetical protein	NA	NA	NA	NA	NA
AWA09090.1|119364_120036_-	Mediator of plasmid stability	NA	NA	NA	NA	NA
AWA09091.1|120038_121010_-	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
AWA09092.1|121258_122743_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AWA09093.1|122742_122994_-	hypothetical protein	NA	NA	NA	NA	NA
AWA09094.1|123152_123584_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
AWA09095.1|123583_124855_+	DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.7	7.5e-152
AWA09096.1|124936_125914_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	53.8	1.4e-86
AWA09097.1|125910_127116_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	5.3e-163
AWA09098.1|128225_129092_-	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
