The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP035179	Klebsiella pneumoniae strain BA33875 chromosome, complete genome	5521588	172801	300944	5521588	integrase,protease,holin,head,terminase,tail,portal,capsid,plate,tRNA	Enterobacteria_phage(24.1%)	138	219862:219880	257602:257620
QAT07232.1|172801_174076_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	38.6	1.4e-68
QAT11997.1|174432_175230_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
QAT07233.1|176518_176746_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	78.4	3.8e-30
QAT07234.1|176778_177057_-	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	44.9	6.7e-13
QAT07235.1|177953_179030_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	74.1	2.1e-147
QAT07236.1|179157_179943_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.2	1.4e-60
QAT07237.1|179942_180242_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	46.7	3.8e-14
QAT07238.1|180329_181247_-	hypothetical protein	NA	A0A1W6JP69	Morganella_phage	36.9	3.1e-46
QAT11998.1|181692_182340_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	63.0	9.3e-74
QAT07239.1|182444_182642_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	66.1	2.7e-16
QAT07240.1|182667_183129_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
QAT07241.1|183366_183546_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	4.6e-15
QAT07242.1|183535_184504_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	66.4	1.0e-84
QAT07243.1|184709_185534_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.5	2.6e-113
QAT07244.1|185543_185921_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	72.8	3.3e-47
QAT07245.1|185933_186914_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.2	8.4e-135
QAT07246.1|186927_187506_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.7	1.7e-50
QAT07247.1|187657_187897_+	hypothetical protein	NA	NA	NA	NA	NA
QAT11999.1|188066_188366_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	84.8	1.5e-39
QAT07248.1|188362_188902_+	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	2.0e-101
QAT07249.1|188898_189243_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	82.1	3.9e-39
QAT12000.1|189464_189659_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	87.3	4.6e-21
QAT07250.1|189645_189888_+	hypothetical protein	NA	NA	NA	NA	NA
QAT07251.1|190016_190262_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	98.8	1.6e-34
QAT07252.1|190772_191123_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	80.7	4.6e-51
QAT07253.1|191254_191749_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	92.0	1.2e-81
QAT07254.1|191745_193476_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	83.4	9.2e-302
QAT07255.1|193485_193671_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	63.9	5.2e-14
QAT07256.1|193670_194900_+|portal	phage portal protein	portal	U5P411	Shigella_phage	81.5	1.7e-201
QAT12001.1|194886_195540_+|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	87.4	2.1e-105
QAT07257.1|195554_196763_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	84.5	9.9e-194
QAT12002.1|196767_197004_+	hypothetical protein	NA	M1FN89	Enterobacteria_phage	39.7	6.7e-06
QAT07258.1|197000_197321_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	43.1	4.8e-15
QAT07259.1|197329_197668_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	74.1	1.4e-41
QAT07260.1|197664_198114_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	82.6	6.7e-63
QAT07261.1|198110_198458_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
QAT07262.1|199247_199652_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	56.9	3.2e-32
QAT07263.1|199654_199960_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	63.6	1.4e-27
QAT07264.1|200033_200267_+	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
QAT07265.1|203732_204206_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	60.8	4.6e-54
QAT07266.1|204192_204678_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	66.2	3.0e-53
QAT07267.1|204687_205068_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	80.2	2.1e-57
QAT07268.1|210470_210761_+	hypothetical protein	NA	NA	NA	NA	NA
QAT07269.1|210971_212708_-	hypothetical protein	NA	A0A2H5BNQ4	Klebsiella_phage	76.7	7.1e-262
QAT07270.1|213459_213882_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	44.5	1.8e-25
QAT07271.1|214295_214535_+	DNA polymerase V	NA	I6PD82	Cronobacter_phage	54.4	7.5e-21
QAT07272.1|214537_214864_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	53.9	1.6e-26
QAT07273.1|215467_216613_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.7	1.1e-117
QAT07274.1|217004_217271_-	hypothetical protein	NA	NA	NA	NA	NA
QAT07275.1|217151_217433_+	hypothetical protein	NA	NA	NA	NA	NA
QAT07276.1|217475_218183_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.7	2.8e-07
QAT07277.1|218226_219660_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.0	4.0e-101
QAT12003.1|219640_220135_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	50.7	9.7e-31
219862:219880	attL	TCTGTTTAAGGTGCCGGCC	NA	NA	NA	NA
QAT07278.1|220109_221021_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
QAT07279.1|221204_222116_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
QAT07280.1|222231_223911_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	41.1	3.1e-20
QAT07281.1|224210_224435_-	DUF2525 domain-containing protein	NA	NA	NA	NA	NA
QAT07282.1|224560_224758_+	protein DsrB	NA	NA	NA	NA	NA
QAT07283.1|224790_225414_-	transcriptional regulator RcsA	NA	NA	NA	NA	NA
QAT12004.1|225789_226221_+	lipoprotein	NA	NA	NA	NA	NA
QAT07284.1|226262_227750_-	alpha-amylase	NA	NA	NA	NA	NA
QAT07285.1|227950_228751_+	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
QAT07286.1|228846_229833_+	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
QAT07287.1|229848_230517_+	cystine ABC transporter permease	NA	NA	NA	NA	NA
QAT07288.1|230513_231266_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.4	2.2e-26
QAT07289.1|231583_232306_+	transcriptional regulator SdiA	NA	NA	NA	NA	NA
QAT07290.1|232373_232598_-	DUF2594 family protein	NA	NA	NA	NA	NA
QAT07291.1|233059_233716_+	two-component system response regulator UvrY	NA	NA	NA	NA	NA
QAT07292.1|233712_235545_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
QAT07293.1|235602_236151_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
QAT07294.1|236721_237729_-|integrase	site-specific integrase	integrase	Q1I119	Pasteurella_virus	56.5	1.3e-103
QAT07295.1|237725_238592_-	BRCT domain-containing protein	NA	NA	NA	NA	NA
QAT07296.1|238608_239238_-	hypothetical protein	NA	NA	NA	NA	NA
QAT07297.1|239247_239676_-	XRE family transcriptional regulator	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	38.5	1.0e-07
QAT07298.1|239948_240152_+	DNA-binding protein	NA	P79674	Haemophilus_phage	37.1	6.4e-05
QAT12005.1|240374_240572_+	DUF4761 domain-containing protein	NA	NA	NA	NA	NA
QAT07299.1|240588_240987_+	hypothetical protein	NA	NA	NA	NA	NA
QAT07300.1|240996_241269_+	hypothetical protein	NA	NA	NA	NA	NA
QAT07301.1|241337_241562_+	hypothetical protein	NA	NA	NA	NA	NA
QAT07302.1|241558_242137_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	41.1	3.2e-33
QAT07303.1|242145_242373_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	49.0	5.5e-05
QAT07304.1|242369_242564_+	hypothetical protein	NA	NA	NA	NA	NA
QAT07305.1|242556_243510_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	56.3	3.6e-82
QAT07306.1|243824_244808_+	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	66.5	2.5e-70
QAT07307.1|244832_247427_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	52.4	1.2e-196
QAT07308.1|247623_248625_+|protease	serine protease	protease	NA	NA	NA	NA
QAT07309.1|249357_250389_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	70.8	3.4e-142
QAT07310.1|250402_252124_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	66.2	6.2e-226
QAT07311.1|252284_253118_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.6	1.1e-95
QAT07312.1|253142_254192_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	55.0	5.7e-105
QAT07313.1|254239_255244_+|terminase	terminase	terminase	B9A7B6	Serratia_phage	77.0	3.9e-87
QAT07314.1|255240_255738_+|head	head completion/stabilization protein	head	B9A7B7	Serratia_phage	71.5	1.2e-60
QAT07315.1|255737_255938_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	66.2	2.3e-15
QAT07316.1|256205_256757_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	41.3	9.2e-30
QAT07317.1|256753_257149_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
QAT07318.1|257293_257752_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	48.1	6.2e-32
257602:257620	attR	TCTGTTTAAGGTGCCGGCC	NA	NA	NA	NA
QAT07319.1|257748_258390_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	48.3	1.5e-44
QAT07320.1|258389_258968_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	62.6	5.1e-63
QAT07321.1|259318_260218_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	60.9	6.2e-92
QAT07322.1|260210_260807_+|tail	phage tail protein I	tail	A0A0M4R4W9	Salmonella_phage	46.3	1.5e-41
QAT07323.1|260811_262971_+	hypothetical protein	NA	H6X4Y8	Enterobacteria_phage	37.0	1.6e-16
QAT07324.1|263023_263314_+	hypothetical protein	NA	NA	NA	NA	NA
QAT07325.1|263413_264571_+|tail	phage tail protein	tail	S4TP62	Salmonella_phage	49.8	2.5e-45
QAT07326.1|264698_265187_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	65.0	1.6e-49
QAT07327.1|265198_268138_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	44.2	2.6e-208
QAT12006.1|268118_268295_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	69.8	1.5e-10
QAT07328.1|268272_268590_-|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	73.6	4.2e-27
QAT07329.1|268644_269160_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	70.0	2.6e-63
QAT07330.1|269159_270341_-|tail	phage tail protein	tail	A0A0A7NV69	Enterobacteria_phage	69.3	1.2e-156
QAT07331.1|271692_271941_+	hypothetical protein	NA	NA	NA	NA	NA
QAT07332.1|272326_273208_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
QAT07333.1|273306_273975_+	YecA family protein	NA	NA	NA	NA	NA
QAT07334.1|273999_275211_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
QAT07335.1|275402_275642_+	DUF2492 family protein	NA	NA	NA	NA	NA
QAT07336.1|275677_276175_-	non-heme ferritin	NA	NA	NA	NA	NA
QAT07337.1|276584_277223_+	hypothetical protein	NA	NA	NA	NA	NA
QAT07338.1|278844_279096_+	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
QAT07339.1|279133_280696_-	MFS transporter	NA	NA	NA	NA	NA
QAT07340.1|280710_280869_+	succinate dehydrogenase	NA	NA	NA	NA	NA
QAT07341.1|280939_281449_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
QAT07342.1|281542_281746_+	hypothetical protein	NA	NA	NA	NA	NA
QAT07343.1|282340_283321_+	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
QAT07344.1|283383_284898_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2R8FG22	Brazilian_cedratvirus	30.0	4.1e-11
QAT12007.1|284912_285893_+	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
QAT07345.1|286054_286843_+	trehalose-phosphatase	NA	NA	NA	NA	NA
QAT07346.1|286817_288242_+	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
QAT07347.1|288265_288694_-	universal stress protein UspC	NA	NA	NA	NA	NA
QAT07348.1|289046_290630_+	MFS transporter	NA	NA	NA	NA	NA
QAT07349.1|290634_291774_+	glycoside hydrolase family 105 protein	NA	NA	NA	NA	NA
QAT07350.1|291835_293569_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.8	1.4e-87
QAT07351.1|293804_294374_+	VOC family protein	NA	NA	NA	NA	NA
QAT07352.1|294450_295194_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
QAT07353.1|295275_296280_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
QAT07354.1|296276_297020_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.1e-25
QAT07355.1|297059_297455_-	hypothetical protein	NA	NA	NA	NA	NA
QAT07356.1|297507_298326_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	82.7	1.1e-60
QAT07357.1|298322_298889_-	hydrolase	NA	NA	NA	NA	NA
QAT07358.1|299156_300944_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.2	1.3e-11
>prophage 2
CP035179	Klebsiella pneumoniae strain BA33875 chromosome, complete genome	5521588	1106904	1113333	5521588		Escherichia_phage(100.0%)	7	NA	NA
QAT08083.1|1106904_1107993_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
QAT08084.1|1108079_1108340_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
QAT08085.1|1108637_1109498_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
QAT08086.1|1109518_1110280_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
QAT08087.1|1110540_1111443_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
QAT08088.1|1111454_1112720_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	7.8e-234
QAT08089.1|1112712_1113333_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 3
CP035179	Klebsiella pneumoniae strain BA33875 chromosome, complete genome	5521588	1819780	1829243	5521588	protease,tRNA	Brazilian_cedratvirus(16.67%)	8	NA	NA
QAT08701.1|1819780_1821502_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
QAT08702.1|1821546_1822248_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
QAT08703.1|1822601_1822820_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
QAT08704.1|1822939_1825219_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
QAT08705.1|1825249_1825567_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
QAT08706.1|1825892_1826114_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
QAT08707.1|1826190_1828131_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
QAT08708.1|1828127_1829243_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 4
CP035179	Klebsiella pneumoniae strain BA33875 chromosome, complete genome	5521588	2305460	2349925	5521588	integrase,head,terminase,lysis,tRNA,coat	Cronobacter_phage(24.0%)	64	2302413:2302458	2346998:2347043
2302413:2302458	attL	ATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
QAT09113.1|2305460_2307938_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.3	1.1e-196
QAT09114.1|2307924_2308320_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.8	2.1e-36
QAT09115.1|2308316_2308787_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	39.7	3.6e-27
QAT09116.1|2308786_2309206_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	47.8	1.8e-30
QAT09117.1|2309305_2311783_-	hypothetical protein	NA	A0A173GC04	Salmonella_phage	56.7	9.0e-210
QAT09118.1|2312453_2312666_-	hypothetical protein	NA	H6WRV2	Salmonella_phage	49.3	8.4e-08
QAT09119.1|2312923_2313643_-	antirepressor protein Ant	NA	Q0H8C7	Salmonella_phage	68.8	6.7e-89
QAT09120.1|2313710_2313857_-	DNA-binding protein	NA	A0A0M4S6R9	Salmonella_phage	60.4	6.8e-09
QAT09121.1|2313958_2314192_+	Arc family DNA-binding protein	NA	A0A0M5M1J2	Salmonella_phage	71.4	5.1e-22
QAT09122.1|2314194_2314668_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	36.8	2.2e-16
QAT12108.1|2314692_2314890_-	hypothetical protein	NA	NA	NA	NA	NA
QAT09123.1|2314895_2315573_-	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	48.0	2.0e-47
QAT09124.1|2315630_2316374_-	DNA breaking-rejoining protein	NA	F1C5E5	Cronobacter_phage	84.9	5.9e-72
QAT09125.1|2316436_2316820_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	61.4	9.8e-39
QAT12109.1|2316816_2317242_-	HK97 gp10 family phage protein	NA	R9TPP7	Aeromonas_phage	44.0	4.7e-26
QAT09126.1|2317244_2317592_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	62.6	1.9e-33
QAT09127.1|2317591_2318260_-	hypothetical protein	NA	A0A292GBW5	Xanthomonas_phage	42.3	3.3e-05
QAT09128.1|2318364_2318535_-	50S ribosomal protein L13	NA	Q5G8X7	Enterobacteria_phage	50.0	3.4e-12
QAT09129.1|2318534_2318915_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	3.1e-29
QAT09130.1|2318917_2319247_-	hypothetical protein	NA	NA	NA	NA	NA
QAT09131.1|2319256_2320354_-|coat	phage coat protein	coat	F1C5E1	Cronobacter_phage	73.6	4.2e-151
QAT09132.1|2320365_2320797_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.1	1.4e-41
QAT09133.1|2320800_2322186_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	64.0	7.6e-166
QAT09134.1|2322256_2322481_-	hypothetical protein	NA	NA	NA	NA	NA
QAT09135.1|2322533_2323532_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	68.6	7.5e-115
QAT09136.1|2323458_2324928_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.8	9.6e-151
QAT09137.1|2324940_2326413_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.7	3.4e-249
QAT09138.1|2326412_2327015_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.3	9.3e-76
QAT09139.1|2327379_2327556_-	rz1 lytic protein	NA	U5P461	Shigella_phage	57.1	5.3e-08
QAT09140.1|2327625_2327853_-	hypothetical protein	NA	NA	NA	NA	NA
QAT09141.1|2327951_2328419_-|lysis	lysis protein	lysis	Q9AZ06	Salmonella_phage	72.3	2.7e-54
QAT09142.1|2328415_2328946_-	lysozyme	NA	G9L6J6	Escherichia_phage	79.7	4.2e-80
QAT09143.1|2328948_2329197_-|lysis	lysis protein	lysis	NA	NA	NA	NA
QAT09144.1|2329214_2329427_+	hypothetical protein	NA	NA	NA	NA	NA
QAT09145.1|2329993_2330683_-	antiterminator	NA	I6PDF8	Cronobacter_phage	53.2	3.4e-58
QAT09146.1|2330679_2330820_-	YlcG family protein	NA	NA	NA	NA	NA
QAT09147.1|2330816_2331452_-	NinG family protein	NA	M9NYX8	Enterobacteria_phage	77.9	1.6e-81
QAT09148.1|2331444_2331615_-	NinE family protein	NA	G8C7V4	Escherichia_phage	71.4	2.8e-14
QAT09149.1|2331620_2332217_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	54.3	1.2e-56
QAT09150.1|2332515_2333376_-	hypothetical protein	NA	NA	NA	NA	NA
QAT09151.1|2334244_2334460_-	molecular chaperone DnaJ	NA	R9TNC2	Aeromonas_phage	98.6	1.6e-38
QAT09152.1|2334911_2335118_-	hypothetical protein	NA	R9TRD3	Aeromonas_phage	95.6	9.0e-31
QAT09153.1|2335114_2335561_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	35.8	2.2e-10
QAT09154.1|2335557_2335851_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	2.5e-26
QAT09155.1|2335850_2337281_-	helicase DnaB	NA	Q9MCT4	Escherichia_phage	66.7	9.9e-185
QAT09156.1|2337270_2338170_-	DNA replication protein	NA	A0A0N7C1Z7	Escherichia_phage	54.8	2.2e-81
QAT09157.1|2338343_2338628_-	hypothetical protein	NA	K7PHN8	Enterobacterial_phage	56.2	1.3e-19
QAT09158.1|2338648_2338861_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
QAT09159.1|2338969_2339566_+	XRE family transcriptional regulator	NA	K7P850	Enterobacteria_phage	27.1	6.9e-07
QAT09160.1|2340105_2340300_+	hypothetical protein	NA	NA	NA	NA	NA
QAT09161.1|2340387_2340672_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
QAT09162.1|2340681_2341596_+	DNA recombinase	NA	G8C7T0	Escherichia_phage	91.4	1.0e-158
QAT09163.1|2341592_2342075_+	siphovirus Gp157 family protein	NA	G8C7S9	Escherichia_phage	93.1	8.2e-75
QAT09164.1|2342109_2342415_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
QAT09165.1|2343063_2344200_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	73.1	7.4e-159
QAT09166.1|2344196_2344421_+	hypothetical protein	NA	NA	NA	NA	NA
QAT09167.1|2344417_2344690_+	hypothetical protein	NA	Q716F1	Shigella_phage	63.5	3.7e-24
QAT09168.1|2344686_2345391_+	hypothetical protein	NA	A0A1W6JP46	Morganella_phage	34.3	1.0e-25
QAT09169.1|2345387_2345606_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	52.2	4.4e-12
QAT09170.1|2345607_2345943_+	DNA-binding protein	NA	NA	NA	NA	NA
QAT12110.1|2345939_2346983_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	85.9	2.2e-178
QAT09171.1|2347413_2348280_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
2346998:2347043	attR	ATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
QAT09172.1|2348281_2348494_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
QAT09173.1|2348539_2349925_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 5
CP035179	Klebsiella pneumoniae strain BA33875 chromosome, complete genome	5521588	4835742	4896625	5521588	integrase,holin,head,terminase,tail,lysis,portal,capsid,plate,tRNA	Salmonella_phage(81.4%)	68	4849943:4849989	4885251:4885297
QAT12217.1|4835742_4835988_-|holin	holin	holin	S4TNY4	Salmonella_phage	71.8	2.7e-26
QAT11406.1|4836385_4836592_-	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	55.3	7.4e-09
QAT11407.1|4837032_4838046_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
QAT11408.1|4838056_4839037_-	PTS sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
QAT11409.1|4839033_4839408_-	PTS sorbitol transporter	NA	NA	NA	NA	NA
QAT11410.1|4839404_4839926_-	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
QAT11411.1|4840038_4840323_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.7	4.6e-17
QAT11412.1|4840417_4840774_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
QAT11413.1|4841092_4843162_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	34.6	8.7e-73
QAT11414.1|4843197_4843413_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
QAT11415.1|4847881_4848529_-	hypothetical protein	NA	NA	NA	NA	NA
4849943:4849989	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
QAT11416.1|4850074_4851121_-	hypothetical protein	NA	NA	NA	NA	NA
QAT11417.1|4851110_4852151_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	92.7	1.7e-189
QAT11418.1|4852154_4852787_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	57.1	3.8e-64
QAT11419.1|4852903_4853146_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
QAT11420.1|4853178_4853688_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	94.7	3.9e-83
QAT11421.1|4853695_4853896_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	100.0	2.4e-33
QAT11422.1|4853859_4854201_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	97.3	1.7e-55
QAT11423.1|4854268_4854502_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	1.2e-31
QAT11424.1|4854501_4854729_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	97.3	3.0e-35
QAT11425.1|4854725_4855583_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.1	1.1e-159
QAT11426.1|4855579_4857994_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.6	0.0e+00
QAT12218.1|4858147_4858336_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
QAT11427.1|4858693_4859371_+	hypothetical protein	NA	NA	NA	NA	NA
QAT11428.1|4860851_4861886_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.3	5.9e-171
QAT11429.1|4861885_4863652_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.1	0.0e+00
QAT11430.1|4863794_4864628_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
QAT11431.1|4864644_4865703_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.9e-180
QAT11432.1|4865706_4866357_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	96.3	8.7e-112
QAT11433.1|4866452_4866917_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.1e-76
QAT11434.1|4866916_4867120_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	91.0	5.2e-31
QAT11435.1|4867123_4867339_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
QAT11436.1|4867319_4867835_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.8	4.0e-88
QAT11437.1|4867831_4868260_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	91.5	1.5e-59
QAT11438.1|4868189_4868393_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	79.1	4.7e-24
QAT11439.1|4868355_4868787_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	1.3e-71
QAT11440.1|4868779_4869244_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	83.6	5.5e-60
QAT11441.1|4869331_4869994_+	hypothetical protein	NA	NA	NA	NA	NA
QAT11442.1|4870077_4870842_+	hypothetical protein	NA	NA	NA	NA	NA
QAT11443.1|4870968_4871547_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	1.6e-93
QAT11444.1|4871543_4871903_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
QAT11445.1|4871889_4872798_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	4.6e-143
QAT11446.1|4872790_4873396_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
QAT11447.1|4873392_4875114_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	78.9	3.5e-152
QAT11448.1|4875113_4875296_+	hypothetical protein	NA	NA	NA	NA	NA
QAT12219.1|4875276_4875429_-	hypothetical protein	NA	U5P083	Shigella_phage	71.1	5.8e-11
QAT12220.1|4876112_4876679_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	85.2	2.1e-85
QAT11449.1|4876821_4877994_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	89.2	2.5e-202
QAT11450.1|4878003_4878519_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	4.8e-89
QAT11451.1|4878573_4878876_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
QAT11452.1|4878890_4879010_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
QAT11453.1|4879002_4882080_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.3	0.0e+00
QAT11454.1|4882076_4882562_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	4.8e-67
QAT12221.1|4883748_4883967_+	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
QAT11455.1|4884370_4885144_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
QAT11456.1|4885759_4886242_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
4885251:4885297	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
QAT11457.1|4886352_4886829_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
QAT11458.1|4886818_4887109_+	RnfH family protein	NA	NA	NA	NA	NA
QAT11459.1|4887175_4887517_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
QAT11460.1|4887664_4889326_-	DNA repair protein RecN	NA	NA	NA	NA	NA
QAT11461.1|4889412_4890291_-	NAD(+) kinase	NA	NA	NA	NA	NA
QAT11462.1|4890415_4891006_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
QAT11463.1|4891125_4892412_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
QAT11464.1|4892431_4893223_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
QAT11465.1|4893386_4894751_+	signal recognition particle protein	NA	NA	NA	NA	NA
QAT11466.1|4895010_4895259_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
QAT12222.1|4895277_4895826_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
QAT11467.1|4895857_4896625_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 6
CP035179	Klebsiella pneumoniae strain BA33875 chromosome, complete genome	5521588	5003630	5054486	5521588	integrase,holin,tail,terminase,capsid	Salmonella_phage(42.11%)	61	5003368:5003382	5033110:5033124
5003368:5003382	attL	GCTGATGAGCTGGAA	NA	NA	NA	NA
QAT11560.1|5003630_5003894_+|holin	nicotinic acetylcholine receptor subunit beta	holin	NA	NA	NA	NA
QAT11561.1|5003890_5004151_+	hypothetical protein	NA	NA	NA	NA	NA
QAT11562.1|5004147_5004360_+	hypothetical protein	NA	NA	NA	NA	NA
QAT11563.1|5004356_5004983_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	37.2	5.0e-24
QAT11564.1|5004997_5007448_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	38.0	3.1e-138
QAT11565.1|5007754_5008153_+	hypothetical protein	NA	NA	NA	NA	NA
QAT11566.1|5008393_5009014_-	hypothetical protein	NA	NA	NA	NA	NA
QAT11567.1|5009014_5010139_-	ATP-binding protein	NA	NA	NA	NA	NA
QAT12226.1|5010096_5010366_-	hypothetical protein	NA	NA	NA	NA	NA
QAT11568.1|5011220_5011541_+	superinfection immunity protein	NA	A0A0S2SY85	Pseudomonas_phage	45.0	4.7e-18
QAT11569.1|5011570_5011948_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	45.5	5.3e-21
QAT11570.1|5012242_5012569_+	hypothetical protein	NA	NA	NA	NA	NA
QAT11571.1|5015539_5015824_+	hypothetical protein	NA	NA	NA	NA	NA
QAT11572.1|5016027_5016399_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	58.7	9.2e-34
QAT11573.1|5016569_5017199_+	hypothetical protein	NA	NA	NA	NA	NA
QAT11574.1|5017968_5018328_-	hypothetical protein	NA	NA	NA	NA	NA
QAT11575.1|5018569_5018815_+	hypothetical protein	NA	NA	NA	NA	NA
QAT11576.1|5019600_5019792_+	hypothetical protein	NA	NA	NA	NA	NA
QAT11577.1|5019822_5020302_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
QAT11578.1|5020485_5021565_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
QAT11579.1|5021614_5021833_+	hypothetical protein	NA	NA	NA	NA	NA
QAT11580.1|5021816_5023208_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	33.0	6.3e-35
QAT11581.1|5023366_5024833_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.5e-87
QAT11582.1|5024900_5026478_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
QAT11583.1|5026669_5027923_+|integrase	site-specific integrase	integrase	A0A1X9TCT6	Enterobacter_phage	83.6	3.5e-202
QAT11584.1|5028184_5028847_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	75.5	4.7e-97
QAT11585.1|5028843_5029446_-	adenine methylase	NA	A0A193GYV6	Enterobacter_phage	92.4	4.0e-103
QAT11586.1|5029442_5029949_-	hypothetical protein	NA	NA	NA	NA	NA
QAT11587.1|5029945_5030104_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	80.8	8.7e-18
QAT12227.1|5030144_5030390_-	PerC family transcriptional regulator	NA	Q858E4	Salmonella_phage	75.3	6.5e-28
QAT11588.1|5030797_5031820_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	95.3	4.0e-180
QAT11589.1|5031829_5032729_-	endonuclease	NA	Q858E0	Salmonella_phage	91.0	6.5e-158
QAT11590.1|5032725_5033025_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
QAT11591.1|5033391_5033973_-	XRE family transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
5033110:5033124	attR	TTCCAGCTCATCAGC	NA	NA	NA	NA
QAT11592.1|5034127_5034361_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
QAT11593.1|5034507_5034717_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
QAT11594.1|5034716_5035484_+	primosomal protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
QAT11595.1|5035480_5036266_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
QAT11596.1|5036385_5036733_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	81.7	1.9e-49
QAT11597.1|5036925_5037327_+	hypothetical protein	NA	A0A2H4N7F5	Pectobacterium_phage	51.6	8.7e-22
QAT11598.1|5037603_5037858_+	hypothetical protein	NA	NA	NA	NA	NA
QAT12228.1|5037857_5038121_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	65.5	3.5e-27
QAT11599.1|5038814_5039054_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	51.7	8.6e-09
QAT11600.1|5039053_5039392_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	79.1	3.1e-44
QAT11601.1|5039466_5039724_+	lF-82	NA	NA	NA	NA	NA
QAT11602.1|5039801_5040386_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.6	9.9e-91
QAT11603.1|5040382_5041858_+|terminase	terminase	terminase	Q858H3	Salmonella_phage	92.4	2.4e-279
QAT11604.1|5041900_5042272_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	93.5	6.8e-61
QAT11605.1|5042322_5042523_+	hypothetical protein	NA	NA	NA	NA	NA
QAT11606.1|5042859_5043048_+	hypothetical protein	NA	NA	NA	NA	NA
QAT11607.1|5043069_5043273_+	hypothetical protein	NA	NA	NA	NA	NA
QAT11608.1|5043276_5044956_+|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	59.3	3.6e-194
QAT11609.1|5044952_5045258_+	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	1.1e-16
QAT12229.1|5045539_5045938_+	peptidase	NA	T1SAP9	Salmonella_phage	59.5	5.6e-37
QAT11610.1|5045950_5046958_+|capsid	phage capsid protein	capsid	T1S9H9	Salmonella_phage	92.8	2.1e-181
QAT11611.1|5046967_5047360_+	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
QAT11612.1|5047352_5047631_+	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	1.1e-20
QAT11613.1|5048289_5050767_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	56.4	2.3e-266
QAT11614.1|5050768_5051239_+	hypothetical protein	NA	Q858G2	Salmonella_phage	55.3	9.5e-44
QAT11615.1|5051231_5051729_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	41.7	8.9e-24
QAT11616.1|5051741_5054486_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	39.7	6.7e-97
>prophage 7
CP035179	Klebsiella pneumoniae strain BA33875 chromosome, complete genome	5521588	5061682	5068901	5521588	holin	Salmonella_phage(57.14%)	8	NA	NA
QAT11623.1|5061682_5061979_-	hypothetical protein	NA	T1SA06	Salmonella_phage	62.7	1.2e-23
QAT11624.1|5063674_5064592_+	hypothetical protein	NA	H6X4Y8	Enterobacteria_phage	34.9	9.6e-16
QAT11625.1|5064633_5064921_+	hypothetical protein	NA	NA	NA	NA	NA
QAT11626.1|5065033_5065438_+	hypothetical protein	NA	T1SA79	Salmonella_phage	82.6	2.1e-55
QAT11627.1|5065424_5065730_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	4.6e-39
QAT11628.1|5065719_5066349_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	78.4	1.5e-92
QAT11629.1|5066345_5066846_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	90.0	1.1e-69
QAT11630.1|5067032_5068901_-	phosphatase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
>prophage 8
CP035179	Klebsiella pneumoniae strain BA33875 chromosome, complete genome	5521588	5433021	5439924	5521588		Bacillus_phage(33.33%)	6	NA	NA
QAT11935.1|5433021_5433885_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	22.5	2.0e-07
QAT11936.1|5433895_5434669_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
QAT12246.1|5434909_5435803_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
QAT11937.1|5436048_5437410_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
QAT11938.1|5437726_5438449_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.4e-30
QAT11939.1|5438445_5439924_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 9
CP035179	Klebsiella pneumoniae strain BA33875 chromosome, complete genome	5521588	5481110	5489485	5521588		Escherichia_phage(33.33%)	6	NA	NA
QAT11964.1|5481110_5482517_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	1.8e-37
QAT11965.1|5482738_5483803_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	4.4e-105
QAT11966.1|5484729_5485620_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
QAT11967.1|5485634_5486189_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
QAT11968.1|5486368_5487535_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
QAT11969.1|5488480_5489485_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.8e-31
>prophage 1
CP035180	Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence	282657	126399	194749	282657	transposase,integrase	Bacillus_phage(20.0%)	60	178993:179008	196326:196341
QAT12428.1|126399_127607_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
QAT12325.1|129035_129467_-	silver-binding protein SilE	NA	NA	NA	NA	NA
QAT12326.1|129717_131193_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
QAT12429.1|131185_131866_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
QAT12327.1|133468_133822_+	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
QAT12328.1|133935_135228_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
QAT12329.1|135238_138385_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
QAT12330.1|138471_138912_+	hypothetical protein	NA	NA	NA	NA	NA
QAT12331.1|141525_141723_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
QAT12332.1|141756_142494_-	peptidase M23	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
QAT12333.1|142782_143232_-	copper resistance protein	NA	NA	NA	NA	NA
QAT12430.1|145279_146176_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
QAT12334.1|146215_146596_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
QAT12335.1|147584_148265_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
QAT12336.1|148261_149662_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
QAT12337.1|149878_150313_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
QAT12338.1|150541_150721_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
QAT12339.1|152463_152973_+	porin	NA	NA	NA	NA	NA
QAT12340.1|153019_153517_-	N-acetyltransferase	NA	NA	NA	NA	NA
QAT12341.1|153848_154175_+	transcriptional regulator	NA	NA	NA	NA	NA
QAT12431.1|154174_154885_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
QAT12342.1|154893_155439_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
QAT12343.1|155514_155877_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
QAT12344.1|155895_157236_+	hypothetical protein	NA	NA	NA	NA	NA
QAT12345.1|157774_158311_+	N-acetyltransferase	NA	NA	NA	NA	NA
QAT12346.1|158780_160070_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
QAT12347.1|160117_161869_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
QAT12348.1|161886_162249_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
QAT12349.1|162298_162649_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
QAT12350.1|163006_163276_+	hypothetical protein	NA	NA	NA	NA	NA
QAT12351.1|163263_163839_+	hypothetical protein	NA	NA	NA	NA	NA
QAT12352.1|164406_164775_+	hypothetical protein	NA	NA	NA	NA	NA
QAT12353.1|164808_165012_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
QAT12354.1|165060_165318_+	hypothetical protein	NA	NA	NA	NA	NA
QAT12355.1|165393_165648_+	hypothetical protein	NA	NA	NA	NA	NA
QAT12356.1|165823_166090_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
QAT12357.1|166077_166560_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
QAT12358.1|166775_168173_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
QAT12359.1|169509_170451_-	hypothetical protein	NA	NA	NA	NA	NA
QAT12360.1|170447_170963_-	thermonuclease family protein	NA	V5UN65	Mycobacterium_phage	28.9	1.1e-08
QAT12361.1|171185_172613_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.6	2.8e-102
QAT12362.1|172741_172912_+	hypothetical protein	NA	NA	NA	NA	NA
QAT12363.1|172936_174256_+	DUF1173 family protein	NA	NA	NA	NA	NA
QAT12364.1|174269_174473_+	hypothetical protein	NA	NA	NA	NA	NA
QAT12365.1|174527_175748_-	hypothetical protein	NA	NA	NA	NA	NA
QAT12432.1|175750_176563_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
QAT12366.1|177071_177740_+	hypothetical protein	NA	NA	NA	NA	NA
178993:179008	attL	ATCGCCGGCCCAGTCG	NA	NA	NA	NA
QAT12367.1|179388_179961_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
QAT12368.1|180097_180688_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
QAT12369.1|180939_181269_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
QAT12370.1|181249_181531_+	XRE family transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
QAT12371.1|182939_183863_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	99.3	1.3e-174
QAT12372.1|184262_184910_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
QAT12373.1|185246_186488_-	tellurium resistance protein TerF	NA	A0A2D1GNA9	Pseudoalteromonas_phage	25.1	4.8e-10
QAT12433.1|187005_187365_-	oxacillinase-carbenicillinase	NA	NA	NA	NA	NA
QAT12434.1|188741_189293_-	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
QAT12374.1|189525_190083_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
QAT12375.1|192756_193461_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
QAT12435.1|193494_193767_-|transposase	transposase	transposase	NA	NA	NA	NA
QAT12376.1|193735_194749_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
196326:196341	attR	CGACTGGGCCGGCGAT	NA	NA	NA	NA
>prophage 2
CP035180	Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence	282657	211924	220929	282657	transposase	Escherichia_phage(100.0%)	8	NA	NA
QAT12386.1|211924_212629_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
QAT12387.1|213089_214178_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
QAT12388.1|214264_214525_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	100.0	1.9e-41
QAT12389.1|214822_215683_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
QAT12390.1|215703_216465_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
QAT12391.1|216722_217625_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
QAT12392.1|218892_219513_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
QAT12393.1|220224_220929_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
