The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP030919	Escherichia coli strain KL53 chromosome, complete genome	4810511	355	59140	4810511	protease,transposase,tail,capsid,integrase	Enterobacteria_phage(15.79%)	57	16168:16181	60005:60018
AXE66562.1|355_859_-|tail	phage tail protein	tail	Q9MCR6	Enterobacteria_phage	66.4	3.0e-43
AXE66563.1|1048_2262_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
AXE70970.1|2250_2757_+	DNA-invertase	NA	A0A1S6L009	Salmonella_phage	81.3	1.6e-65
AXE66564.1|2814_3186_-	hypothetical protein	NA	NA	NA	NA	NA
AXE66565.1|3148_4165_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
AXE66566.1|4202_4319_-	sugar kinase	NA	Q6QLL3	Human_immunodeficiency_virus	94.4	6.2e-13
AXE66567.1|4689_5433_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXE66568.1|6647_6863_+	hypothetical protein	NA	NA	NA	NA	NA
AXE66569.1|6859_7219_+	hypothetical protein	NA	NA	NA	NA	NA
AXE66570.1|7235_8267_+|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AXE66571.1|8388_8586_+	hypothetical protein	NA	NA	NA	NA	NA
AXE66572.1|8578_10444_+	hypothetical protein	NA	A0A1D7XFE4	Escherichia_phage	31.7	2.5e-63
AXE66573.1|10782_11061_+	hypothetical protein	NA	NA	NA	NA	NA
AXE66574.1|11096_12311_-|integrase	integrase	integrase	NA	NA	NA	NA
AXE66575.1|12850_13192_-	toxin	NA	NA	NA	NA	NA
AXE66576.1|13212_13530_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
AXE66577.1|13548_13770_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
AXE66578.1|13778_14255_-	DNA repair protein RadC	NA	NA	NA	NA	NA
AXE66579.1|14270_14729_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
AXE66580.1|14826_15066_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AXE66581.1|15142_15610_-	hypothetical protein	NA	NA	NA	NA	NA
AXE66582.1|15633_16077_-	hypothetical protein	NA	NA	NA	NA	NA
AXE66583.1|16076_16313_-	hypothetical protein	NA	NA	NA	NA	NA
16168:16181	attL	GCAACACTGGCAGC	NA	NA	NA	NA
AXE66584.1|16353_17055_-	WYL domain-containing protein	NA	NA	NA	NA	NA
AXE66585.1|17271_18093_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.1	3.6e-46
AXE66586.1|18184_19048_-	GTPase family protein	NA	NA	NA	NA	NA
AXE66587.1|20963_22115_-	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	9.9e-26
AXE66588.1|22139_23105_-|protease	Zn-dependent protease	protease	NA	NA	NA	NA
AXE66589.1|23082_23580_-	phosphate-starvation-inducible E family protein	NA	NA	NA	NA	NA
AXE66590.1|23576_25292_-	sodium:proton exchanger	NA	NA	NA	NA	NA
AXE66591.1|25295_25736_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	37.2	5.8e-11
AXE66592.1|26951_27563_-	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
AXE66593.1|27652_28540_-	hypothetical protein	NA	NA	NA	NA	NA
AXE66594.1|28642_29557_-	hypothetical protein	NA	NA	NA	NA	NA
AXE66595.1|29579_30038_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AXE66596.1|30125_31853_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	C7U047	Ostreococcus_tauri_virus	37.7	5.7e-86
AXE66597.1|31913_32105_-	hypothetical protein	NA	NA	NA	NA	NA
AXE66598.1|32104_35020_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.2	1.2e-128
AXE66599.1|35125_35695_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AXE70971.1|35729_36011_-	DNA-binding protein	NA	NA	NA	NA	NA
AXE66600.1|37108_38299_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	48.6	1.6e-47
AXE66601.1|39220_40372_-|transposase	IS30 family transposase IS30	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
AXE66602.1|41820_42774_+	3-carboxyethylcatechol 2,3-dioxygenase	NA	NA	NA	NA	NA
AXE66603.1|42802_43669_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
AXE66604.1|44484_45435_+	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.0	5.3e-33
AXE66605.1|45431_46445_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	30.8	1.2e-43
AXE66606.1|46514_47726_+	3-(3-hydroxy-phenyl)propionate transporter MhpT	NA	NA	NA	NA	NA
AXE70972.1|48000_49404_+	S-methylmethionine permease	NA	NA	NA	NA	NA
AXE66607.1|49390_50323_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
AXE66608.1|50431_51478_-	Fe(3+) ions import ATP-binding protein FbpC	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
AXE66609.1|53144_53354_+	hypothetical protein	NA	NA	NA	NA	NA
AXE66610.1|53353_53728_+	hypothetical protein	NA	NA	NA	NA	NA
AXE66611.1|53744_54773_+|capsid	minor capsid protein E	capsid	NA	NA	NA	NA
AXE66612.1|54925_55123_+	hypothetical protein	NA	NA	NA	NA	NA
AXE66613.1|55157_56999_+	hypothetical protein	NA	A0A140G5Z0	Enterobacteria_phage	27.0	2.7e-17
AXE66614.1|57046_57724_+	hypothetical protein	NA	A0A1D7XFF4	Escherichia_phage	51.3	8.6e-46
AXE66615.1|57805_59140_-|integrase	integrase	integrase	NA	NA	NA	NA
60005:60018	attR	GCAACACTGGCAGC	NA	NA	NA	NA
>prophage 2
CP030919	Escherichia coli strain KL53 chromosome, complete genome	4810511	664141	759324	4810511	tRNA,portal,protease,holin,plate,head,terminase,tail,capsid,integrase,lysis	Escherichia_phage(46.67%)	89	669436:669453	737230:737247
AXE67172.1|664141_664462_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
AXE67173.1|664492_666769_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
AXE67174.1|667453_667672_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AXE67175.1|667956_668661_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AXE67176.1|668702_670424_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	9.9e-22
669436:669453	attL	TGGGTATCAGGAAAGGTG	NA	NA	NA	NA
AXE67177.1|670424_672191_-	ATP-binding/permease CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
AXE67178.1|672313_673279_-	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
AXE67179.1|673823_674318_+	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AXE67180.1|674452_678442_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
AXE67181.1|678600_679212_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AXE67182.1|679222_680566_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	1.6e-80
AXE67183.1|680656_681949_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
AXE67184.1|682187_684632_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
AXE67185.1|684642_685260_+	dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
AXE67186.1|685261_686125_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AXE67187.1|686159_686786_-	hydrolase	NA	NA	NA	NA	NA
AXE67188.1|687099_688248_+	MFS transporter	NA	NA	NA	NA	NA
AXE67189.1|689631_690429_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
AXE67190.1|690460_691456_-|integrase	site-specific integrase	integrase	A0A0F7LBR0	Escherichia_phage	100.0	5.4e-190
AXE67191.1|691549_691849_-	XRE family transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	100.0	3.0e-51
AXE70993.1|691957_692314_+	hypothetical protein	NA	Q1JS28	Enterobacteria_phage	99.2	1.5e-62
AXE67192.1|692297_692495_+	hypothetical protein	NA	A0A0F7LDS9	Escherichia_phage	98.5	6.1e-29
AXE70994.1|692491_692992_+	replication protein B	NA	S4TTB7	Salmonella_phage	99.4	1.7e-91
AXE67193.1|693055_693280_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
AXE67194.1|693279_693582_+	hypothetical protein	NA	A0A0F7LDT6	Escherichia_phage	96.0	5.5e-45
AXE67195.1|693581_693806_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
AXE67196.1|693802_694078_+	hypothetical protein	NA	M1TAP2	Escherichia_phage	98.9	8.6e-45
AXE67197.1|694067_696353_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.7	0.0e+00
AXE67198.1|696709_698215_+	hypothetical protein	NA	Q858T2	Yersinia_virus	28.3	1.5e-05
AXE67199.1|698284_699169_+	DNA adenine methylase	NA	NA	NA	NA	NA
AXE67200.1|699504_700539_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.7	2.4e-201
AXE67201.1|700538_702311_-	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
AXE67202.1|702484_703339_+|capsid	capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
AXE67203.1|703397_704471_+|capsid	phage major capsid protein, P2 family	capsid	Q94MC7	Enterobacteria_phage	99.7	3.0e-202
AXE67204.1|704474_705218_+|terminase	terminase	terminase	A0A0F7LBP7	Escherichia_phage	98.8	6.0e-125
AXE67205.1|705317_705827_+|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	99.4	2.5e-90
AXE67206.1|705826_706030_+|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
AXE67207.1|706033_706315_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
AXE67208.1|706314_706812_+	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
AXE67209.1|706826_707252_+	protein lysA	NA	A0A0F7LBP4	Escherichia_phage	96.5	8.6e-60
AXE67210.1|707239_707665_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	97.2	9.4e-67
AXE67211.1|707651_707810_+|lysis	phage lysis protein	lysis	A0A0F7LCN5	Escherichia_phage	100.0	2.6e-22
AXE67212.1|707772_708240_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	4.3e-81
AXE67213.1|708232_708685_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	4.1e-76
AXE67214.1|708751_709387_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	96.7	4.6e-110
AXE67215.1|709383_709731_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	99.1	5.0e-58
AXE67216.1|709735_710644_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	4.4e-162
AXE67217.1|710636_711248_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	100.0	1.7e-117
AXE67218.1|711244_712429_+|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	77.2	2.2e-161
AXE67219.1|712431_712872_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	66.7	1.5e-51
AXE67220.1|712843_713437_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	62.9	1.3e-58
AXE67221.1|713436_714006_-|tail	phage tail protein	tail	K7PH60	Enterobacterial_phage	58.1	1.0e-44
AXE67222.1|714036_714630_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	98.0	1.2e-104
AXE67223.1|714689_715880_+|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
AXE67224.1|715892_716411_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	5.5e-93
AXE67225.1|716467_716743_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
AXE67226.1|716775_716895_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AXE67227.1|716887_719335_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	94.6	0.0e+00
AXE67228.1|719349_719829_+|tail	phage tail protein	tail	O64315	Escherichia_phage	97.5	1.3e-83
AXE67229.1|719828_720992_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	5.4e-205
AXE67230.1|721037_721292_+	DNA-binding transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	98.8	1.3e-44
AXE67231.1|721610_723893_-	formate acetyltransferase 1	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
AXE67232.1|723947_724805_-	formate transporter FocA	NA	NA	NA	NA	NA
AXE67233.1|725210_726971_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
AXE67234.1|727100_727793_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AXE67235.1|727991_729080_+	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
AXE67236.1|729150_730434_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AXE67237.1|730602_731367_+|protease	metalloprotease	protease	NA	NA	NA	NA
AXE67238.1|731539_732223_+	cytidylate kinase	NA	NA	NA	NA	NA
AXE67239.1|732333_734007_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
AXE67240.1|734166_734451_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
AXE67241.1|734658_736923_+	ComEC family protein	NA	NA	NA	NA	NA
AXE67242.1|736959_738708_+	lipid A export ATP-binding/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
737230:737247	attR	TGGGTATCAGGAAAGGTG	NA	NA	NA	NA
AXE67243.1|738704_739691_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AXE67244.1|739727_740960_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXE67245.1|741011_741194_+	protein YcaR	NA	NA	NA	NA	NA
AXE67246.1|741190_741937_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AXE67247.1|742090_742984_+	hypothetical protein	NA	NA	NA	NA	NA
AXE67248.1|742960_743740_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
AXE67249.1|743875_744661_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
AXE67250.1|744657_745980_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
AXE67251.1|745960_746665_+	condensin subunit E	NA	NA	NA	NA	NA
AXE67252.1|746664_751125_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
AXE67253.1|751385_753233_+	transpeptidase	NA	NA	NA	NA	NA
AXE70995.1|753413_753962_+	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
AXE67254.1|753988_754636_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AXE67255.1|754857_756048_-	aspartate aminotransferase	NA	NA	NA	NA	NA
AXE67256.1|756232_757321_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
AXE67257.1|757923_759324_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.9	2.6e-81
>prophage 3
CP030919	Escherichia coli strain KL53 chromosome, complete genome	4810511	1064701	1150713	4810511	tRNA,portal,holin,protease,transposase,terminase,tail,integrase	Enterobacteria_phage(50.0%)	100	1060638:1060652	1091184:1091198
1060638:1060652	attL	CTGTTCTGGAGGGGA	NA	NA	NA	NA
AXE67549.1|1064701_1065895_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	99.5	2.5e-234
AXE67550.1|1065887_1066088_-	excisionase	NA	K7PM28	Enterobacteria_phage	82.5	1.9e-25
AXE67551.1|1066133_1066376_-	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	87.3	6.6e-33
AXE67552.1|1066362_1066566_-	hypothetical protein	NA	A0A1B0VN94	Pseudomonas_phage	66.7	1.7e-10
AXE67553.1|1066558_1066903_-	hypothetical protein	NA	NA	NA	NA	NA
AXE67554.1|1066937_1068029_-	enterohemolysin	NA	K7PKR8	Enterobacteria_phage	59.5	7.4e-116
AXE67555.1|1068041_1071431_-	exodeoxyribonuclease	NA	K7P6V4	Enterobacteria_phage	94.0	0.0e+00
AXE71013.1|1071743_1071950_-	cell division inhibitor protein	NA	K7PM31	Enterobacteria_phage	100.0	1.5e-33
AXE67556.1|1072603_1073766_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
AXE67557.1|1074194_1074476_-	hypothetical protein	NA	A4KWR2	Enterobacteria_phage	75.3	2.2e-32
AXE71014.1|1074540_1074960_-	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	77.1	3.1e-46
AXE67558.1|1075032_1075251_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	64.8	1.5e-20
AXE67559.1|1075262_1075820_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	41.1	6.4e-23
AXE67560.1|1075904_1076813_+	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	100.0	1.2e-159
AXE67561.1|1076809_1077499_+	phage replication protein	NA	K7P7B6	Enterobacteria_phage	100.0	6.8e-131
AXE67562.1|1077500_1077845_+	winged helix-turn-helix transcriptional regulator	NA	K7PHG5	Enterobacteria_phage	100.0	1.3e-58
AXE67563.1|1077841_1078039_+	hypothetical protein	NA	K7PKS4	Enterobacteria_phage	100.0	2.6e-27
AXE67564.1|1078035_1078581_+	ead/Ea22-like family protein	NA	K7P6V8	Enterobacteria_phage	93.3	1.5e-37
AXE67565.1|1078582_1078786_+	hypothetical protein	NA	NA	NA	NA	NA
AXE67566.1|1078789_1079239_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	89.5	4.8e-45
AXE67567.1|1079292_1079613_+	hypothetical protein	NA	NA	NA	NA	NA
AXE67568.1|1079868_1080519_+	hypothetical protein	NA	NA	NA	NA	NA
AXE67569.1|1080499_1081603_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXE67570.1|1081893_1082127_+	DinI family protein	NA	K7PM44	Enterobacteria_phage	98.7	6.6e-38
AXE67571.1|1082244_1082493_+	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	100.0	2.1e-42
AXE67572.1|1082527_1083127_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	100.0	5.7e-110
AXE71015.1|1083132_1083333_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	63.6	4.1e-20
AXE67573.1|1083323_1083617_+	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	100.0	9.7e-47
AXE67574.1|1083613_1083970_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	100.0	1.1e-65
AXE67575.1|1083966_1084104_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	76.3	3.2e-08
AXE67576.1|1084103_1084919_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	98.2	4.1e-143
AXE71017.1|1085425_1085704_+|holin	holin	holin	K7PGZ9	Enterobacteria_phage	97.8	5.1e-45
AXE71016.1|1085681_1086248_+	lysozyme	NA	K7P7Q3	Enterobacteria_phage	92.0	2.1e-98
AXE67577.1|1086247_1086784_+	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	93.3	2.6e-74
AXE67578.1|1087154_1087355_+	hypothetical protein	NA	NA	NA	NA	NA
AXE67579.1|1087358_1088261_+	S49 family peptidase	NA	NA	NA	NA	NA
AXE71018.1|1088541_1089030_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	100.0	3.1e-82
AXE67580.1|1089029_1091132_+|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	98.7	0.0e+00
AXE67581.1|1091128_1091344_+	hypothetical protein	NA	K7PMB5	Enterobacterial_phage	98.6	1.4e-31
1091184:1091198	attR	CTGTTCTGGAGGGGA	NA	NA	NA	NA
AXE67582.1|1091340_1092840_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	99.8	3.8e-288
AXE71019.1|1092853_1094800_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	99.2	0.0e+00
AXE67583.1|1094882_1095209_+	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	98.1	3.9e-52
AXE67584.1|1095201_1095477_+	DNA breaking-rejoining protein	NA	K7PH55	Enterobacterial_phage	96.2	5.9e-38
AXE67585.1|1095486_1096065_+|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	99.0	4.5e-96
AXE67586.1|1096061_1096463_+|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	100.0	4.1e-72
AXE67587.1|1096472_1097216_+|tail	phage tail protein	tail	K7PKX6	Enterobacterial_phage	98.4	3.9e-132
AXE67588.1|1097226_1097667_+|tail	phage minor tail protein G	tail	K7PJY4	Enterobacterial_phage	93.8	3.8e-71
AXE67589.1|1097675_1097990_+|tail	phage tail assembly protein T	tail	E4WL32	Enterobacteria_phage	95.2	9.8e-53
AXE67590.1|1097973_1101234_+|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	96.5	0.0e+00
AXE67591.1|1101230_1101569_+|tail	phage tail protein	tail	E4WL34	Enterobacteria_phage	100.0	2.3e-60
AXE67592.1|1101625_1102363_+|tail	phage minor tail protein L	tail	M9NYX1	Enterobacteria_phage	99.6	1.2e-146
AXE67593.1|1102365_1103085_+	peptidase P60	NA	K7PJY5	Enterobacterial_phage	99.2	1.8e-142
AXE67594.1|1103077_1103695_+|tail	tail assembly protein	tail	M9NZA3	Enterobacteria_phage	99.5	1.5e-105
AXE67595.1|1103737_1107229_+	host specificity protein J	NA	M9P0D8	Enterobacteria_phage	95.2	0.0e+00
AXE67596.1|1107230_1107533_+	hypothetical protein	NA	K7PJT3	Enterobacteria_phage	100.0	5.7e-50
AXE67597.1|1107532_1108207_+	hypothetical protein	NA	K7P7N1	Enterobacteria_phage	99.6	1.0e-123
AXE67598.1|1108318_1108552_+	cor protein	NA	K7PH20	Enterobacteria_phage	100.0	2.7e-39
AXE71020.1|1108595_1109879_+|tail	phage tail protein	tail	K7P6I4	Enterobacteria_phage	49.5	2.9e-103
AXE67599.1|1109987_1110227_+	DNA polymerase V	NA	I6PD82	Cronobacter_phage	43.0	3.7e-12
AXE67600.1|1110228_1110558_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.5	2.5e-22
AXE67601.1|1110815_1111382_-	hydrolase	NA	NA	NA	NA	NA
AXE67602.1|1111691_1113464_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AXE67603.1|1113581_1114034_+	NUDIX pyrophosphatase	NA	NA	NA	NA	NA
AXE67604.1|1114062_1114803_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AXE67605.1|1114837_1115359_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
AXE67606.1|1115360_1115963_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
AXE71021.1|1116033_1116099_+	hypothetical protein	NA	NA	NA	NA	NA
AXE67607.1|1116237_1116849_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AXE67608.1|1116857_1117868_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
AXE67609.1|1118208_1118994_-	zinc uptake system membrane protein ZnuB	NA	NA	NA	NA	NA
AXE67610.1|1118990_1119746_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
AXE71022.1|1119824_1120757_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXE67611.1|1120772_1122095_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
AXE67612.1|1122214_1123186_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
AXE67613.1|1123316_1124759_-	pyruvate kinase	NA	NA	NA	NA	NA
AXE67614.1|1124886_1125756_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AXE67615.1|1126093_1127569_+	glucose-6-phosphate 1-dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
AXE67616.1|1127803_1129615_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
AXE67617.1|1129651_1130293_+	KHG/KDPG aldolase	NA	NA	NA	NA	NA
AXE67618.1|1130348_1131527_-	phosphoribosylglycinamide formyltransferase 2	NA	NA	NA	NA	NA
AXE67619.1|1131660_1131951_+	damage-inducible protein YebG	NA	NA	NA	NA	NA
AXE67620.1|1132017_1132374_+	protein YebF	NA	NA	NA	NA	NA
AXE67621.1|1132700_1133360_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
AXE67622.1|1133568_1135629_+	oligopeptidase B	NA	NA	NA	NA	NA
AXE67623.1|1135625_1136288_-	DNA polymerase III subunit epsilon	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
AXE67624.1|1136311_1136968_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AXE67625.1|1137069_1137300_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
AXE67626.1|1137438_1137813_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AXE67627.1|1137816_1138689_+	hypothetical protein	NA	NA	NA	NA	NA
AXE67628.1|1138701_1139043_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AXE67629.1|1139438_1140095_+	protein-serine/threonine phosphatase	NA	A0A2D1GLI5	Escherichia_phage	49.5	4.9e-54
AXE71023.1|1140095_1140287_-	DUF1482 family protein	NA	NA	NA	NA	NA
AXE67630.1|1140391_1140628_-	DUF1480 family protein	NA	NA	NA	NA	NA
AXE71024.1|1140745_1142185_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
AXE67631.1|1142264_1144898_-	MCE family protein	NA	NA	NA	NA	NA
AXE67632.1|1144866_1146150_-	paraquat-inducible membrane protein A	NA	NA	NA	NA	NA
AXE67633.1|1146279_1146777_+	GAF domain-containing protein	NA	NA	NA	NA	NA
AXE67634.1|1146873_1147572_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
AXE67635.1|1147591_1149640_+|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.5	1.2e-85
AXE67636.1|1149831_1150713_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 4
CP030919	Escherichia coli strain KL53 chromosome, complete genome	4810511	1397194	1444491	4810511	tail,protease,lysis,transposase	Enterobacteria_phage(28.12%)	61	NA	NA
AXE67874.1|1397194_1398016_-|protease	serine protease	protease	NA	NA	NA	NA
AXE67875.1|1398115_1398199_-	hypothetical protein	NA	NA	NA	NA	NA
AXE67876.1|1398291_1398627_-	acid shock protein	NA	NA	NA	NA	NA
AXE67877.1|1399023_1400277_-	MFS transporter	NA	NA	NA	NA	NA
AXE67878.1|1400383_1401277_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AXE67879.1|1401411_1402632_+	ROK family transcriptional regulator	NA	NA	NA	NA	NA
AXE67880.1|1402756_1403452_+	dethiobiotin synthase	NA	NA	NA	NA	NA
AXE71038.1|1403404_1404697_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
AXE67881.1|1404855_1405470_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
AXE67882.1|1405512_1406367_-	dimethylsulfoxide reductase	NA	NA	NA	NA	NA
AXE67883.1|1406368_1406986_-	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
AXE71039.1|1406996_1409420_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
AXE67884.1|1409480_1411907_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	2.9e-213
AXE67885.1|1412105_1412411_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AXE67886.1|1412592_1413866_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
AXE67887.1|1413884_1414565_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
AXE67888.1|1414567_1415128_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AXE67889.1|1415162_1415504_-	DUF1283 family protein	NA	NA	NA	NA	NA
AXE67890.1|1415638_1415965_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AXE67891.1|1416001_1416190_+	hypothetical protein	NA	NA	NA	NA	NA
AXE67892.1|1416170_1417385_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AXE67893.1|1417396_1418416_+	starvation-sensing protein RspB	NA	E3SJ82	Synechococcus_phage	26.2	5.7e-17
AXE67894.1|1418473_1418584_+	transporter	NA	NA	NA	NA	NA
AXE67895.1|1418603_1419899_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.1	3.3e-155
AXE67896.1|1419918_1420170_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AXE67897.1|1420242_1422714_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
AXE67898.1|1422806_1422998_-	DUF1482 family protein	NA	NA	NA	NA	NA
AXE67899.1|1422994_1423183_-	division inhibition protein DicB	NA	NA	NA	NA	NA
AXE67900.1|1423278_1423620_+	hypothetical protein	NA	U5P0A0	Shigella_phage	56.1	8.2e-37
AXE67901.1|1423660_1424083_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
AXE67902.1|1424079_1424436_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
AXE67903.1|1425588_1425768_+	hypothetical protein	NA	NA	NA	NA	NA
AXE67904.1|1425742_1425925_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
AXE67905.1|1426102_1427416_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AXE67906.1|1427460_1427583_+	plasmid mobilization protein	NA	NA	NA	NA	NA
AXE67907.1|1427852_1428185_-	protein FlxA	NA	NA	NA	NA	NA
AXE67908.1|1428387_1428693_-	hypothetical protein	NA	NA	NA	NA	NA
AXE67909.1|1428717_1428957_+	antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
AXE67910.1|1428956_1429244_+	mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
AXE67911.1|1429315_1429471_+	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
AXE67912.1|1429687_1429939_+	hypothetical protein	NA	NA	NA	NA	NA
AXE67913.1|1430005_1430284_+	hypothetical protein	NA	NA	NA	NA	NA
AXE67914.1|1430939_1432153_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
AXE67915.1|1432661_1433414_+	antitermination protein Q	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
AXE67916.1|1433835_1434048_-	cold-shock protein CspF	NA	NA	NA	NA	NA
AXE67917.1|1434348_1434564_+	cold-shock protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
AXE67918.1|1435317_1435533_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
AXE67919.1|1435537_1435849_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
AXE67920.1|1435845_1436379_+	lysozyme from lambdoid prophage Qin	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
AXE67921.1|1436375_1436873_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	28.8	6.4e-06
AXE67922.1|1437235_1437448_+	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AXE67923.1|1437458_1437647_+	cold-shock protein	NA	NA	NA	NA	NA
AXE67924.1|1437677_1437950_+	hypothetical protein	NA	NA	NA	NA	NA
AXE67925.1|1438121_1438295_+	protein GnsB	NA	NA	NA	NA	NA
AXE67926.1|1438446_1438857_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
AXE67927.1|1438914_1439148_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
AXE67928.1|1439295_1439397_+	hypothetical protein	NA	NA	NA	NA	NA
AXE67929.1|1441832_1442678_+|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	66.5	2.3e-48
AXE67930.1|1442677_1443253_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
AXE67931.1|1443350_1443941_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.5e-25
AXE67932.1|1444257_1444491_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
>prophage 5
CP030919	Escherichia coli strain KL53 chromosome, complete genome	4810511	1732450	1805768	4810511	tRNA,portal,holin,protease,transposase,terminase,tail	Enterobacteria_phage(50.85%)	87	NA	NA
AXE68176.1|1732450_1733500_-|protease	protease	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
AXE68177.1|1733719_1734478_+	NAD(P)-dependent oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	4.4e-06
AXE68178.1|1734474_1735065_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AXE68179.1|1735104_1735980_-	23S rRNA pseudouridylate synthase B	NA	NA	NA	NA	NA
AXE68180.1|1736190_1738086_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
AXE68181.1|1738113_1738734_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AXE68182.1|1738730_1739612_-	phosphatase	NA	NA	NA	NA	NA
AXE71056.1|1739749_1739794_+	trp operon leader peptide	NA	NA	NA	NA	NA
AXE68183.1|1739885_1741448_+	anthranilate synthase component I	NA	NA	NA	NA	NA
AXE68184.1|1741447_1743043_+	bifunctional glutamine amidotransferase/anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
AXE71057.1|1743046_1744405_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	3.3e-36
AXE68185.1|1744416_1745610_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AXE68186.1|1745609_1746416_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AXE68187.1|1746796_1746976_+	hypothetical protein	NA	NA	NA	NA	NA
AXE68188.1|1748384_1748891_+	YciE/YciF family protein	NA	NA	NA	NA	NA
AXE68189.1|1748950_1749589_-	outer membrane protein W	NA	NA	NA	NA	NA
AXE68190.1|1749945_1750689_+	UPF0259 family protein	NA	NA	NA	NA	NA
AXE68191.1|1750718_1751258_+	intracellular septation protein A	NA	NA	NA	NA	NA
AXE68192.1|1751362_1751761_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AXE71058.1|1751800_1752520_-	protein TonB	NA	NA	NA	NA	NA
AXE68193.1|1752743_1753040_+	YciI family protein	NA	NA	NA	NA	NA
AXE68194.1|1753486_1754770_-|tail	phage tail protein	tail	K7P6I4	Enterobacteria_phage	49.5	7.2e-102
AXE68195.1|1754815_1755049_-	cor protein	NA	E4WL42	Enterobacteria_phage	100.0	2.3e-38
AXE68196.1|1755160_1755835_-	hypothetical protein	NA	K7PGX6	Enterobacteria_phage	99.6	1.5e-122
AXE68197.1|1755834_1756137_-	hypothetical protein	NA	K7PJT3	Enterobacteria_phage	100.0	5.7e-50
AXE68198.1|1756138_1759630_-	host specificity protein J	NA	M9P0D8	Enterobacteria_phage	95.2	0.0e+00
AXE68199.1|1759672_1760290_-|tail	tail assembly protein	tail	M9NZA3	Enterobacteria_phage	99.5	1.5e-105
AXE68200.1|1760282_1761002_-	peptidase P60	NA	K7PJY5	Enterobacterial_phage	99.2	1.8e-142
AXE68201.1|1761004_1761742_-|tail	phage minor tail protein L	tail	M9NYX1	Enterobacteria_phage	99.6	1.2e-146
AXE68202.1|1761798_1762137_-|tail	phage tail protein	tail	E4WL34	Enterobacteria_phage	100.0	2.3e-60
AXE68203.1|1762133_1765394_-|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	96.5	0.0e+00
AXE68204.1|1765377_1765692_-|tail	phage tail assembly protein T	tail	E4WL32	Enterobacteria_phage	95.2	9.8e-53
AXE68205.1|1765700_1766141_-|tail	phage minor tail protein G	tail	K7PJY4	Enterobacterial_phage	93.8	3.8e-71
AXE68206.1|1766151_1766895_-|tail	phage tail protein	tail	K7PKX6	Enterobacterial_phage	98.4	3.9e-132
AXE68207.1|1766904_1767306_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	100.0	4.1e-72
AXE68208.1|1767302_1767881_-|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	99.0	4.5e-96
AXE68209.1|1767890_1768166_-	DNA breaking-rejoining protein	NA	K7PH55	Enterobacterial_phage	96.2	5.9e-38
AXE68210.1|1768158_1768485_-	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	98.1	3.9e-52
AXE71059.1|1768567_1770514_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	99.2	0.0e+00
AXE68211.1|1770527_1772027_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	99.8	3.8e-288
AXE68212.1|1772023_1772239_-	hypothetical protein	NA	K7PMB5	Enterobacterial_phage	98.6	1.4e-31
AXE68213.1|1772235_1774338_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	98.7	0.0e+00
AXE71060.1|1774337_1774826_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	100.0	3.1e-82
AXE68214.1|1775106_1776009_-	S49 family peptidase	NA	NA	NA	NA	NA
AXE68215.1|1776012_1776213_-	hypothetical protein	NA	NA	NA	NA	NA
AXE68216.1|1776583_1777120_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	93.3	2.6e-74
AXE71061.1|1777119_1777686_-	lysozyme	NA	K7P7Q3	Enterobacteria_phage	92.0	2.1e-98
AXE68217.1|1777663_1777942_-|holin	holin	holin	K7PGZ9	Enterobacteria_phage	97.8	5.1e-45
AXE68218.1|1778149_1778320_+	DUF2116 family Zn-ribbon domain-containing protein	NA	NA	NA	NA	NA
AXE68219.1|1778795_1779221_-	HNH endonuclease	NA	S5YNW3	Mycobacterium_phage	52.0	2.3e-12
AXE68220.1|1779423_1779912_-	antiterminator	NA	M1FPN0	Enterobacteria_phage	99.4	5.9e-89
AXE68221.1|1779902_1780097_-	protein ninH	NA	K7PMJ0	Enterobacteria_phage	100.0	6.0e-29
AXE68222.1|1780093_1780456_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	85.0	7.8e-54
AXE68223.1|1780452_1780743_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	91.7	4.8e-46
AXE68224.1|1780735_1780906_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	60.0	2.9e-11
AXE68225.1|1780905_1781343_-	recombination protein NinB	NA	G8C7V3	Escherichia_phage	77.9	2.6e-59
AXE68226.1|1781711_1782149_+	hypothetical protein	NA	A0A222YWI5	Escherichia_phage	41.1	2.8e-13
AXE68227.1|1782150_1782768_-	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	86.5	1.1e-68
AXE68228.1|1782767_1782968_-	hypothetical protein	NA	K7P6F8	Enterobacteria_phage	100.0	5.6e-30
AXE68229.1|1782960_1783356_-	ead/Ea22-like family protein	NA	K7P7J4	Enterobacteria_phage	100.0	6.8e-27
AXE68230.1|1783352_1783697_-	winged helix-turn-helix transcriptional regulator	NA	K7P7J0	Enterobacteria_phage	90.9	1.3e-50
AXE68231.1|1783698_1784388_-	phage replication protein	NA	K7P7B6	Enterobacteria_phage	100.0	6.8e-131
AXE68232.1|1784384_1785293_-	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	100.0	1.2e-159
AXE68233.1|1785378_1785921_-	regulator	NA	M9NZI6	Enterobacteria_phage	87.2	1.7e-81
AXE68234.1|1785950_1786172_-	helix-turn-helix domain-containing protein	NA	K7P6H5	Enterobacteria_phage	98.6	2.3e-32
AXE71062.1|1786289_1787000_+	helix-turn-helix transcriptional regulator	NA	M9NZE3	Enterobacteria_phage	98.7	1.5e-133
AXE68235.1|1787543_1788752_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	99.8	2.3e-235
AXE68236.1|1789080_1790013_+	hypothetical protein	NA	K7PGT0	Enterobacteria_phage	100.0	9.0e-171
AXE68237.1|1790148_1790346_-	hypothetical protein	NA	G8C7T7	Escherichia_phage	87.5	5.0e-23
AXE68238.1|1790903_1791092_+	hypothetical protein	NA	K7P6V5	Enterobacteria_phage	98.4	8.7e-33
AXE71063.1|1791128_1791422_+	regulator	NA	M9P0E2	Enterobacteria_phage	99.0	2.0e-47
AXE68239.1|1791706_1791904_+	DUF1482 family protein	NA	NA	NA	NA	NA
AXE71064.1|1792234_1792906_+	hypothetical protein	NA	R9VWB9	Serratia_phage	36.6	5.5e-29
AXE68240.1|1792868_1793108_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AXE68241.1|1793104_1793347_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	78.8	4.0e-30
AXE71065.1|1793669_1793816_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	79.2	8.0e-18
AXE68242.1|1793825_1794062_+	excisionase	NA	Q8W657	Enterobacteria_phage	92.3	2.1e-39
AXE68243.1|1794120_1795434_+	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	89.9	4.3e-235
AXE68244.1|1795412_1796186_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	98.4	3.0e-71
AXE68245.1|1796238_1796634_+	hypothetical protein	NA	NA	NA	NA	NA
AXE68246.1|1796674_1797418_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	3.5e-24
AXE68247.1|1797414_1798386_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AXE68248.1|1798550_1800980_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	NA	NA	NA	NA
AXE68249.1|1801004_1802105_-	cytochrome C	NA	NA	NA	NA	NA
AXE68250.1|1802492_1803239_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AXE68251.1|1803252_1803819_-	VOC family protein	NA	NA	NA	NA	NA
AXE68252.1|1804034_1805768_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
>prophage 6
CP030919	Escherichia coli strain KL53 chromosome, complete genome	4810511	1891466	1945035	4810511	integrase,transposase	Enterobacteria_phage(22.22%)	40	1943246:1943259	1944428:1944441
AXE71068.1|1891466_1892680_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
AXE68343.1|1899538_1900591_-	lipopolysaccharide heptosyltransferase family protein	NA	NA	NA	NA	NA
AXE68344.1|1902034_1903489_+	AMP nucleosidase	NA	NA	NA	NA	NA
AXE68345.1|1904011_1905220_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
AXE68346.1|1905159_1905384_-	hypothetical protein	NA	A9CR10	Bovine_papillomavirus	95.0	5.9e-12
AXE68347.1|1906738_1907656_+	nitrogen assimilation regulatory protein nac	NA	NA	NA	NA	NA
AXE68348.1|1907757_1908708_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
AXE68349.1|1908921_1910409_-	FMN/FAD transporter	NA	NA	NA	NA	NA
AXE68350.1|1910825_1912100_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	38.5	4.2e-70
AXE68351.1|1912146_1913535_-	SpnT protein	NA	NA	NA	NA	NA
AXE68352.1|1913729_1915616_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	44.4	1.2e-137
AXE68353.1|1915625_1918586_+	restriction endonuclease subunit R	NA	A0A2K5B2C2	Erysipelothrix_phage	38.7	3.8e-162
AXE68354.1|1918712_1920245_-	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	NA	NA	NA	NA
AXE68355.1|1920544_1920868_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
AXE68356.1|1920951_1921467_-	hypothetical protein	NA	NA	NA	NA	NA
AXE68357.1|1921493_1921808_-	hypothetical protein	NA	NA	NA	NA	NA
AXE68358.1|1923418_1924930_+	molybdopterin-guanine dinucleotide biosynthesis protein MobA	NA	NA	NA	NA	NA
AXE68359.1|1925005_1925650_-	hypothetical protein	NA	NA	NA	NA	NA
AXE68360.1|1926443_1926737_+	hypothetical protein	NA	NA	NA	NA	NA
AXE68361.1|1926833_1927229_-	hypothetical protein	NA	NA	NA	NA	NA
AXE68362.1|1927341_1927635_-	hypothetical protein	NA	NA	NA	NA	NA
AXE68363.1|1927725_1928013_-	hypothetical protein	NA	NA	NA	NA	NA
AXE68364.1|1928029_1928416_-	hypothetical protein	NA	NA	NA	NA	NA
AXE68365.1|1928430_1928742_-	hypothetical protein	NA	NA	NA	NA	NA
AXE68366.1|1928771_1928987_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	50.0	6.5e-08
AXE68367.1|1929173_1930037_-	hypothetical protein	NA	NA	NA	NA	NA
AXE68368.1|1930494_1931427_-	L,D-transpeptidase	NA	NA	NA	NA	NA
AXE68369.1|1931491_1932571_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
AXE68370.1|1932582_1933326_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
AXE68371.1|1933322_1933868_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
AXE68372.1|1934001_1934142_-	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
AXE68373.1|1939316_1939457_-	hemolysin activation protein	NA	NA	NA	NA	NA
AXE71069.1|1939793_1940060_-	hypothetical protein	NA	NA	NA	NA	NA
AXE68374.1|1940005_1940407_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
AXE68375.1|1940486_1941074_+	hypothetical protein	NA	NA	NA	NA	NA
AXE68376.1|1941073_1941175_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
AXE68377.1|1941720_1942934_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
1943246:1943259	attL	AGCAACGAACACGT	NA	NA	NA	NA
AXE68378.1|1943285_1943675_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AXE68379.1|1943885_1943999_+|integrase	integrase	integrase	NA	NA	NA	NA
AXE68380.1|1944012_1945035_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	4.6e-200
1944428:1944441	attR	ACGTGTTCGTTGCT	NA	NA	NA	NA
>prophage 7
CP030919	Escherichia coli strain KL53 chromosome, complete genome	4810511	1975482	1981800	4810511		Enterobacteria_phage(50.0%)	7	NA	NA
AXE68412.1|1975482_1976040_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.1	7.3e-51
AXE68413.1|1976044_1976923_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.5e-106
AXE68414.1|1976980_1977880_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.8	2.2e-28
AXE68415.1|1977879_1978965_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.8	2.3e-101
AXE68416.1|1979037_1979301_+	hypothetical protein	NA	NA	NA	NA	NA
AXE68417.1|1979337_1980231_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
AXE68418.1|1980405_1981800_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.8	2.8e-19
>prophage 8
CP030919	Escherichia coli strain KL53 chromosome, complete genome	4810511	2071777	2081218	4810511		Enterobacteria_phage(85.71%)	10	NA	NA
AXE68488.1|2071777_2072914_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
AXE68489.1|2072910_2074911_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
AXE68490.1|2075035_2075497_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AXE68491.1|2075536_2076007_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
AXE68492.1|2076053_2076773_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AXE68493.1|2076769_2078455_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AXE68494.1|2078676_2079408_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AXE68495.1|2079467_2079575_+	hypothetical protein	NA	NA	NA	NA	NA
AXE68496.1|2079555_2080287_-	ABC transporter permease	NA	NA	NA	NA	NA
AXE68497.1|2080291_2081218_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 9
CP030919	Escherichia coli strain KL53 chromosome, complete genome	4810511	2466734	2476524	4810511	transposase	Escherichia_phage(75.0%)	10	NA	NA
AXE68832.1|2466734_2467943_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
AXE68833.1|2470840_2471344_-|transposase	IS1 family transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AXE68834.1|2471262_2471538_-|transposase	IS1 family transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AXE68835.1|2471588_2471726_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	95.5	1.2e-15
AXE68836.1|2471743_2471935_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
AXE68837.1|2471996_2472143_+	succinate dehydrogenase	NA	NA	NA	NA	NA
AXE68838.1|2472245_2472764_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.3e-62
AXE68839.1|2472779_2473319_+	hypothetical protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
AXE68840.1|2473411_2474989_-	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
AXE68841.1|2475057_2476524_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
>prophage 10
CP030919	Escherichia coli strain KL53 chromosome, complete genome	4810511	2596549	2612772	4810511	portal,integrase	Salmonella_phage(84.21%)	20	2597565:2597602	2613949:2613986
AXE68951.1|2596549_2597032_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
2597565:2597602	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGC	NA	NA	NA	NA
AXE68952.1|2597732_2598215_+	hypothetical protein	NA	Q19UP0	Mannheimia_phage	34.3	1.6e-17
AXE68953.1|2598241_2598460_-	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	77.8	7.5e-28
AXE68954.1|2599196_2600963_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AXE68955.1|2600962_2602003_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.9	1.8e-172
AXE68956.1|2602058_2602325_-	hypothetical protein	NA	NA	NA	NA	NA
AXE68957.1|2603654_2604395_+	DUF4145 domain-containing protein	NA	A0A1S6L018	Salmonella_phage	91.1	2.3e-132
AXE68958.1|2604523_2604829_-	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	2.3e-35
AXE71087.1|2604767_2604956_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
AXE68959.1|2605109_2607500_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.1	0.0e+00
AXE71088.1|2607499_2608321_-	hypothetical protein	NA	A0A0M4RCP6	Salmonella_phage	75.7	1.1e-122
AXE68960.1|2608326_2609181_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	89.8	6.4e-147
AXE68961.1|2609177_2609405_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
AXE68962.1|2609404_2609638_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.1e-32
AXE68963.1|2609705_2610047_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.3e-55
AXE68964.1|2610010_2610211_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
AXE68965.1|2610218_2610728_-	hypothetical protein	NA	E5G6L3	Salmonella_phage	94.1	1.9e-82
AXE68966.1|2610760_2611003_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
AXE68967.1|2611119_2611752_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	57.6	7.7e-65
AXE68968.1|2611755_2612772_+|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	92.9	7.5e-187
2613949:2613986	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGC	NA	NA	NA	NA
>prophage 11
CP030919	Escherichia coli strain KL53 chromosome, complete genome	4810511	2711394	2726078	4810511	integrase	Escherichia_phage(45.45%)	13	2706785:2706798	2723003:2723016
2706785:2706798	attL	TCCAGCAACGCCAG	NA	NA	NA	NA
AXE69055.1|2711394_2712678_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	23.7	3.1e-12
AXE69056.1|2712895_2715457_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	2.3e-30
AXE69057.1|2715562_2716219_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	45.3	5.2e-48
AXE69058.1|2716269_2717037_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
AXE69059.1|2717232_2718141_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.9e-118
AXE69060.1|2718137_2719400_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
AXE69061.1|2719396_2720035_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AXE69062.1|2720039_2720816_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AXE69063.1|2720904_2722269_+	permease	NA	NA	NA	NA	NA
AXE69064.1|2722362_2723355_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
2723003:2723016	attR	TCCAGCAACGCCAG	NA	NA	NA	NA
AXE69065.1|2723417_2724557_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
AXE69066.1|2724696_2725323_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
AXE69067.1|2725316_2726078_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 12
CP030919	Escherichia coli strain KL53 chromosome, complete genome	4810511	3727722	3737241	4810511		Enterobacteria_phage(100.0%)	11	NA	NA
AXE70003.1|3727722_3728886_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	93.3	5.0e-211
AXE70004.1|3728900_3730904_+	ATP-binding protein	NA	NA	NA	NA	NA
AXE70005.1|3731285_3731471_+	hypothetical protein	NA	NA	NA	NA	NA
AXE70006.1|3731434_3732001_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	7.7e-56
AXE70007.1|3732017_3732263_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	76.5	8.2e-31
AXE70008.1|3732259_3732997_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	63.9	3.4e-80
AXE70009.1|3733537_3733804_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
AXE70010.1|3733800_3734352_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	60.2	7.0e-30
AXE70011.1|3734348_3734576_+	hypothetical protein	NA	NA	NA	NA	NA
AXE70012.1|3734572_3734893_+	hypothetical protein	NA	NA	NA	NA	NA
AXE70013.1|3734907_3737241_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
>prophage 13
CP030919	Escherichia coli strain KL53 chromosome, complete genome	4810511	4389253	4394016	4810511	transposase	Enterobacteria_phage(57.14%)	8	NA	NA
AXE70584.1|4389253_4389520_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	98.9	1.8e-44
AXE70585.1|4389516_4390107_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	99.3	1.3e-69
AXE70586.1|4390099_4390387_+	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
AXE70587.1|4390379_4390835_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	1.0e-63
AXE70588.1|4390982_4391333_-|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	5.2e-39
AXE70589.1|4391477_4391735_+	hypothetical protein	NA	NA	NA	NA	NA
AXE70590.1|4392291_4393059_-	Fe(3+) dicitrate transport ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
AXE70591.1|4393059_4394016_-	Fe3+ dicitrate ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	8.2e-18
>prophage 1
CP030920	Escherichia coli strain KL53 plasmid pKL53-L, complete sequence	259094	1708	69649	259094	transposase,integrase	Shigella_phage(18.75%)	57	NA	NA
AXE71167.1|1708_2449_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
AXE71168.1|2781_3138_+|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	92.5	5.7e-33
AXE71169.1|3884_5098_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
AXE71170.1|7108_8182_-	FUSC family protein	NA	NA	NA	NA	NA
AXE71171.1|8199_8382_+	hypothetical protein	NA	NA	NA	NA	NA
AXE71172.1|8761_9685_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	3.8e-177
AXE71173.1|10826_11639_-	ribokinase	NA	NA	NA	NA	NA
AXE71174.1|11651_12626_-	SIS domain-containing protein	NA	NA	NA	NA	NA
AXE71175.1|12630_13416_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXE71176.1|13642_14407_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AXE71177.1|15256_15781_-	hypothetical protein	NA	NA	NA	NA	NA
AXE71178.1|15804_16332_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
AXE71179.1|17085_18009_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.5	1.1e-165
AXE71180.1|18272_19184_+	acetamidase	NA	A0A1V0S8X7	Catovirus	41.9	2.8e-07
AXE71181.1|19180_20524_+	amino acid permease	NA	NA	NA	NA	NA
AXE71182.1|21845_22946_+	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
AXE71183.1|23026_23278_-	hypothetical protein	NA	NA	NA	NA	NA
AXE71184.1|23313_23730_-	PIN domain-containing protein	NA	NA	NA	NA	NA
AXE71185.1|23726_23957_-	virulence-associated protein vagC	NA	NA	NA	NA	NA
AXE71186.1|24556_24775_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
AXE71187.1|24776_25082_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
AXE71188.1|26464_27259_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	87.8	1.2e-51
AXE71189.1|27835_28192_+|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	92.5	5.7e-33
AXE71190.1|28383_29656_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
AXE71191.1|30638_31484_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.9	1.4e-16
AXE71192.1|32484_32652_+|integrase	integrase	integrase	NA	NA	NA	NA
AXE71193.1|32936_34064_+	regulator	NA	NA	NA	NA	NA
AXE71194.1|34060_34654_+	ANTAR domain-containing protein	NA	NA	NA	NA	NA
AXE71195.1|34650_35499_+	ABC transporter permease	NA	NA	NA	NA	NA
AXE71196.1|35498_36419_+	ABC transporter permease	NA	NA	NA	NA	NA
AXE71197.1|36431_38036_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXE71198.1|38080_39028_+	acetamidase	NA	A0A1V0S8X7	Catovirus	22.9	1.3e-10
AXE71199.1|39035_40769_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
AXE71200.1|41620_41881_-	hypothetical protein	NA	NA	NA	NA	NA
AXE71201.1|42009_42576_+	DUF2913 family protein	NA	NA	NA	NA	NA
AXE71202.1|42757_43762_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AXE71203.1|43949_44558_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXE71204.1|44554_45706_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXE71205.1|45702_46908_+	ABC transporter permease	NA	NA	NA	NA	NA
AXE71206.1|46909_47620_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	3.7e-31
AXE71207.1|47648_48122_+	cytochrome C	NA	NA	NA	NA	NA
AXE71208.1|48108_49596_+	RND transporter	NA	NA	NA	NA	NA
AXE71209.1|49725_50283_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	82.1	2.6e-48
AXE71210.1|51584_52589_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AXE71211.1|53048_53369_+	DUF134 domain-containing protein	NA	NA	NA	NA	NA
AXE71212.1|53343_53805_+	dinitrogenase iron-molybdenum cofactor	NA	NA	NA	NA	NA
AXE71213.1|53965_54403_+	PaaI family thioesterase	NA	NA	NA	NA	NA
AXE71214.1|54517_54994_+	DNA starvation/stationary phase protection protein	NA	G0X506	Salmonella_phage	28.7	6.7e-05
AXE71215.1|55298_55649_-	transcriptional regulator	NA	NA	NA	NA	NA
AXE71216.1|55810_57469_+	CoA-disulfide reductase	NA	NA	NA	NA	NA
AXE71217.1|57714_58179_+	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
AXE71218.1|58288_58420_+	ABC transporter	NA	NA	NA	NA	NA
AXE71219.1|59753_61817_-	ATP-binding protein	NA	NA	NA	NA	NA
AXE71220.1|61813_63205_-	hypothetical protein	NA	NA	NA	NA	NA
AXE71221.1|63281_63863_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	48.9	5.5e-41
AXE71222.1|67169_67526_+	hypothetical protein	NA	NA	NA	NA	NA
AXE71377.1|68302_69649_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP030920	Escherichia coli strain KL53 plasmid pKL53-L, complete sequence	259094	82093	208055	259094	protease,transposase	Stx2-converting_phage(16.13%)	109	NA	NA
AXE71234.1|82093_82441_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AXE71235.1|82440_83118_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	4.3e-21
AXE71236.1|83094_83184_+	copper resistance protein	NA	NA	NA	NA	NA
AXE71237.1|83221_84757_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	2.0e-260
AXE71238.1|84806_85154_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
AXE71239.1|85150_85534_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	36.3	4.1e-13
AXE71240.1|85714_86149_-	copper-binding protein	NA	NA	NA	NA	NA
AXE71241.1|86366_87767_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	3.2e-18
AXE71242.1|87763_88444_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.8	3.9e-30
AXE71243.1|88498_89428_-	copper resistance protein CopD	NA	NA	NA	NA	NA
AXE71244.1|89432_89813_-	copper resistance system chaperone PcoC	NA	NA	NA	NA	NA
AXE71245.1|89852_90749_-	copper resistance protein B	NA	NA	NA	NA	NA
AXE71246.1|90748_92566_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
AXE71247.1|92800_93250_+	copper resistance protein	NA	NA	NA	NA	NA
AXE71248.1|93538_94276_+	peptidase	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	31.9	1.3e-10
AXE71249.1|94309_94507_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AXE71250.1|94547_96995_-	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.6	2.9e-83
AXE71251.1|97121_97562_-	hypothetical protein	NA	NA	NA	NA	NA
AXE71252.1|97648_100795_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.5	1.8e-61
AXE71253.1|100805_102098_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXE71254.1|102211_102565_-	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXE71255.1|102593_103979_-	Cu(I)/Ag(I) efflux RND transporter outer membrane protein	NA	NA	NA	NA	NA
AXE71256.1|104168_104849_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.1	6.0e-31
AXE71257.1|104841_106323_+	Cu(+)/Ag(+) sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	1.8e-27
AXE71258.1|106567_106999_+	silver-binding protein SilE	NA	NA	NA	NA	NA
AXE71259.1|107146_107497_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	50.5	2.3e-18
AXE71260.1|109717_123139_+	tandem-95 repeat protein	NA	NA	NA	NA	NA
AXE71261.1|123215_125135_+	TolC family protein	NA	NA	NA	NA	NA
AXE71262.1|125149_126031_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXE71263.1|126027_127377_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXE71264.1|127378_129511_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AXE71380.1|130158_130290_+	ABC transporter	NA	NA	NA	NA	NA
AXE71265.1|130328_131309_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	3.4e-184
AXE71266.1|132538_132919_+	hypothetical protein	NA	NA	NA	NA	NA
AXE71267.1|132976_133642_+	hypothetical protein	NA	NA	NA	NA	NA
AXE71268.1|133701_134157_+	hypothetical protein	NA	NA	NA	NA	NA
AXE71269.1|134198_134435_+	hypothetical protein	NA	NA	NA	NA	NA
AXE71270.1|134470_134755_+	hypothetical protein	NA	NA	NA	NA	NA
AXE71271.1|134932_135337_+	DNA-binding protein	NA	NA	NA	NA	NA
AXE71272.1|135412_135592_+	hypothetical protein	NA	NA	NA	NA	NA
AXE71273.1|135678_135882_-	hypothetical protein	NA	NA	NA	NA	NA
AXE71274.1|135943_136801_-	HNH endonuclease	NA	G0X580	Salmonella_phage	34.2	3.9e-11
AXE71275.1|136816_137125_-	hypothetical protein	NA	NA	NA	NA	NA
AXE71276.1|137673_138099_-	hypothetical protein	NA	NA	NA	NA	NA
AXE71277.1|138352_139168_-	HNH endonuclease	NA	G0X580	Salmonella_phage	36.5	1.1e-15
AXE71278.1|139180_139591_-	hypothetical protein	NA	NA	NA	NA	NA
AXE71279.1|139692_139899_-	hypothetical protein	NA	NA	NA	NA	NA
AXE71280.1|141071_142094_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AXE71281.1|142178_145166_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.9	3.3e-299
AXE71282.1|145333_145975_+	resolvase	NA	NA	NA	NA	NA
AXE71283.1|146231_147155_-	cation transporter	NA	NA	NA	NA	NA
AXE71381.1|147354_147927_-	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
AXE71284.1|148402_149641_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	23.1	2.5e-11
AXE71285.1|149939_150935_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.6	1.4e-20
AXE71286.1|151779_152931_-	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	7.5e-26
AXE71287.1|152955_153921_-|protease	Zn-dependent protease	protease	NA	NA	NA	NA
AXE71288.1|153898_154396_-	phosphate-starvation-inducible E family protein	NA	NA	NA	NA	NA
AXE71289.1|154392_156108_-	sodium:proton exchanger	NA	NA	NA	NA	NA
AXE71290.1|156111_156552_-	thioredoxin TrxC	NA	A0A023NHA9	Dinoroseobacter_phage	34.7	2.6e-11
AXE71291.1|156541_157687_-	hypothetical protein	NA	NA	NA	NA	NA
AXE71292.1|157766_158378_-	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
AXE71293.1|158474_159362_-	hypothetical protein	NA	NA	NA	NA	NA
AXE71294.1|159464_160373_-	hypothetical protein	NA	NA	NA	NA	NA
AXE71295.1|160394_160853_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AXE71296.1|160931_162761_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	C7U047	Ostreococcus_tauri_virus	41.5	5.3e-106
AXE71382.1|162788_164219_-	cardiolipin synthase	NA	NA	NA	NA	NA
AXE71297.1|164235_167085_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.3	1.2e-128
AXE71298.1|167182_167752_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AXE71299.1|167787_168069_-	DNA-binding protein	NA	NA	NA	NA	NA
AXE71300.1|168296_168560_-	hypothetical protein	NA	NA	NA	NA	NA
AXE71301.1|169430_171053_-|transposase	transposase	transposase	NA	NA	NA	NA
AXE71302.1|171045_172548_-|transposase	transposase	transposase	NA	NA	NA	NA
AXE71303.1|172549_174160_-	ATP-binding protein	NA	NA	NA	NA	NA
AXE71383.1|174152_176213_-|transposase	transposase	transposase	NA	NA	NA	NA
AXE71304.1|176226_177054_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
AXE71305.1|177953_178157_-	hypothetical protein	NA	NA	NA	NA	NA
AXE71306.1|178171_178591_-	hypothetical protein	NA	NA	NA	NA	NA
AXE71307.1|178569_178962_-	hypothetical protein	NA	NA	NA	NA	NA
AXE71308.1|179304_179676_+	hypothetical protein	NA	NA	NA	NA	NA
AXE71309.1|179767_179959_+	hypothetical protein	NA	NA	NA	NA	NA
AXE71310.1|180008_180290_+	hypothetical protein	NA	NA	NA	NA	NA
AXE71311.1|180852_182094_-	tellurium resistance protein TerF	NA	NA	NA	NA	NA
AXE71312.1|182522_183098_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
AXE71313.1|183165_183744_-	TerD family protein	NA	A0A2P1N0L4	Streptomyces_phage	40.0	3.3e-06
AXE71314.1|183792_184833_-	tellurium resistance protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
AXE71315.1|184855_185311_-	Tellurite resistance protein TerB	NA	NA	NA	NA	NA
AXE71316.1|185333_186491_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
AXE71317.1|186490_187072_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	29.6	1.8e-12
AXE71318.1|187394_188453_+	carbamoyl-phosphate synthase large chain	NA	NA	NA	NA	NA
AXE71319.1|188462_189605_+	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.7e-30
AXE71320.1|189597_190371_+	hypothetical protein	NA	NA	NA	NA	NA
AXE71321.1|190372_191452_+	hypothetical protein	NA	A0A172Q0S8	Acinetobacter_phage	33.8	8.1e-38
AXE71322.1|191451_192408_+	citrate lyase subunit beta	NA	NA	NA	NA	NA
AXE71323.1|192418_193627_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
AXE71324.1|193644_194112_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
AXE71325.1|194574_195213_+	VWA domain-containing protein	NA	NA	NA	NA	NA
AXE71326.1|195235_195877_+	tellurium resistance protein TerX	NA	NA	NA	NA	NA
AXE71327.1|195876_196515_+	VWA domain-containing protein	NA	NA	NA	NA	NA
AXE71328.1|196600_197641_+	VWA domain-containing protein	NA	NA	NA	NA	NA
AXE71329.1|197640_199278_+	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
AXE71330.1|199303_200803_+	kinase	NA	NA	NA	NA	NA
AXE71331.1|200969_202052_-	hypothetical protein	NA	NA	NA	NA	NA
AXE71332.1|202412_202625_-	hypothetical protein	NA	NA	NA	NA	NA
AXE71333.1|202795_203971_+	recombinase	NA	A0A1B0V7J3	Salmonella_phage	26.6	1.6e-15
AXE71334.1|203992_204337_-	hypothetical protein	NA	NA	NA	NA	NA
AXE71335.1|204272_205178_-	hypothetical protein	NA	NA	NA	NA	NA
AXE71336.1|205187_206168_-	DNA replication protein	NA	NA	NA	NA	NA
AXE71337.1|206240_206687_-	hypothetical protein	NA	NA	NA	NA	NA
AXE71338.1|207038_208055_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	3.7e-186
>prophage 1
CP030921	Escherichia coli strain KL53 plasmid pKL53-M, complete sequence	109118	3983	52774	109118	transposase,integrase	Escherichia_phage(15.79%)	60	18475:18491	57629:57645
AXE71391.1|3983_5192_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	99.8	2.3e-235
AXE71392.1|5557_6763_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
AXE71393.1|7206_7527_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AXE71394.1|7519_7906_+	amino acid-binding protein	NA	NA	NA	NA	NA
AXE71395.1|7913_8600_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AXE71396.1|8577_9204_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AXE71397.1|9282_10488_+	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
AXE71398.1|10600_11269_-	putative tetracyline resistance transcriptional regulator TetC	NA	NA	NA	NA	NA
AXE71399.1|11707_12916_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
AXE71400.1|12985_14115_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.1	8.7e-51
AXE71401.1|14145_14769_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.3e-37
AXE71402.1|14894_17780_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.9	1.1e-190
AXE71403.1|17852_18845_+	hypothetical protein	NA	NA	NA	NA	NA
18475:18491	attL	ATCAGGCATGCCGTCTG	NA	NA	NA	NA
AXE71404.1|18903_19521_-	proQ/FINO family protein	NA	NA	NA	NA	NA
AXE71405.1|19715_21272_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
AXE71406.1|21536_22127_-	hypothetical protein	NA	NA	NA	NA	NA
AXE71407.1|22126_22384_-	hypothetical protein	NA	NA	NA	NA	NA
AXE71408.1|22712_23816_+	nucleotide-binding containing TIR-like domain protein	NA	NA	NA	NA	NA
AXE71409.1|23845_24976_+	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
AXE71410.1|24975_25266_+	korC	NA	NA	NA	NA	NA
AXE71411.1|25262_25460_-	hypothetical protein	NA	NA	NA	NA	NA
AXE71412.1|25784_26918_+	hypothetical protein	NA	NA	NA	NA	NA
AXE71413.1|26937_27222_+	korC	NA	NA	NA	NA	NA
AXE71414.1|27392_28040_-	hypothetical protein	NA	NA	NA	NA	NA
AXE71415.1|28027_28363_-	hypothetical protein	NA	NA	NA	NA	NA
AXE71416.1|28542_29124_-	hypothetical protein	NA	NA	NA	NA	NA
AXE71417.1|29275_29476_+	hypothetical protein	NA	NA	NA	NA	NA
AXE71418.1|29693_30044_+	hypothetical protein	NA	NA	NA	NA	NA
AXE71419.1|30113_30722_+	hypothetical protein	NA	NA	NA	NA	NA
AXE71420.1|30789_31572_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.4e-52
AXE71421.1|31709_31985_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AXE71422.1|31978_32623_-	chromosome partitioning protein ParA	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
AXE71423.1|32851_33823_+	plasmid segregation protein parM	NA	A0A222YXF2	Escherichia_phage	42.9	7.4e-67
AXE71424.1|33791_34220_+	plasmid stability protein	NA	NA	NA	NA	NA
AXE71425.1|34224_35496_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	60.5	1.4e-142
AXE71426.1|35495_35933_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
AXE71427.1|35929_36178_-	protein ImpC	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
AXE71428.1|36288_36558_+	hypothetical protein	NA	NA	NA	NA	NA
AXE71507.1|36595_37498_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
AXE71429.1|37881_38565_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.1e-29
AXE71430.1|38565_38787_+	hypothetical protein	NA	NA	NA	NA	NA
AXE71431.1|38799_39234_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AXE71432.1|40470_40896_+	antirestriction protein	NA	NA	NA	NA	NA
AXE71433.1|40942_41365_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AXE71434.1|41361_41553_+	hypothetical protein	NA	NA	NA	NA	NA
AXE71435.1|41667_41853_-	hypothetical protein	NA	NA	NA	NA	NA
AXE71436.1|41830_43498_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.0	4.3e-163
AXE71437.1|44211_44718_-	hypothetical protein	NA	NA	NA	NA	NA
AXE71438.1|44664_45192_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.5	1.6e-47
AXE71439.1|45249_45483_+	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	51.1	2.3e-06
AXE71440.1|45541_47500_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.9	5.6e-21
AXE71441.1|47551_47989_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
AXE71442.1|47985_48705_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AXE71443.1|48701_49298_+	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	56.6	9.0e-15
AXE71444.1|49759_50260_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	27.3	2.4e-05
AXE71445.1|50399_50699_-	hypothetical protein	NA	NA	NA	NA	NA
AXE71446.1|50720_50966_+	hypothetical protein	NA	NA	NA	NA	NA
AXE71447.1|50988_51423_+	post-segregation killing protein PndC	NA	NA	NA	NA	NA
AXE71448.1|51516_51783_+	hypothetical protein	NA	NA	NA	NA	NA
AXE71449.1|51847_52774_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.4	3.5e-66
57629:57645	attR	ATCAGGCATGCCGTCTG	NA	NA	NA	NA
>prophage 1
CP030922	Escherichia coli strain KL53 plasmid pKL53-S, complete sequence	77405	0	4633	77405		Morganella_phage(50.0%)	5	NA	NA
AXE71515.1|953_1283_-	hypothetical protein	NA	NA	NA	NA	NA
AXE71516.1|1447_2206_-	hypothetical protein	NA	A0A192YA72	Morganella_phage	34.5	8.5e-26
AXE71517.1|2368_3217_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AXE71518.1|3771_4266_-	type II toxin-antitoxin system YhaV family toxin	NA	NA	NA	NA	NA
AXE71607.1|4288_4633_-	type II toxin-antitoxin system PrlF family antitoxin	NA	K4FB87	Cronobacter_phage	50.0	2.9e-05
>prophage 2
CP030922	Escherichia coli strain KL53 plasmid pKL53-S, complete sequence	77405	10070	10763	77405		unidentified_phage(100.0%)	1	NA	NA
AXE71529.1|10070_10763_-	hypothetical protein	NA	H7BVT3	unidentified_phage	32.4	8.6e-09
>prophage 3
CP030922	Escherichia coli strain KL53 plasmid pKL53-S, complete sequence	77405	14173	15271	77405		Salmonella_phage(100.0%)	1	NA	NA
AXE71537.1|14173_15271_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	40.7	2.9e-67
>prophage 4
CP030922	Escherichia coli strain KL53 plasmid pKL53-S, complete sequence	77405	51597	62879	77405		Salmonella_phage(16.67%)	15	NA	NA
AXE71577.1|51597_52980_-	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	66.1	6.9e-167
AXE71578.1|53054_53579_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
AXE71579.1|54558_54771_+	hypothetical protein	NA	NA	NA	NA	NA
AXE71580.1|54826_55342_+	hypothetical protein	NA	NA	NA	NA	NA
AXE71581.1|55356_56583_+	3'-5' exonuclease	NA	A0A1D9C9N8	Salinivibrio_phage	37.9	6.2e-18
AXE71582.1|56594_56885_+	hypothetical protein	NA	NA	NA	NA	NA
AXE71583.1|56949_57186_+	hypothetical protein	NA	NA	NA	NA	NA
AXE71584.1|57225_57864_+	hypothetical protein	NA	NA	NA	NA	NA
AXE71585.1|57884_58667_+	resolvase	NA	I3WFA4	Macacine_betaherpesvirus	54.4	2.1e-19
AXE71586.1|58822_59056_-	hypothetical protein	NA	NA	NA	NA	NA
AXE71587.1|59353_59791_+	peptidase	NA	A0A218MND2	uncultured_virus	55.8	1.0e-28
AXE71588.1|59777_61040_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	48.2	6.8e-105
AXE71589.1|61178_61589_-	hypothetical protein	NA	NA	NA	NA	NA
AXE71590.1|61585_62032_-	hypothetical protein	NA	NA	NA	NA	NA
AXE71591.1|62162_62879_+	hypothetical protein	NA	A0A0B5A4P3	Achromobacter_phage	40.4	1.3e-28
