The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028806	Klebsiella pneumoniae strain WCHKP7E2 chromosome, complete genome	5371030	446643	516021	5371030	head,capsid,portal,integrase,terminase,protease,tail,tRNA	uncultured_Caudovirales_phage(61.11%)	75	464251:464268	480246:480263
AWA66618.1|446643_447591_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
AWA66619.1|447605_448115_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
AWA66620.1|448243_449368_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
AWA66621.1|449339_449813_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
AWA66622.1|449838_450381_+	hypothetical protein	NA	NA	NA	NA	NA
AWA66623.1|450385_450958_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
AWA66624.1|450961_451780_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
AWA66625.1|451776_452034_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
AWA71167.1|452009_452564_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AWA66626.1|458359_458581_-	hypothetical protein	NA	NA	NA	NA	NA
AWA66627.1|458874_461985_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
AWA66628.1|461997_463137_-	MexX family efflux pump subunit	NA	NA	NA	NA	NA
AWA66629.1|463515_464166_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
464251:464268	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
AWA66630.1|464441_465668_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
AWA66631.1|465760_466702_+	hypothetical protein	NA	NA	NA	NA	NA
AWA66632.1|466883_467168_+	transcriptional regulator	NA	NA	NA	NA	NA
AWA66633.1|467178_467958_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
AWA66634.1|468081_468276_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AWA71168.1|468409_468679_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
AWA66635.1|468671_468860_+	hypothetical protein	NA	NA	NA	NA	NA
AWA66636.1|468852_469167_+	hypothetical protein	NA	NA	NA	NA	NA
AWA66637.1|469163_469532_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
AWA66638.1|469528_469894_+	hypothetical protein	NA	NA	NA	NA	NA
AWA66639.1|469893_472029_+	DNA primase	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
AWA66640.1|472371_472707_+	hypothetical protein	NA	NA	NA	NA	NA
AWA66641.1|472755_473268_-	hypothetical protein	NA	NA	NA	NA	NA
AWA66642.1|473531_474698_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
AWA66643.1|474749_475310_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
AWA66644.1|475311_476553_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
AWA66645.1|476549_476885_+|head,tail	head-tail adaptor	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
AWA66646.1|476881_477181_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
AWA66647.1|477180_477624_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
AWA66648.1|477750_477942_+|terminase	terminase	terminase	NA	NA	NA	NA
AWA66649.1|477899_478256_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
AWA66650.1|478239_479901_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
AWA66651.1|479903_480095_+	hypothetical protein	NA	NA	NA	NA	NA
AWA66652.1|480248_480545_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
480246:480263	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
AWA66653.1|480569_481535_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
AWA66654.1|481692_481887_-	hypothetical protein	NA	NA	NA	NA	NA
AWA66655.1|481892_482774_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AWA66656.1|482785_484237_-	sodium/panthothenate symporter	NA	NA	NA	NA	NA
AWA66657.1|484226_484469_-	hypothetical protein	NA	NA	NA	NA	NA
AWA66658.1|484579_485929_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AWA66659.1|485939_486407_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
AWA66660.1|486429_486882_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AWA66661.1|487105_487714_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
AWA66662.1|487713_488715_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
AWA66663.1|488943_489135_+	hypothetical protein	NA	NA	NA	NA	NA
AWA66664.1|489214_491155_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
AWA66665.1|491276_491483_-	hypothetical protein	NA	NA	NA	NA	NA
AWA66666.1|491460_492504_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
AWA66667.1|492574_493567_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AWA66668.1|493566_494055_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AWA66669.1|494062_494644_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AWA66670.1|494646_496116_+	ribonuclease G	NA	NA	NA	NA	NA
AWA66671.1|496153_499951_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
AWA66672.1|500039_501485_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AWA66673.1|501520_502450_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
AWA66674.1|502581_502785_+	protein AaeX	NA	NA	NA	NA	NA
AWA66675.1|502792_503725_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
AWA66676.1|503730_505698_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
AWA66677.1|505777_506053_+	hypothetical protein	NA	NA	NA	NA	NA
AWA66678.1|506103_506370_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AWA66679.1|506468_506732_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AWA66680.1|507107_507578_-	arginine repressor	NA	NA	NA	NA	NA
AWA66681.1|507992_508931_+	malate dehydrogenase	NA	NA	NA	NA	NA
AWA66682.1|509067_510126_-|protease	serine endoprotease DegS	protease	NA	NA	NA	NA
AWA66683.1|510213_511581_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
AWA66684.1|511754_512153_-	DUF1043 domain-containing protein	NA	NA	NA	NA	NA
AWA66685.1|512343_513471_+	cell division protein ZapE	NA	NA	NA	NA	NA
AWA66686.1|513736_514165_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
AWA66687.1|514180_514573_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
AWA66688.1|514682_514886_-	hypothetical protein	NA	NA	NA	NA	NA
AWA66689.1|514884_515523_+	stringent starvation protein A	NA	NA	NA	NA	NA
AWA66690.1|515526_516021_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
>prophage 2
CP028806	Klebsiella pneumoniae strain WCHKP7E2 chromosome, complete genome	5371030	2747189	2758076	5371030		Escherichia_phage(87.5%)	9	NA	NA
AWA68744.1|2747189_2750297_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
AWA68745.1|2750351_2751617_+	MFS transporter	NA	NA	NA	NA	NA
AWA68746.1|2751647_2752736_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
AWA68747.1|2752822_2753083_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
AWA68748.1|2753380_2754241_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AWA68749.1|2754261_2755023_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AWA68750.1|2755283_2756186_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
AWA68751.1|2756197_2757463_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
AWA68752.1|2757455_2758076_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 3
CP028806	Klebsiella pneumoniae strain WCHKP7E2 chromosome, complete genome	5371030	2952117	3023614	5371030	head,terminase,plate,protease,tail,lysis	uncultured_Caudovirales_phage(34.0%)	82	NA	NA
AWA68934.1|2952117_2953203_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AWA68935.1|2953166_2954921_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AWA68936.1|2956592_2960018_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
AWA68937.1|2960001_2961141_-	hypothetical protein	NA	NA	NA	NA	NA
AWA68938.1|2961137_2961395_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
AWA68939.1|2961439_2963857_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
AWA68940.1|2963844_2964375_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AWA68941.1|2964442_2964973_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AWA68942.1|2965041_2965572_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AWA68943.1|2965639_2966170_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AWA68944.1|2966238_2966769_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AWA68945.1|2966832_2967612_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AWA68946.1|2967612_2969991_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.8	9.2e-18
AWA68947.1|2969983_2972638_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	2.5e-96
AWA68948.1|2972902_2973394_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AWA68949.1|2973398_2975105_-	OmpA family protein	NA	NA	NA	NA	NA
AWA68950.1|2975101_2975791_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AWA71262.1|2975787_2977128_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AWA68951.1|2977140_2978685_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AWA68952.1|2978727_2979219_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AWA68953.1|2980064_2980313_+	damage-inducible protein DinI	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
AWA68954.1|2980535_2980820_-	hypothetical protein	NA	NA	NA	NA	NA
AWA68955.1|2980924_2981134_-	hypothetical protein	NA	NA	NA	NA	NA
AWA68956.1|2981130_2981862_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71263.1|2981872_2982601_-	hypothetical protein	NA	NA	NA	NA	NA
AWA68957.1|2984951_2985149_-	hypothetical protein	NA	NA	NA	NA	NA
AWA68958.1|2985148_2986015_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
AWA68959.1|2986014_2986788_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
AWA68960.1|2986784_2987981_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
AWA68961.1|2987980_2988334_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
AWA68962.1|2988335_2988989_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
AWA68963.1|2989042_2989609_-	hypothetical protein	NA	NA	NA	NA	NA
AWA68964.1|2989645_2989831_+	hypothetical protein	NA	NA	NA	NA	NA
AWA68965.1|2989883_2990225_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
AWA68966.1|2990224_2991247_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
AWA68967.1|2991249_2991552_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
AWA68968.1|2991552_2992152_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
AWA68969.1|2992151_2994155_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
AWA68970.1|2994144_2994297_-	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
AWA68971.1|2994332_2994758_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
AWA68972.1|2994761_2995202_-	DUF3277 domain-containing protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
AWA68973.1|2995212_2996358_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
AWA68974.1|2996361_2996802_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
AWA68975.1|2996896_2997283_-|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
AWA68976.1|2997282_2997789_-	hypothetical protein	NA	NA	NA	NA	NA
AWA68977.1|2997785_2998205_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
AWA68978.1|2998173_2998455_-	hypothetical protein	NA	NA	NA	NA	NA
AWA68979.1|2998494_2999436_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
AWA68980.1|2999447_2999942_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
AWA68981.1|2999945_3001148_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
AWA68982.1|3001199_3001748_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
AWA68983.1|3001803_3003255_-	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
AWA68984.1|3003492_3004893_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
AWA68985.1|3004843_3005596_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
AWA68986.1|3005697_3006018_-	negative regulator GrlR	NA	NA	NA	NA	NA
AWA68987.1|3006252_3006642_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
AWA68988.1|3006638_3007169_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
AWA68989.1|3007171_3007420_-|lysis	lysis protein	lysis	NA	NA	NA	NA
AWA68990.1|3007825_3008608_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
AWA68991.1|3008604_3009081_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
AWA68992.1|3009077_3010040_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
AWA68993.1|3010041_3011700_-	helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
AWA68994.1|3012008_3012302_-	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	97.6	2.8e-38
AWA68995.1|3012276_3012498_-	XRE family transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
AWA68996.1|3012595_3013264_+	LexA family transcriptional repressor	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
AWA68997.1|3013434_3013749_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	99.0	1.3e-49
AWA68998.1|3013741_3013930_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
AWA68999.1|3014099_3014465_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
AWA69000.1|3014457_3014712_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
AWA69001.1|3014898_3015324_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
AWA69002.1|3015320_3015515_+	hypothetical protein	NA	NA	NA	NA	NA
AWA69003.1|3015511_3016339_+|protease	serine protease	protease	Q8W654	Enterobacteria_phage	84.0	5.5e-111
AWA69004.1|3016443_3016962_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
AWA69005.1|3016967_3017678_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
AWA69006.1|3017667_3017892_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
AWA69007.1|3017888_3018101_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
AWA69008.1|3018097_3018577_+	hypothetical protein	NA	NA	NA	NA	NA
AWA69009.1|3018755_3018998_+	AlpA family transcriptional regulator	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
AWA69010.1|3018978_3020160_-	DUF4102 domain-containing protein	NA	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
AWA69011.1|3020356_3020905_+|protease	protease	protease	NA	NA	NA	NA
AWA69012.1|3021103_3022636_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
AWA69013.1|3022852_3023614_-	3-oxoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 4
CP028806	Klebsiella pneumoniae strain WCHKP7E2 chromosome, complete genome	5371030	3311536	3320461	5371030	tail	Salmonella_phage(33.33%)	7	NA	NA
AWA69292.1|3311536_3312439_-	hypothetical protein	NA	M1PJH8	Synechococcus_phage	29.5	1.7e-33
AWA69293.1|3313145_3313964_-	hypothetical protein	NA	A0A2H4J9C3	uncultured_Caudovirales_phage	47.8	1.2e-22
AWA69294.1|3314041_3316870_-|tail	phage tail protein	tail	G0X4U7	Salmonella_phage	49.2	1.1e-272
AWA69295.1|3316883_3317786_-	hypothetical protein	NA	A0A2P1CAM5	Salmonella_phage	33.8	2.8e-15
AWA69296.1|3317800_3318439_-	hypothetical protein	NA	NA	NA	NA	NA
AWA69297.1|3318542_3319445_-	hypothetical protein	NA	H8ZM08	Pseudomonas_phage	31.6	4.1e-27
AWA69298.1|3319462_3320461_-	hypothetical protein	NA	A0A076G697	Vibrio_phage	37.9	7.5e-06
>prophage 5
CP028806	Klebsiella pneumoniae strain WCHKP7E2 chromosome, complete genome	5371030	3475324	3565049	5371030	head,capsid,portal,integrase,plate,protease,tail,tRNA,lysis	Salmonella_phage(57.63%)	98	3530850:3530868	3565124:3565142
AWA69431.1|3475324_3476617_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
AWA69432.1|3476707_3478051_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
AWA69433.1|3478059_3478671_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AWA69434.1|3478793_3483047_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
AWA69435.1|3483182_3483677_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AWA69436.1|3484209_3485178_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
AWA69437.1|3485292_3487059_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
AWA69438.1|3487059_3488781_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
AWA69439.1|3488825_3489527_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AWA69440.1|3489880_3490099_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AWA69441.1|3490219_3492499_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AWA69442.1|3492529_3492847_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AWA69443.1|3493172_3493394_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AWA69444.1|3493348_3493531_-	hypothetical protein	NA	NA	NA	NA	NA
AWA69445.1|3493470_3495411_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AWA69446.1|3495407_3496523_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
AWA69447.1|3496669_3498328_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AWA69448.1|3498747_3499443_+	aquaporin Z	NA	NA	NA	NA	NA
AWA69449.1|3499558_3500458_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
AWA71282.1|3500601_3502254_+	hydroxylamine reductase	NA	NA	NA	NA	NA
AWA69450.1|3502264_3503233_+	NADH oxidoreductase	NA	NA	NA	NA	NA
AWA69451.1|3503183_3503387_+	hypothetical protein	NA	NA	NA	NA	NA
AWA69452.1|3503444_3503879_-	DoxX family protein	NA	NA	NA	NA	NA
AWA71283.1|3504030_3505749_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
AWA69453.1|3505787_3506789_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AWA69454.1|3506799_3508242_+	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
AWA69455.1|3508329_3509343_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AWA69456.1|3509339_3510170_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
AWA69457.1|3510201_3511341_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AWA69458.1|3511393_3511573_+	hypothetical protein	NA	NA	NA	NA	NA
AWA69459.1|3512218_3512734_+	lipoprotein	NA	NA	NA	NA	NA
AWA69460.1|3512960_3513689_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
AWA71284.1|3513709_3514441_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWA69461.1|3514447_3515164_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
AWA69462.1|3515163_3515832_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
AWA69463.1|3516015_3516747_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWA69464.1|3516789_3518262_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
AWA69465.1|3518258_3518975_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
AWA69466.1|3519053_3520181_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
AWA69467.1|3520222_3520711_-	DUF2593 domain-containing protein	NA	NA	NA	NA	NA
AWA69468.1|3520768_3521614_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AWA69469.1|3521610_3522564_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AWA71285.1|3522574_3523708_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
AWA69470.1|3523871_3524984_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AWA69471.1|3525332_3525812_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AWA69472.1|3525900_3526803_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
AWA69473.1|3527624_3527912_-	hypothetical protein	NA	NA	NA	NA	NA
AWA69474.1|3528114_3528378_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
AWA69475.1|3528384_3528768_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71286.1|3529034_3530720_+	transporter	NA	NA	NA	NA	NA
3530850:3530868	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
AWA69476.1|3530940_3531159_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AWA69477.1|3531249_3532350_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.0	1.7e-176
AWA69478.1|3532346_3532832_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
AWA69479.1|3532828_3535906_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.6	0.0e+00
AWA69480.1|3535898_3536018_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AWA69481.1|3536032_3536335_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
AWA69482.1|3536389_3536905_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
AWA69483.1|3536914_3538087_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	1.3e-203
AWA71287.1|3538826_3539333_+	hypothetical protein	NA	NA	NA	NA	NA
AWA69484.1|3539335_3539746_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	43.3	1.1e-19
AWA69485.1|3539726_3539960_-	hypothetical protein	NA	NA	NA	NA	NA
AWA69486.1|3539962_3541447_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	78.1	3.9e-152
AWA69487.1|3541443_3542049_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	8.9e-111
AWA69488.1|3542041_3542950_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	5.0e-142
AWA69489.1|3542936_3543296_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
AWA69490.1|3543292_3543871_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
AWA69491.1|3543939_3544386_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.9e-62
AWA69492.1|3544378_3544810_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	1.3e-71
AWA69493.1|3544772_3544976_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	71.6	2.6e-22
AWA69494.1|3544905_3545334_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.4	8.4e-47
AWA69495.1|3545330_3545708_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71288.1|3545709_3546183_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AWA69496.1|3546202_3546418_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	78.9	6.9e-26
AWA69497.1|3546421_3546625_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AWA69498.1|3546624_3547089_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	88.3	9.3e-76
AWA69499.1|3547184_3547835_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	95.8	1.2e-110
AWA69500.1|3547838_3548897_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
AWA69501.1|3548913_3549747_-|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	91.3	2.2e-123
AWA69502.1|3549889_3551656_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
AWA69503.1|3551655_3552687_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.6	1.3e-170
AWA69504.1|3552712_3553675_-	DNA-processing protein DprA	NA	S6BFL3	Thermus_phage	30.2	1.8e-20
AWA69505.1|3553679_3554249_-	hypothetical protein	NA	NA	NA	NA	NA
AWA69506.1|3554599_3554905_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AWA71289.1|3554843_3555032_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
AWA69507.1|3555185_3557600_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.3	0.0e+00
AWA69508.1|3557596_3558454_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.1	8.6e-160
AWA69509.1|3558450_3558753_-	DUF3850 domain-containing protein	NA	A0A0A8WI22	Clostridium_phage	42.1	9.8e-10
AWA69510.1|3558749_3558977_-	hypothetical protein	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
AWA69511.1|3558976_3559210_-	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
AWA69512.1|3559277_3559619_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
AWA69513.1|3559700_3559949_+	hypothetical protein	NA	NA	NA	NA	NA
AWA69514.1|3560034_3560331_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.2	1.1e-21
AWA69515.1|3560338_3560848_-	hypothetical protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AWA69516.1|3560880_3561102_-	regulator	NA	NA	NA	NA	NA
AWA69517.1|3561227_3562109_+	chromosome partitioning protein ParB	NA	A0A1S6KZZ7	Salmonella_phage	45.3	6.4e-41
AWA69518.1|3562189_3563392_+	hypothetical protein	NA	NA	NA	NA	NA
AWA69519.1|3563393_3563915_+	hypothetical protein	NA	NA	NA	NA	NA
AWA69520.1|3563996_3565049_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	6.1e-107
3565124:3565142	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 6
CP028806	Klebsiella pneumoniae strain WCHKP7E2 chromosome, complete genome	5371030	3981631	4056539	5371030	coat,head,terminase,integrase,transposase,tail,tRNA,lysis	Escherichia_phage(23.33%)	90	4003376:4003422	4053611:4053657
AWA69888.1|3981631_3983149_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	9.5e-85
AWA69889.1|3983480_3984956_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.0	6.9e-48
AWA69890.1|3985015_3987163_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
AWA69891.1|3988949_3990518_-	transcriptional regulator CadC	NA	NA	NA	NA	NA
AWA69892.1|3990810_3991083_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AWA69893.1|3991183_3992104_-	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	40.1	5.4e-51
AWA69894.1|3992614_3993481_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWA69895.1|3993503_3994529_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AWA69896.1|3994530_3996966_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AWA69897.1|3996976_3997672_-	fimbrial chaperone	NA	NA	NA	NA	NA
AWA69898.1|3997730_3998291_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AWA69899.1|3998762_3999425_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AWA69900.1|3999402_3999708_+	hypothetical protein	NA	NA	NA	NA	NA
AWA69901.1|3999760_4001065_-	citrate synthase	NA	NA	NA	NA	NA
AWA69902.1|4001309_4001498_+	hypothetical protein	NA	NA	NA	NA	NA
AWA69903.1|4001575_4001746_+	ATP-NAD kinase	NA	NA	NA	NA	NA
AWA69904.1|4001824_4002226_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AWA69905.1|4002621_4002915_-	hypothetical protein	NA	NA	NA	NA	NA
4003376:4003422	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AWA69906.1|4003577_4003895_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.9	3.7e-23
AWA69907.1|4003894_4004134_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	50.6	6.1e-15
AWA69908.1|4004211_4005696_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AWA69909.1|4005695_4005947_-	hypothetical protein	NA	NA	NA	NA	NA
AWA69910.1|4006148_4006358_-	hypothetical protein	NA	NA	NA	NA	NA
AWA69911.1|4006354_4007086_-	hypothetical protein	NA	NA	NA	NA	NA
AWA71312.1|4007089_4007959_-	hypothetical protein	NA	NA	NA	NA	NA
AWA69912.1|4010163_4012641_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	45.6	2.7e-198
AWA69913.1|4012627_4013023_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
AWA69914.1|4013019_4013490_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
AWA71313.1|4013489_4013909_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	48.5	1.8e-30
AWA69915.1|4014008_4017455_-	hypothetical protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.4e-163
AWA69916.1|4017547_4018051_-	hypothetical protein	NA	NA	NA	NA	NA
AWA69917.1|4018178_4018964_-	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
AWA69918.1|4019029_4019743_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
AWA69919.1|4019732_4019903_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
AWA69920.1|4020002_4020362_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
AWA69921.1|4020378_4020849_-	hypothetical protein	NA	NA	NA	NA	NA
AWA69922.1|4021142_4021397_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
AWA69923.1|4021399_4022155_-	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
AWA69924.1|4022330_4023008_-	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
AWA69925.1|4023060_4023813_-	DNA breaking-rejoining protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
AWA69926.1|4023881_4024274_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	5.1e-35
AWA69927.1|4024270_4024696_-	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
AWA69928.1|4024698_4025061_-	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
AWA69929.1|4025060_4025234_-	50S ribosomal protein L13	NA	I6R0P9	Salmonella_phage	56.1	1.4e-13
AWA69930.1|4025233_4025614_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
AWA69931.1|4025616_4025856_-	hypothetical protein	NA	NA	NA	NA	NA
AWA69932.1|4025866_4026961_-|coat	phage coat protein	coat	F1C5E1	Cronobacter_phage	62.8	1.7e-123
AWA69933.1|4026972_4027401_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
AWA69934.1|4027404_4028790_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
AWA69935.1|4028862_4029339_-	hypothetical protein	NA	NA	NA	NA	NA
AWA69936.1|4029380_4030385_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	9.0e-116
AWA69937.1|4030359_4031781_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
AWA69938.1|4031793_4033266_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
AWA69939.1|4033265_4033868_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
AWA69940.1|4034238_4034568_+	hypothetical protein	NA	NA	NA	NA	NA
AWA69941.1|4034673_4035138_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
AWA69942.1|4035134_4035665_-	lysozyme	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
AWA69943.1|4035667_4035916_-|lysis	lysis protein	lysis	NA	NA	NA	NA
AWA69944.1|4036652_4037699_-|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
AWA69945.1|4037926_4038616_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
AWA69946.1|4038612_4039143_-	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	5.2e-30
AWA69947.1|4039135_4039273_-	YlcG family protein	NA	NA	NA	NA	NA
AWA69948.1|4039269_4039905_-	NinG family protein	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
AWA69949.1|4039897_4040068_-	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
AWA69950.1|4040067_4040523_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
AWA69951.1|4040775_4041024_-	hypothetical protein	NA	NA	NA	NA	NA
AWA69952.1|4041023_4041671_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
AWA69953.1|4041843_4042686_-	addiction module toxin RelE	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
AWA69954.1|4042792_4043299_-	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
AWA69955.1|4043295_4043589_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
AWA69956.1|4043588_4045019_-	replicative DNA helicase	NA	Q9MCT4	Escherichia_phage	66.7	2.6e-185
AWA69957.1|4045008_4045908_-	DNA replication protein	NA	F1C5C3	Cronobacter_phage	54.9	5.4e-88
AWA69958.1|4046132_4046354_-	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
AWA69959.1|4046394_4046628_-	transcriptional regulator	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
AWA69960.1|4046755_4047445_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.2	4.3e-61
AWA69961.1|4047795_4048011_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
AWA69962.1|4048110_4048305_+	hypothetical protein	NA	NA	NA	NA	NA
AWA69963.1|4048393_4048678_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
AWA69964.1|4048693_4049539_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.9e-69
AWA69965.1|4049535_4050216_+	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
AWA69966.1|4050212_4050371_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
AWA69967.1|4050367_4051024_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
AWA69968.1|4051020_4051788_+	dcm methylase	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
AWA69969.1|4051784_4052003_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
AWA69970.1|4052004_4052220_+	conjugal transfer protein TraR	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
AWA71314.1|4052221_4052557_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AWA71315.1|4052553_4053597_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	86.2	2.5e-177
AWA69971.1|4054027_4054894_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
4053611:4053657	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AWA69972.1|4054895_4055108_+	ribosome-associated protein	NA	NA	NA	NA	NA
AWA69973.1|4055153_4056539_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 7
CP028806	Klebsiella pneumoniae strain WCHKP7E2 chromosome, complete genome	5371030	4267400	4279054	5371030	integrase	Enterobacteria_phage(70.0%)	13	4267850:4267864	4290907:4290921
AWA70169.1|4267400_4268504_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
4267850:4267864	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
AWA70170.1|4268514_4269768_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
AWA70171.1|4270120_4271311_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
AWA70172.1|4271298_4272249_+	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
AWA70173.1|4272248_4272674_+	hypothetical protein	NA	NA	NA	NA	NA
AWA70174.1|4273242_4273809_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
AWA70175.1|4273826_4274072_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
AWA70176.1|4274068_4274806_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
AWA70177.1|4275347_4275614_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
AWA70178.1|4275610_4276168_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
AWA70179.1|4276164_4276392_+	hypothetical protein	NA	NA	NA	NA	NA
AWA70180.1|4276388_4276709_+	hypothetical protein	NA	NA	NA	NA	NA
AWA70181.1|4276720_4279054_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
4290907:4290921	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 1
CP028804	Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence	323934	107708	153767	323934	transposase,protease	uncultured_Caudovirales_phage(30.77%)	47	NA	NA
AWA65822.1|107708_108713_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AWA65823.1|110047_110752_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWA65824.1|111607_112435_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
AWA65825.1|112431_113295_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AWA66042.1|113303_114131_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
AWA65826.1|114139_115150_+	phosphonate dehydrogenase	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
AWA65827.1|115143_116013_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWA66044.1|116718_117045_-	hypothetical protein	NA	NA	NA	NA	NA
AWA66043.1|117096_117183_+	ABC transporter	NA	NA	NA	NA	NA
AWA65828.1|117221_118202_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AWA66045.1|120188_120470_+	DNA-binding protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
AWA65829.1|120504_121074_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AWA65830.1|121188_123984_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
AWA65831.1|123983_124181_+	hypothetical protein	NA	NA	NA	NA	NA
AWA65832.1|124418_125168_+	diguanylate cyclase	NA	NA	NA	NA	NA
AWA65833.1|125154_126117_+|protease	Zn-dependent protease	protease	NA	NA	NA	NA
AWA66046.1|127959_129306_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AWA65834.1|129517_130000_-	N-acetyltransferase	NA	NA	NA	NA	NA
AWA65835.1|129987_130254_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AWA65836.1|130429_130684_-	hypothetical protein	NA	NA	NA	NA	NA
AWA65837.1|130759_131017_-	hypothetical protein	NA	NA	NA	NA	NA
AWA65838.1|131065_131269_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
AWA65839.1|131302_131671_-	hypothetical protein	NA	NA	NA	NA	NA
AWA65840.1|131714_132209_-	DNA-binding protein	NA	NA	NA	NA	NA
AWA65841.1|132239_132815_-	hypothetical protein	NA	NA	NA	NA	NA
AWA65842.1|132802_133072_-	hypothetical protein	NA	NA	NA	NA	NA
AWA65843.1|133429_133780_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
AWA65844.1|133829_134192_+	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AWA65845.1|134209_135961_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AWA65846.1|136008_137298_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
AWA65847.1|137310_137736_+	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
AWA65848.1|137768_138305_-	N-acetyltransferase	NA	NA	NA	NA	NA
AWA65849.1|140201_140564_-	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AWA65850.1|140639_141185_-	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
AWA66047.1|141193_141904_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
AWA65851.1|141903_142230_-	transcriptional regulator	NA	NA	NA	NA	NA
AWA65852.1|142561_143059_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWA65853.1|143108_143618_-	porin	NA	NA	NA	NA	NA
AWA66048.1|145360_145540_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AWA65854.1|145771_146206_-	copper-binding protein	NA	NA	NA	NA	NA
AWA65855.1|146422_147823_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
AWA65856.1|147819_148500_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
AWA65857.1|148554_149484_-	copper resistance protein D	NA	NA	NA	NA	NA
AWA65858.1|149488_149869_-	copper resistance system chaperone PcoC	NA	NA	NA	NA	NA
AWA65859.1|149908_150805_-	copper resistance protein B	NA	NA	NA	NA	NA
AWA65860.1|150804_152622_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
AWA65861.1|152786_153767_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 2
CP028804	Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence	323934	213092	305990	323934	transposase,integrase,bacteriocin	Escherichia_phage(42.86%)	104	255245:255304	308642:308657
AWA65919.1|213092_214016_-|transposase	IS5/IS1182 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	2.3e-166
AWA66053.1|214474_215161_+	conjugal transfer protein TraJ	NA	NA	NA	NA	NA
AWA66054.1|215244_215616_+	TraY domain-containing protein	NA	NA	NA	NA	NA
AWA65920.1|215669_216038_+	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
AWA65921.1|216051_216357_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
AWA65922.1|216376_216943_+	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
AWA65923.1|216929_217670_+	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
AWA65924.1|217669_219094_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
AWA65925.1|219086_219683_+	conjugal transfer protein TraP	NA	NA	NA	NA	NA
AWA65926.1|219705_220275_+	type IV conjugative transfer system protein TraV	NA	NA	NA	NA	NA
AWA65927.1|220406_220817_+	lipase chaperone	NA	NA	NA	NA	NA
AWA65928.1|220821_221112_+	hypothetical protein	NA	NA	NA	NA	NA
AWA65929.1|221135_221354_+	hypothetical protein	NA	NA	NA	NA	NA
AWA65930.1|221354_221672_+	hypothetical protein	NA	NA	NA	NA	NA
AWA65931.1|221738_222143_+	hypothetical protein	NA	NA	NA	NA	NA
AWA65932.1|222444_222837_+	hypothetical protein	NA	NA	NA	NA	NA
AWA65933.1|222908_225548_+	type IV secretion system protein TraC	NA	NA	NA	NA	NA
AWA65934.1|225547_225937_+	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
AWA65935.1|225936_226563_+	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
AWA65936.1|226573_227566_+	conjugal transfer protein TraU	NA	NA	NA	NA	NA
AWA65937.1|227578_228217_+	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
AWA66055.1|228264_230220_+	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
AWA65938.1|230251_230488_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
AWA65939.1|230484_230670_+	hypothetical protein	NA	NA	NA	NA	NA
AWA65940.1|230715_231042_+	hypothetical protein	NA	NA	NA	NA	NA
AWA65941.1|231062_231815_+	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
AWA65942.1|231825_232065_+	conjugal transfer protein TraQ	NA	NA	NA	NA	NA
AWA65943.1|232036_232609_+	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
AWA65944.1|232601_233030_+	conjugal transfer protein TrbF	NA	NA	NA	NA	NA
AWA65945.1|233016_234387_+	conjugal transfer protein TraH	NA	NA	NA	NA	NA
AWA65946.1|234386_237236_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AWA66056.1|237241_237769_+	conjugal transfer protein TraS	NA	NA	NA	NA	NA
AWA65947.1|237958_238690_+	complement resistance protein TraT	NA	NA	NA	NA	NA
AWA65948.1|239049_241359_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
AWA65949.1|241358_246620_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
AWA65950.1|246699_247425_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	29.4	5.5e-06
AWA65951.1|247582_248179_+	conjugal transfer protein	NA	NA	NA	NA	NA
AWA65952.1|248198_248546_+	hypothetical protein	NA	NA	NA	NA	NA
AWA65953.1|248760_249306_-	hypothetical protein	NA	NA	NA	NA	NA
AWA65954.1|249662_251984_+|bacteriocin	klebicin B-related nuclease bacteriocin	bacteriocin	NA	NA	NA	NA
AWA65955.1|251985_252264_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AWA66057.1|252532_253084_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	35.2	1.1e-19
AWA65956.1|253404_253683_+	replication protein	NA	NA	NA	NA	NA
AWA66058.1|253899_253977_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
AWA65957.1|253969_254827_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
255245:255304	attL	AGAGGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGA	NA	NA	NA	NA
AWA65958.1|255311_256016_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
255245:255304	attL	AGAGGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGA	NA	NA	NA	NA
AWA65959.1|255961_256390_-	hypothetical protein	NA	NA	NA	NA	NA
AWA65960.1|256328_257342_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AWA65961.1|257486_257984_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
AWA65962.1|258095_258386_+	hypothetical protein	NA	NA	NA	NA	NA
AWA65963.1|258391_259183_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AWA65964.1|259346_259694_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AWA65965.1|259687_260527_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AWA65966.1|260456_260636_-	hypothetical protein	NA	NA	NA	NA	NA
AWA65967.1|260654_260927_+	hypothetical protein	NA	NA	NA	NA	NA
AWA65968.1|261108_262113_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AWA65969.1|262340_263546_+	chromate transporter	NA	NA	NA	NA	NA
AWA65970.1|263556_263862_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AWA65971.1|263877_264060_-	resolvase	NA	NA	NA	NA	NA
AWA65972.1|264088_264853_+|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AWA65973.1|265043_265400_-	hypothetical protein	NA	NA	NA	NA	NA
AWA65974.1|265345_265930_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AWA65975.1|265929_267168_-	MFS transporter	NA	NA	NA	NA	NA
AWA65976.1|267164_268070_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AWA65977.1|268191_268896_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWA65978.1|269046_269862_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
268904:269727	attR	TCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGAACAATAAAACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTTATGAGCCATATTCAACGGGAAACGTCTTGCTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGATTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGGAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAGCTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAG	NA	NA	NA	NA
AWA65979.1|270051_270720_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.9e-130
268904:269727	attR	TCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGAACAATAAAACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTTATGAGCCATATTCAACGGGAAACGTCTTGCTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGATTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGGAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAGCTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAG	NA	NA	NA	NA
AWA65980.1|271011_272016_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AWA65981.1|274945_275650_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWA65982.1|275830_276535_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWA65983.1|277546_278089_-	tunicamycin resistance protein	NA	NA	NA	NA	NA
AWA65984.1|278101_278962_-	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
AWA65985.1|279068_279773_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWA65986.1|280095_281628_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AWA65987.1|282156_282606_-	hypothetical protein	NA	NA	NA	NA	NA
AWA65988.1|283120_283231_-	hypothetical protein	NA	E4ZFP9	Streptococcus_phage	88.6	1.9e-08
AWA65989.1|283235_283973_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	6.3e-135
AWA65990.1|284098_284194_-	23S rRNA methyltransferase attenuator leader peptide ErmL	NA	NA	NA	NA	NA
AWA65991.1|284328_285033_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWA65992.1|285154_286060_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AWA65993.1|286056_287295_+	MFS transporter	NA	NA	NA	NA	NA
AWA65994.1|287294_287879_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AWA65995.1|287824_288181_+	hypothetical protein	NA	NA	NA	NA	NA
AWA65996.1|288371_289136_-|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AWA65997.1|289164_289347_+	resolvase	NA	NA	NA	NA	NA
AWA65998.1|289338_290328_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AWA65999.1|290324_290561_-	mercury resistance protein	NA	NA	NA	NA	NA
AWA66000.1|290557_290923_-	transcriptional regulator	NA	NA	NA	NA	NA
AWA66001.1|291034_291673_-	organomercurial lyase MerB	NA	NA	NA	NA	NA
AWA66002.1|291687_293373_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.9	1.1e-38
AWA66003.1|293444_293720_-	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AWA66004.1|293735_294086_-	mercuric transporter	NA	NA	NA	NA	NA
AWA66005.1|294157_294592_+	mercuric resistance operon regulatory protein	NA	NA	NA	NA	NA
AWA66006.1|294691_295696_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AWA66007.1|296311_296713_+	hypothetical protein	NA	NA	NA	NA	NA
AWA66008.1|296826_297552_+	hypothetical protein	NA	NA	NA	NA	NA
AWA66009.1|297526_297730_-	hypothetical protein	NA	NA	NA	NA	NA
AWA66010.1|297684_301938_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	47.6	1.1e-18
AWA66011.1|301909_302350_+	hypothetical protein	NA	NA	NA	NA	NA
AWA66012.1|302988_303591_-	hypothetical protein	NA	NA	NA	NA	NA
AWA66013.1|303821_304142_+	hypothetical protein	NA	NA	NA	NA	NA
AWA66014.1|304160_304448_+	hypothetical protein	NA	NA	NA	NA	NA
AWA66015.1|304440_304977_+	hypothetical protein	NA	NA	NA	NA	NA
AWA66016.1|304979_305990_+|integrase	integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
308642:308657	attR	TAATTATGATAATTAC	NA	NA	NA	NA
>prophage 1
CP028805	Klebsiella pneumoniae strain WCHKP7E2 plasmid pKPC2_085072, complete sequence	131028	15530	26689	131028		Escherichia_phage(50.0%)	11	NA	NA
AWA66075.1|15530_16397_+	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
AWA66076.1|17506_18712_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	5.3e-163
AWA66077.1|18708_19686_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	53.8	1.4e-86
AWA66078.1|19767_21039_-	DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.7	7.5e-152
AWA66079.1|21038_21470_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
AWA66080.1|21628_21880_+	hypothetical protein	NA	NA	NA	NA	NA
AWA66081.1|21879_23364_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AWA66082.1|23612_24584_+	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
AWA66083.1|24586_25258_+	Mediator of plasmid stability	NA	NA	NA	NA	NA
AWA66084.1|25320_25551_+	hypothetical protein	NA	NA	NA	NA	NA
AWA66085.1|25987_26689_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	1.6e-26
>prophage 2
CP028805	Klebsiella pneumoniae strain WCHKP7E2 plasmid pKPC2_085072, complete sequence	131028	103804	130635	131028	transposase,bacteriocin	Salmonella_phage(27.27%)	25	NA	NA
AWA66165.1|103804_105343_+|transposase	IS66 family transposase ISKpn24	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.3	5.1e-280
AWA66193.1|105455_105713_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AWA66194.1|105942_106494_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.1	6.2e-18
AWA66166.1|106813_107092_+	replication protein	NA	NA	NA	NA	NA
AWA66195.1|107307_107385_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
AWA66167.1|107377_108235_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AWA66168.1|108539_108728_-	hypothetical protein	NA	NA	NA	NA	NA
AWA66196.1|108871_109060_-	hypothetical protein	NA	NA	NA	NA	NA
AWA66169.1|109551_110793_+	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
AWA66170.1|110800_111694_+	hypothetical protein	NA	NA	NA	NA	NA
AWA66171.1|111697_113695_+	hypothetical protein	NA	NA	NA	NA	NA
AWA66172.1|113691_114603_+	hypothetical protein	NA	NA	NA	NA	NA
AWA66173.1|114988_115321_+	hypothetical protein	NA	NA	NA	NA	NA
AWA66174.1|116256_116730_+	N-acetyltransferase	NA	NA	NA	NA	NA
AWA66175.1|117267_120234_-|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
AWA66176.1|120237_120798_-|transposase	transposase	transposase	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
AWA66177.1|122340_122619_+	hypothetical protein	NA	NA	NA	NA	NA
AWA66178.1|122729_123155_+	antirestriction protein	NA	A0A2D0W8Z5	Bordetella_virus	37.3	5.3e-17
AWA66179.1|123483_123780_+	transcriptional repressor protein KorC	NA	NA	NA	NA	NA
AWA66180.1|125014_125896_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AWA66181.1|126050_127031_-|transposase	IS481 family transposase ISKpn27	transposase	A8RHK4	Spiroplasma_virus	27.4	2.9e-10
AWA66182.1|127153_127711_-	recombinase	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
AWA66183.1|128027_128732_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWA66184.1|128829_129949_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.2	6.0e-52
AWA66185.1|129996_130635_+	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	65.5	8.3e-75
