The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024113	Bacillus cytotoxicus strain CH_3 chromosome, complete genome	4245145	157129	210997	4245145	integrase,protease,transposase	Bacillus_phage(26.67%)	55	156922:156970	174090:174138
156922:156970	attL	TGCTTCCATAGCTCAGCTGGTAGAGCACTTCCATGGTAAGGAAGAGGTC	NA	NA	NA	NA
AWC51198.1|157129_158056_+|integrase	integrase	integrase	A0A2I6UG75	Salinibacter_virus	24.5	5.5e-11
AWC54887.1|158361_159087_+	helix-turn-helix domain-containing protein	NA	A0A1I9S595	Bacillus_phage	28.6	2.0e-08
AWC51199.1|159579_159954_-	hypothetical protein	NA	NA	NA	NA	NA
AWC51200.1|161947_162562_+	hypothetical protein	NA	NA	NA	NA	NA
AWC51201.1|162567_162798_+	hypothetical protein	NA	NA	NA	NA	NA
AWC51202.1|162811_163048_+	hypothetical protein	NA	NA	NA	NA	NA
AWC51203.1|163077_163758_+	hypothetical protein	NA	NA	NA	NA	NA
AWC51204.1|163996_164821_+	hypothetical protein	NA	NA	NA	NA	NA
AWC51205.1|164835_165255_+	hypothetical protein	NA	NA	NA	NA	NA
AWC51206.1|165277_165487_+	hypothetical protein	NA	NA	NA	NA	NA
AWC51207.1|165507_165912_+	hypothetical protein	NA	NA	NA	NA	NA
AWC51208.1|166146_166797_+	hypothetical protein	NA	M1HN75	Bacillus_virus	34.6	2.1e-17
AWC51209.1|166904_167327_+	hypothetical protein	NA	A0A2P1JUJ6	Bacillus_phage	58.6	1.0e-33
AWC51210.1|167413_169600_+	hypothetical protein	NA	A0A2P1JUK2	Bacillus_phage	41.2	2.0e-11
AWC51211.1|169737_170022_+	hypothetical protein	NA	NA	NA	NA	NA
AWC51212.1|170038_170347_+	hypothetical protein	NA	NA	NA	NA	NA
AWC51213.1|170497_171349_+	DNA methyltransferase	NA	A0A1S5PRR3	Streptococcus_phage	52.3	6.7e-80
AWC51214.1|171332_172613_+	translation elongation factor	NA	NA	NA	NA	NA
AWC51215.1|172866_173190_+	hypothetical protein	NA	NA	NA	NA	NA
AWC51216.1|173252_173450_+	hypothetical protein	NA	NA	NA	NA	NA
AWC51217.1|173653_173869_+	hypothetical protein	NA	NA	NA	NA	NA
AWC51218.1|174911_176054_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.7	5.1e-51
174090:174138	attR	TGCTTCCATAGCTCAGCTGGTAGAGCACTTCCATGGTAAGGAAGAGGTC	NA	NA	NA	NA
AWC51219.1|176251_177145_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	31.1	7.9e-23
AWC51220.1|177398_178229_+	TIGR00159 family protein	NA	NA	NA	NA	NA
AWC51221.1|178221_179667_+	hypothetical protein	NA	NA	NA	NA	NA
AWC51222.1|179659_181006_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AWC51223.1|181490_183293_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q84421	Paramecium_bursaria_Chlorella_virus	40.3	3.1e-103
AWC51224.1|183523_184195_-	hypothetical protein	NA	A0A146ICT8	Staphylococcus_phage	55.6	1.1e-16
AWC51225.1|184620_185373_-|transposase	transposase	transposase	A0A059NT77	Lactococcus_phage	46.9	2.7e-56
AWC51226.1|185362_186658_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	27.1	8.5e-10
AWC51227.1|187529_188399_+	hypothetical protein	NA	A0A1X9I6E0	Streptococcus_phage	26.1	1.6e-07
AWC51228.1|188839_190033_+	radical SAM protein	NA	NA	NA	NA	NA
AWC51229.1|190025_191951_+	hypothetical protein	NA	NA	NA	NA	NA
AWC51230.1|191943_192534_+	radical SAM protein	NA	NA	NA	NA	NA
AWC51231.1|192520_193330_+	hypothetical protein	NA	NA	NA	NA	NA
AWC51232.1|194836_195541_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWC51233.1|196057_196801_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWC51234.1|197424_197664_-	hypothetical protein	NA	NA	NA	NA	NA
AWC51235.1|197710_197863_+	hypothetical protein	NA	NA	NA	NA	NA
AWC51236.1|198166_198823_+	hypothetical protein	NA	NA	NA	NA	NA
AWC54888.1|199056_199470_+	DUF1648 domain-containing protein	NA	NA	NA	NA	NA
AWC51237.1|200463_201630_+	MFS transporter	NA	NA	NA	NA	NA
AWC51238.1|201635_202097_+	hypothetical protein	NA	NA	NA	NA	NA
AWC51239.1|202099_202912_+	hypothetical protein	NA	NA	NA	NA	NA
AWC51240.1|202945_203227_+	hypothetical protein	NA	NA	NA	NA	NA
AWC51241.1|203231_204224_+	hypothetical protein	NA	NA	NA	NA	NA
AWC51242.1|204228_204483_+	hypothetical protein	NA	NA	NA	NA	NA
AWC51243.1|204479_205643_+	hypothetical protein	NA	NA	NA	NA	NA
AWC51244.1|205661_206897_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
AWC51245.1|206914_207646_+	adenylyltransferase	NA	S4VW33	Pandoravirus	31.3	4.1e-09
AWC51246.1|207786_208152_+	hypothetical protein	NA	NA	NA	NA	NA
AWC51247.1|208161_208365_+	hypothetical protein	NA	NA	NA	NA	NA
AWC51248.1|208306_208474_-	hypothetical protein	NA	NA	NA	NA	NA
AWC54889.1|209066_209489_+	hypothetical protein	NA	NA	NA	NA	NA
AWC51249.1|209845_210997_+|transposase	transposase	transposase	S6AND0	Bacillus_phage	80.4	9.1e-173
>prophage 2
CP024113	Bacillus cytotoxicus strain CH_3 chromosome, complete genome	4245145	287355	295333	4245145		uncultured_virus(33.33%)	6	NA	NA
AWC51317.1|287355_287640_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	52.7	5.8e-20
AWC51318.1|287674_289303_+	molecular chaperone GroEL	NA	A0A219YK78	uncultured_virus	56.9	1.5e-157
AWC51319.1|289729_291277_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	30.6	2.2e-20
AWC51320.1|291650_292976_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	31.8	4.4e-46
AWC51321.1|293118_293820_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.7	8.6e-41
AWC54892.1|293845_295333_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.2	1.3e-33
>prophage 3
CP024113	Bacillus cytotoxicus strain CH_3 chromosome, complete genome	4245145	328309	336681	4245145		Synechococcus_phage(33.33%)	8	NA	NA
AWC51332.1|328309_329611_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	31.6	2.0e-19
AWC51333.1|329705_330425_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	43.9	9.8e-48
AWC51334.1|330417_330672_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AWC51335.1|330668_331352_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AWC51336.1|331335_333555_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.2	2.0e-160
AWC51337.1|333539_334955_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.2	3.6e-54
AWC51338.1|335057_336101_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	48.0	2.7e-70
AWC51339.1|336093_336681_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.2	1.6e-24
>prophage 4
CP024113	Bacillus cytotoxicus strain CH_3 chromosome, complete genome	4245145	758225	796414	4245145	coat,transposase	Thermus_phage(20.0%)	39	NA	NA
AWC51682.1|758225_759356_+|transposase	transposase	transposase	S6C485	Thermus_phage	32.1	1.2e-12
AWC51683.1|759359_761450_+|transposase	transposase	transposase	NA	NA	NA	NA
AWC51684.1|761451_761832_+|transposase	transposase	transposase	NA	NA	NA	NA
AWC51685.1|761910_762384_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
AWC51686.1|762619_763318_-	recombinase	NA	M9Q1K0	Clostridium_phage	25.4	2.9e-12
AWC51687.1|763559_763967_+	transcriptional repressor	NA	NA	NA	NA	NA
AWC51688.1|763981_764953_+	ornithine cyclodeaminase	NA	NA	NA	NA	NA
AWC51689.1|764967_766080_-	hypothetical protein	NA	NA	NA	NA	NA
AWC51690.1|766164_766536_+	hypothetical protein	NA	NA	NA	NA	NA
AWC51691.1|767089_767746_-	hypothetical protein	NA	NA	NA	NA	NA
AWC51692.1|768071_768470_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWC51693.1|768620_769475_+	patatin family protein	NA	NA	NA	NA	NA
AWC51694.1|769610_770912_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	34.1	4.5e-51
AWC51695.1|771199_772066_+	NAD(P)-dependent oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	43.3	6.6e-59
AWC51696.1|772238_773000_+	L,D-transpeptidase	NA	NA	NA	NA	NA
AWC51697.1|773092_773365_+	hypothetical protein	NA	NA	NA	NA	NA
AWC51698.1|773415_773631_-	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
AWC51699.1|773702_774113_-	thioredoxin	NA	NA	NA	NA	NA
AWC51700.1|774125_774545_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
AWC51701.1|774675_775551_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
AWC51702.1|775738_775987_-	hypothetical protein	NA	NA	NA	NA	NA
AWC51703.1|776087_776585_-	hypothetical protein	NA	NA	NA	NA	NA
AWC51704.1|776639_777740_-	spore gernimation protein GerB	NA	NA	NA	NA	NA
AWC51705.1|777752_778835_-	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
AWC51706.1|778831_780343_-	spore germination protein	NA	NA	NA	NA	NA
AWC51707.1|780618_781179_+	nitroreductase	NA	NA	NA	NA	NA
AWC51708.1|781863_783276_+	stage V sporulation protein R	NA	NA	NA	NA	NA
AWC51709.1|783475_783916_-	hypothetical protein	NA	NA	NA	NA	NA
AWC51710.1|784071_785238_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
AWC51711.1|785585_787241_-	sodium:phosphate symporter	NA	NA	NA	NA	NA
AWC51712.1|787583_788786_-	MFS transporter	NA	NA	NA	NA	NA
AWC51713.1|789106_790195_+	DUF871 domain-containing protein	NA	NA	NA	NA	NA
AWC51714.1|790235_791417_-	ABC transporter permease	NA	NA	NA	NA	NA
AWC51715.1|791419_792094_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.5	6.1e-36
AWC51716.1|792090_793194_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AWC51717.1|793813_795130_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
AWC51718.1|795344_795914_-|coat	spore coat protein CotJC	coat	NA	NA	NA	NA
AWC51719.1|795926_796190_-|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
AWC51720.1|796198_796414_-|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
>prophage 5
CP024113	Bacillus cytotoxicus strain CH_3 chromosome, complete genome	4245145	2345385	2413361	4245145	tail,holin,integrase,bacteriocin,transposase	Bacillus_phage(36.84%)	56	2340551:2340567	2374361:2374377
2340551:2340567	attL	TCCTTCTGCATCTAATA	NA	NA	NA	NA
AWC53087.1|2345385_2346533_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	66.4	1.8e-99
AWC53088.1|2346809_2348978_-|bacteriocin	bacteriocin-associated protein	bacteriocin	NA	NA	NA	NA
AWC53089.1|2349101_2349290_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53090.1|2349274_2349544_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53091.1|2350266_2350620_+|integrase	integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	34.1	6.5e-05
AWC53092.1|2350640_2350889_-	DUF4176 domain-containing protein	NA	NA	NA	NA	NA
AWC53093.1|2350889_2351078_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53094.1|2351108_2351300_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53095.1|2352587_2352950_-	DUF3958 domain-containing protein	NA	NA	NA	NA	NA
AWC53096.1|2352990_2353266_-	TIGR04197 family type VII secretion effector	NA	NA	NA	NA	NA
AWC53097.1|2353970_2356541_-	permease	NA	NA	NA	NA	NA
AWC53098.1|2356558_2357305_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	5.0e-31
AWC53099.1|2357670_2357994_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53100.1|2358001_2358526_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53101.1|2360659_2361043_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53102.1|2361331_2362057_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	37.8	1.3e-36
AWC53103.1|2362621_2362810_-	transcriptional regulator	NA	S5M643	Brevibacillus_phage	42.4	3.7e-07
AWC53104.1|2362799_2363123_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53105.1|2364379_2365360_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
AWC53106.1|2365422_2365671_-	hypothetical protein	NA	A0A288WFY7	Bacillus_phage	46.2	3.9e-12
AWC53107.1|2365943_2366993_-	oxidoreductase	NA	NA	NA	NA	NA
AWC53108.1|2367475_2367874_+	DUF2871 domain-containing protein	NA	NA	NA	NA	NA
AWC53109.1|2368772_2369033_-	DUF2642 domain-containing protein	NA	NA	NA	NA	NA
AWC53110.1|2369172_2369835_-	bacillithiol biosynthesis deacetylase BshB2	NA	NA	NA	NA	NA
AWC53111.1|2369850_2370201_-	DUF1806 domain-containing protein	NA	NA	NA	NA	NA
AWC53112.1|2370442_2371768_+	hypothetical protein	NA	NA	NA	NA	NA
AWC53113.1|2372107_2372635_-	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	66.3	4.8e-60
AWC53114.1|2372641_2374543_-	mannonate oxidoreductase	NA	F2Y0V3	Organic_Lake_phycodnavirus	25.0	3.4e-15
2374361:2374377	attR	TCCTTCTGCATCTAATA	NA	NA	NA	NA
AWC53115.1|2375095_2375887_+	arylamine N-acetyltransferase	NA	NA	NA	NA	NA
AWC53116.1|2376015_2377803_+	oligoendopeptidase F	NA	NA	NA	NA	NA
AWC53117.1|2377988_2379221_-	MFS transporter	NA	NA	NA	NA	NA
AWC53118.1|2379324_2380188_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWC53119.1|2380355_2381414_+	acyltransferase	NA	NA	NA	NA	NA
AWC53120.1|2381458_2382403_-	glycerophosphodiester phosphodiesterase	NA	A0A076G4Q2	Staphylococcus_phage	35.0	2.4e-38
AWC53121.1|2382881_2383424_-	N-acetyltransferase	NA	NA	NA	NA	NA
AWC53122.1|2383674_2384088_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53123.1|2384630_2385479_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	47.9	1.4e-08
AWC53124.1|2385897_2386536_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53125.1|2386562_2387375_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53126.1|2387856_2389236_+	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	35.7	1.4e-21
AWC53127.1|2389389_2391060_-	peptidase M4 family protein	NA	NA	NA	NA	NA
AWC53128.1|2391709_2393185_+	SELO family protein	NA	A0A075BSJ0	Microcystis_phage	30.7	3.4e-47
AWC53129.1|2393300_2394686_-	2-hydroxy-acid oxidase	NA	NA	NA	NA	NA
AWC53130.1|2395110_2395788_-	methyltransferase	NA	G3MA03	Bacillus_virus	43.3	8.1e-20
AWC53131.1|2396603_2397515_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53132.1|2397920_2398268_+	hypothetical protein	NA	NA	NA	NA	NA
AWC53133.1|2398409_2399486_+	hypothetical protein	NA	NA	NA	NA	NA
AWC53134.1|2400756_2401089_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53135.1|2401258_2401471_+	XRE family transcriptional regulator	NA	A0A076G7N2	Bacillus_phage	51.5	9.0e-10
AWC53136.1|2401570_2402155_+	hypothetical protein	NA	NA	NA	NA	NA
AWC53137.1|2402195_2403020_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4J966	uncultured_Caudovirales_phage	51.1	7.2e-79
AWC53138.1|2403035_2403266_-|holin	phage holin	holin	A0A0S2MVE8	Bacillus_phage	73.3	4.1e-24
AWC53139.1|2403280_2403565_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53140.1|2403604_2408101_-	hypothetical protein	NA	A0A0M4RER0	Bacillus_phage	45.3	2.8e-262
AWC53141.1|2408100_2409603_-|tail	phage tail protein	tail	A0A1B1P7W7	Bacillus_phage	73.9	5.0e-203
AWC53142.1|2409617_2413361_-|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	38.8	8.1e-53
>prophage 6
CP024113	Bacillus cytotoxicus strain CH_3 chromosome, complete genome	4245145	2421703	2434814	4245145		Bacillus_phage(41.67%)	17	NA	NA
AWC53156.1|2421703_2423407_-	hypothetical protein	NA	A0A142F1L6	Bacillus_phage	50.5	2.9e-159
AWC53157.1|2423406_2423880_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53158.1|2424948_2425773_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53159.1|2426168_2426735_-	hypothetical protein	NA	A0A2H4J2L4	uncultured_Caudovirales_phage	45.8	9.7e-35
AWC53160.1|2426746_2427124_-	hypothetical protein	NA	A0A0N9RZI0	Paenibacillus_phage	43.1	2.0e-15
AWC53161.1|2427508_2428147_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53162.1|2428158_2428392_-	glutaredoxin family protein	NA	A0A1B1P8E0	Bacillus_phage	64.5	1.2e-23
AWC53163.1|2428388_2428994_-	hypothetical protein	NA	A0A2H4JAZ2	uncultured_Caudovirales_phage	41.2	7.7e-38
AWC53164.1|2429054_2429681_-	hypothetical protein	NA	J9Q953	Bacillus_phage	43.2	1.4e-34
AWC53165.1|2429682_2430315_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53166.1|2430457_2430766_-	transglycosylase	NA	A0A0K2CZP5	Paenibacillus_phage	36.9	2.6e-05
AWC53167.1|2430765_2431161_-	alpha/beta hydrolase	NA	A0A2H4IZM2	uncultured_Caudovirales_phage	68.9	6.1e-44
AWC53168.1|2431446_2431974_-	hypothetical protein	NA	A0A0N9ST03	Paenibacillus_phage	44.6	3.2e-08
AWC53169.1|2431970_2432195_-	hypothetical protein	NA	U5Q038	Bacillus_phage	70.6	8.3e-22
AWC53170.1|2432194_2433241_-	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	58.6	4.8e-88
AWC53171.1|2433254_2433410_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53172.1|2434310_2434814_-	hypothetical protein	NA	A0A0A0RUN2	Bacillus_phage	47.3	3.8e-30
>prophage 7
CP024113	Bacillus cytotoxicus strain CH_3 chromosome, complete genome	4245145	2440421	2451218	4245145		uncultured_Caudovirales_phage(37.5%)	18	NA	NA
AWC53177.1|2440421_2441645_-	hypothetical protein	NA	A0A288WGM1	Bacillus_phage	47.8	9.9e-101
AWC53178.1|2441759_2441963_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWC54972.1|2442026_2442212_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWC53179.1|2442219_2443236_-	hypothetical protein	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	43.2	6.8e-71
AWC53180.1|2443262_2444606_-	DNA helicase	NA	A0A2H4IZL9	uncultured_Caudovirales_phage	55.8	7.5e-134
AWC53181.1|2444702_2444987_-	hypothetical protein	NA	A0A0H3V0M3	Geobacillus_virus	44.0	5.4e-10
AWC53182.1|2445234_2445651_-	hypothetical protein	NA	A0A0K2CNU6	Brevibacillus_phage	57.1	8.5e-12
AWC53183.1|2445671_2445923_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53184.1|2445969_2446221_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53185.1|2446267_2446456_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53186.1|2446819_2447584_-	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	56.5	3.7e-77
AWC53187.1|2447583_2448258_-	DUF723 domain-containing protein	NA	NA	NA	NA	NA
AWC54973.1|2448273_2448660_-	hypothetical protein	NA	A0A2H4J134	uncultured_Caudovirales_phage	36.2	5.5e-13
AWC53188.1|2448665_2448998_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53189.1|2448984_2449143_-	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
AWC53190.1|2449224_2449569_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53191.1|2449698_2450313_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53192.1|2450324_2451218_-	hypothetical protein	NA	A0A0N9RZE9	Paenibacillus_phage	30.9	5.5e-16
>prophage 8
CP024113	Bacillus cytotoxicus strain CH_3 chromosome, complete genome	4245145	2612907	2628388	4245145	integrase	Bacillus_phage(72.73%)	29	2624622:2624636	2631146:2631160
AWC53334.1|2612907_2613117_-	DNA-binding protein	NA	A0A1Z1LZP5	Bacillus_phage	62.1	1.4e-15
AWC53335.1|2613364_2613580_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53336.1|2613910_2614378_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	51.8	3.5e-30
AWC54978.1|2615115_2615391_-	DNA-binding protein	NA	A0A2H4JBQ8	uncultured_Caudovirales_phage	43.2	2.0e-09
AWC53337.1|2615359_2615557_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53338.1|2615630_2615822_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53339.1|2615920_2616301_-	ArpU family transcriptional regulator	NA	A0A0M4R397	Bacillus_phage	84.7	4.1e-53
AWC53340.1|2616305_2616593_-	hypothetical protein	NA	A6M999	Geobacillus_virus	70.2	4.2e-34
AWC53341.1|2616622_2616823_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53342.1|2616854_2617061_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53343.1|2617102_2617345_-	hypothetical protein	NA	A0A0S2MV78	Bacillus_phage	73.8	9.9e-29
AWC53344.1|2617374_2617602_-	hypothetical protein	NA	A0A288WFX6	Bacillus_phage	98.7	3.5e-36
AWC53345.1|2617642_2618281_-	hypothetical protein	NA	A0A0K2CP60	Brevibacillus_phage	49.0	1.5e-52
AWC53346.1|2618312_2618516_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53347.1|2618929_2619718_-	hypothetical protein	NA	A0A0M4RU33	Bacillus_phage	39.7	1.5e-28
AWC53348.1|2619710_2619899_-	hypothetical protein	NA	A0A0M4RD83	Bacillus_phage	56.7	3.6e-10
AWC53349.1|2619883_2620099_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53350.1|2620109_2620982_-	DNA replication protein	NA	A0A0M4RD64	Bacillus_phage	72.0	5.6e-114
AWC53351.1|2620911_2621700_-	phage replication protein	NA	A0A0M4S6Y4	Bacillus_phage	76.8	9.6e-89
AWC53352.1|2621700_2621970_-	hypothetical protein	NA	A0A0M4S680	Bacillus_phage	83.1	5.3e-39
AWC53353.1|2621950_2622805_-	hypothetical protein	NA	Q38143	Bacillus_phage	44.6	5.4e-53
AWC53354.1|2623955_2624195_-	hypothetical protein	NA	A0A0M4S677	Bacillus_phage	77.9	2.3e-22
AWC53355.1|2624521_2624704_-	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	43.5	4.4e-05
2624622:2624636	attL	ATTTCTTTCACTTCT	NA	NA	NA	NA
AWC53356.1|2624738_2625014_-	group-specific protein	NA	S5MC08	Brevibacillus_phage	59.3	3.6e-27
AWC53357.1|2625040_2625877_-	hypothetical protein	NA	A0A0M5M1L9	Bacillus_phage	84.9	2.6e-129
AWC53358.1|2625873_2626062_-	XRE family transcriptional regulator	NA	A0A1C8E998	Bacillus_phage	83.6	2.0e-21
AWC53359.1|2626334_2626754_+	XRE family transcriptional regulator	NA	A0A1C8E9A4	Bacillus_phage	89.2	1.1e-64
AWC53360.1|2626768_2627194_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1C8E988	Bacillus_phage	92.9	1.2e-72
AWC53361.1|2627230_2628388_+|integrase	site-specific integrase	integrase	A0A0S2SXP1	Bacillus_phage	76.1	1.2e-76
2631146:2631160	attR	ATTTCTTTCACTTCT	NA	NA	NA	NA
>prophage 9
CP024113	Bacillus cytotoxicus strain CH_3 chromosome, complete genome	4245145	2810669	2884637	4245145	tail,head,terminase,capsid,holin,tRNA,portal,integrase,protease	Bacillus_phage(77.78%)	85	2842212:2842229	2891358:2891375
AWC53517.1|2810669_2813435_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L9X8	Tupanvirus	27.3	2.8e-87
AWC53518.1|2813779_2814286_-	septum formation initiator	NA	NA	NA	NA	NA
AWC53519.1|2814378_2815152_-	RNA-binding protein	NA	NA	NA	NA	NA
AWC53520.1|2815166_2815430_-	YggT family protein	NA	NA	NA	NA	NA
AWC53521.1|2815436_2815907_-	cell division protein SepF	NA	NA	NA	NA	NA
AWC53522.1|2815925_2816600_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AWC53523.1|2816606_2817416_-	laccase domain-containing protein	NA	NA	NA	NA	NA
AWC53524.1|2817533_2817812_-	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
AWC53525.1|2818075_2818855_-	RNA polymerase sporulation sigma factor SigG	NA	A0A0Y0AU18	Bacillus_phage	43.4	3.4e-46
AWC53526.1|2819046_2819766_-	RNA polymerase sporulation sigma factor SigE	NA	A0A2H4JC68	uncultured_Caudovirales_phage	42.9	2.5e-19
AWC53527.1|2819785_2820712_-	sigma-E processing peptidase SpoIIGA	NA	NA	NA	NA	NA
AWC53528.1|2820927_2822082_-	cell division protein FtsZ	NA	NA	NA	NA	NA
AWC53529.1|2822121_2823426_-	cell division protein FtsA	NA	NA	NA	NA	NA
AWC53530.1|2823826_2824594_-	cell division protein DivIB	NA	NA	NA	NA	NA
AWC54985.1|2824691_2825597_-	UDP-N-acetylenolpyruvoylglucosamine reductase	NA	NA	NA	NA	NA
AWC53531.1|2825657_2826752_-	undecaprenyldiphospho-muramoylpentapeptide beta-N- acetylglucosaminyltransferase	NA	NA	NA	NA	NA
AWC54986.1|2826936_2828028_-	stage V sporulation protein E	NA	NA	NA	NA	NA
AWC53532.1|2828119_2829475_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
AWC53533.1|2829475_2830450_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
AWC53534.1|2830472_2831948_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
AWC53535.1|2832220_2834137_-	stage V sporulation protein D	NA	NA	NA	NA	NA
AWC54987.1|2834234_2836385_-	dihydropteridine reductase	NA	NA	NA	NA	NA
AWC53536.1|2836407_2836764_-	cell division protein FtsL	NA	NA	NA	NA	NA
AWC53537.1|2836779_2837712_-	ribosomal RNA small subunit methyltransferase H	NA	NA	NA	NA	NA
AWC54988.1|2838075_2839692_-	bacillithiol biosynthesis cysteine-adding enzyme BshC	NA	NA	NA	NA	NA
AWC54989.1|2839771_2840656_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AWC53538.1|2840957_2841431_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWC53539.1|2841526_2842048_-	RsfA family transcriptional regulator	NA	G3MB11	Bacillus_virus	47.8	4.0e-11
2842212:2842229	attL	GCTGCCCTAAAATAGCGG	NA	NA	NA	NA
AWC53540.1|2842307_2842481_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
AWC53541.1|2842542_2843043_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53542.1|2843324_2843945_-	hypothetical protein	NA	Q2LIA9	Bacillus_phage	76.8	1.0e-85
AWC53543.1|2843886_2845068_-	cell division protein FtsK	NA	Q3HKZ7	Bacillus_phage	84.5	3.0e-195
AWC53544.1|2845185_2845368_-	hypothetical protein	NA	Q2I8E2	Bacillus_phage	88.3	2.2e-20
AWC53545.1|2845364_2845673_-	hypothetical protein	NA	A0A288WG08	Bacillus_phage	78.4	3.8e-41
AWC53546.1|2845856_2846066_+	XRE family transcriptional regulator	NA	Q2I8E4	Bacillus_phage	79.4	2.7e-22
AWC53547.1|2846068_2846557_+	hypothetical protein	NA	Q3HL01	Bacillus_phage	61.7	8.1e-46
AWC53548.1|2846592_2847657_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7AQV3	Bacillus_phage	85.9	2.3e-178
AWC53549.1|2847653_2847893_-|holin	holin	holin	A0A2H4J378	uncultured_Caudovirales_phage	87.3	1.2e-29
AWC53550.1|2847892_2848129_-	hypothetical protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	78.2	1.2e-07
AWC53551.1|2848170_2852202_-	peptidase S74	NA	H0USX5	Bacillus_phage	44.9	1.7e-242
AWC53552.1|2852198_2853692_-|tail	phage tail protein	tail	A0A2H4JC38	uncultured_Caudovirales_phage	83.7	1.2e-254
AWC53553.1|2853700_2857741_-|tail	phage tail tape measure protein	tail	H0USX3	Bacillus_phage	75.1	0.0e+00
AWC53554.1|2857957_2858272_-	hypothetical protein	NA	A0A288WFU6	Bacillus_phage	70.2	1.8e-35
AWC53555.1|2858320_2858932_-|tail	phage tail protein	tail	A0A2H4J8F3	uncultured_Caudovirales_phage	94.5	8.4e-101
AWC53556.1|2858932_2859292_-	DUF3168 domain-containing protein	NA	A0A0S2GLE3	Bacillus_phage	90.8	1.4e-55
AWC53557.1|2859288_2859723_-	hypothetical protein	NA	A0A288WGB7	Bacillus_phage	84.9	8.2e-66
AWC53558.1|2859715_2860039_-|head,tail	head-tail adaptor protein	head,tail	A0A288WG18	Bacillus_phage	85.0	8.0e-50
AWC53559.1|2860035_2860326_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A288WGQ6	Bacillus_phage	88.5	3.6e-41
AWC53560.1|2860343_2861519_-|capsid	phage major capsid protein	capsid	A0A288WG01	Bacillus_phage	88.0	2.5e-186
AWC54990.1|2861560_2862133_-|head,protease	HK97 family phage prohead protease	head,protease	Q2I8F8	Bacillus_phage	91.1	1.3e-95
AWC53561.1|2862122_2863433_-|portal	phage portal protein	portal	Q2LIC9	Bacillus_phage	89.2	6.4e-215
AWC53562.1|2863448_2865146_-|terminase	terminase large subunit	terminase	A0A288WFW5	Bacillus_phage	91.7	0.0e+00
AWC53563.1|2865142_2865625_-|terminase	phage terminase small subunit P27 family	terminase	Q2I8G1	Bacillus_phage	92.5	1.4e-74
AWC53564.1|2865724_2866108_-	HNH endonuclease	NA	Q2I8B2	Bacillus_phage	90.6	2.2e-62
AWC53565.1|2866173_2866413_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53566.1|2867079_2867334_-	hypothetical protein	NA	A0A288WG25	Bacillus_phage	73.8	2.5e-30
AWC53567.1|2867353_2867545_-	hypothetical protein	NA	A0A288WFV5	Bacillus_phage	88.9	1.7e-23
AWC53568.1|2867550_2867769_-	hypothetical protein	NA	D2XR60	Bacillus_phage	73.6	3.3e-23
AWC53569.1|2868063_2868441_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	39.7	1.0e-16
AWC54991.1|2868498_2868819_-	hypothetical protein	NA	NA	NA	NA	NA
AWC54992.1|2868859_2869087_-	hypothetical protein	NA	A0A288WFX6	Bacillus_phage	68.0	2.2e-22
AWC53570.1|2869132_2869678_-	hypothetical protein	NA	A0A1I9S5V4	Bacillus_phage	78.0	3.5e-66
AWC53571.1|2869738_2870002_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53572.1|2870762_2871161_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53573.1|2871169_2872060_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
AWC53574.1|2872130_2872841_-	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
AWC53575.1|2872860_2873274_-	DUF1064 domain-containing protein	NA	A0A2P1JTY5	Anoxybacillus_phage	58.5	1.2e-34
AWC53576.1|2873266_2873761_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	A0A1B1P8C0	Bacillus_phage	70.6	3.2e-58
AWC53577.1|2873977_2874430_-	MFS transporter	NA	A0A0A7AQW3	Bacillus_phage	43.4	3.3e-33
AWC53578.1|2874444_2874927_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53579.1|2874907_2875102_-	hypothetical protein	NA	NA	NA	NA	NA
AWC54993.1|2875107_2875800_-	DNA replication protein	NA	A0A0S2GLK2	Bacillus_phage	50.6	7.9e-63
AWC53580.1|2875870_2876836_-	DnaD domain protein	NA	H0USU2	Bacillus_phage	51.9	9.7e-43
AWC53581.1|2877010_2877817_-	recombinase RecT	NA	S6AVW6	Thermus_phage	66.9	3.4e-97
AWC53582.1|2877816_2878056_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53583.1|2878070_2879006_-	hypothetical protein	NA	S6C475	Thermus_phage	59.5	1.9e-99
AWC53584.1|2879087_2879303_-	hypothetical protein	NA	NA	NA	NA	NA
AWC54994.1|2879478_2879772_-	hypothetical protein	NA	A0A0S2GLB6	Bacillus_phage	62.4	1.7e-27
AWC53585.1|2879779_2880100_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53586.1|2880247_2880457_-	DNA-binding protein	NA	A0A0U4IIS1	Bacillus_phage	50.9	4.4e-09
AWC53587.1|2880579_2880789_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWC53588.1|2880954_2881293_+	XRE family transcriptional regulator	NA	H0UST7	Bacillus_phage	53.3	1.3e-21
AWC53589.1|2881574_2881709_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53590.1|2881722_2882820_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53591.1|2883506_2884637_+|integrase	site-specific integrase	integrase	A0A0U4JNS1	Bacillus_phage	37.4	1.7e-62
2891358:2891375	attR	CCGCTATTTTAGGGCAGC	NA	NA	NA	NA
>prophage 10
CP024113	Bacillus cytotoxicus strain CH_3 chromosome, complete genome	4245145	3154822	3190236	4245145	tail,head,terminase,holin,portal	Bacillus_phage(87.18%)	47	NA	NA
AWC53887.1|3154822_3155395_+	DUF4352 domain-containing protein	NA	A0A1B1P898	Bacillus_phage	84.9	1.5e-54
AWC53888.1|3155706_3156147_+	hypothetical protein	NA	NA	NA	NA	NA
AWC53889.1|3156221_3157043_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2GLD4	Bacillus_phage	85.3	5.9e-142
AWC53890.1|3157042_3157483_-|holin	holin	holin	A0A1B1P7S2	Bacillus_phage	86.3	8.3e-66
AWC55008.1|3157494_3157800_-	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	58.0	1.4e-27
AWC53891.1|3157865_3162302_-	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	48.8	0.0e+00
AWC53892.1|3162298_3163792_-|tail	phage tail protein	tail	A0A1B1P7W7	Bacillus_phage	75.5	4.4e-228
AWC53893.1|3163804_3166732_-|tail	phage tail tape measure protein	tail	A0A0A7AR36	Bacillus_phage	55.7	2.9e-183
AWC53894.1|3166737_3167004_-	hypothetical protein	NA	A0A0M4S6X7	Bacillus_phage	60.2	8.3e-21
AWC53895.1|3167039_3167477_-	hypothetical protein	NA	A0A0M4QX42	Bacillus_phage	32.7	3.6e-13
AWC53896.1|3167522_3168155_-	hypothetical protein	NA	A0A0M4R5F9	Bacillus_phage	79.1	5.7e-76
AWC53897.1|3168172_3168553_-	hypothetical protein	NA	A0A0M4RD75	Bacillus_phage	83.3	1.8e-56
AWC53898.1|3168549_3168966_-	hypothetical protein	NA	A0A0M4S6Z2	Bacillus_phage	76.8	2.7e-58
AWC53899.1|3168949_3169309_-	hypothetical protein	NA	A0A0M4S6Z9	Bacillus_phage	81.2	5.7e-49
AWC53900.1|3169290_3169629_-	hypothetical protein	NA	W8CYS9	Bacillus_phage	39.6	2.9e-10
AWC53901.1|3169665_3170508_-	hypothetical protein	NA	A0A0M5M1L4	Bacillus_phage	77.7	5.2e-117
AWC53902.1|3170521_3171112_-	DUF4355 domain-containing protein	NA	A0A0M3ULE7	Bacillus_phage	55.8	4.6e-19
AWC53903.1|3171181_3172207_-|head	phage head morphogenesis protein	head	A0A0M5M7Z2	Bacillus_phage	84.1	5.1e-159
AWC53904.1|3172193_3173549_-|portal	phage portal protein	portal	A0A0M4S669	Bacillus_phage	85.6	3.5e-200
AWC53905.1|3173560_3174865_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0M4R5F3	Bacillus_phage	95.2	9.5e-251
AWC53906.1|3174851_3175283_-|terminase	terminase small subunit	terminase	A0A0M4RU19	Bacillus_phage	74.1	6.4e-55
AWC53907.1|3176046_3176292_-	DNA-binding protein	NA	A0A290FZJ4	Caldibacillus_phage	57.5	5.1e-17
AWC53908.1|3176695_3177076_-	ArpU family transcriptional regulator	NA	A0A0M4R397	Bacillus_phage	84.7	1.1e-53
AWC53909.1|3177080_3177368_-	hypothetical protein	NA	A6M999	Geobacillus_virus	70.2	4.2e-34
AWC53910.1|3177395_3177818_-	hypothetical protein	NA	R9TLR2	Paenibacillus_phage	41.3	2.0e-21
AWC55009.1|3178068_3178353_-	hypothetical protein	NA	I7J4K9	Bacillus_phage	48.9	4.3e-15
AWC53911.1|3178387_3178582_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53912.1|3178618_3178822_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53913.1|3178857_3179100_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53914.1|3179147_3179693_-	hypothetical protein	NA	A0A1I9S5V4	Bacillus_phage	78.0	3.5e-66
AWC55010.1|3180047_3180620_-	dUTPase	NA	A0A0A7AQI4	Bacillus_phage	77.0	1.2e-80
AWC53915.1|3180773_3181565_-	hypothetical protein	NA	A0A0M4RU33	Bacillus_phage	42.5	4.5e-30
AWC53916.1|3181551_3181746_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53917.1|3181730_3181946_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53918.1|3181948_3182131_-	hypothetical protein	NA	NA	NA	NA	NA
AWC55011.1|3182157_3182940_-	hypothetical protein	NA	U5PWH5	Bacillus_phage	38.3	2.9e-37
AWC53919.1|3182923_3183676_-	phage replication protein	NA	A0A0M4S6Y4	Bacillus_phage	67.4	2.1e-56
AWC53920.1|3183676_3183946_-	hypothetical protein	NA	A0A0M4S680	Bacillus_phage	83.1	5.3e-39
AWC53921.1|3183942_3184782_-	hypothetical protein	NA	Q38143	Bacillus_phage	45.1	3.1e-53
AWC53922.1|3184993_3185881_-	hypothetical protein	NA	S6C475	Thermus_phage	49.1	5.9e-71
AWC53923.1|3185925_3186159_-	hypothetical protein	NA	A0A0M4S677	Bacillus_phage	80.3	4.9e-25
AWC53924.1|3186478_3186673_-	hypothetical protein	NA	NA	NA	NA	NA
AWC53925.1|3186701_3187478_-	hypothetical protein	NA	A0A288WFS9	Bacillus_phage	62.9	2.7e-59
AWC53926.1|3187474_3187663_-	XRE family transcriptional regulator	NA	A0A0M3ULF9	Bacillus_phage	91.4	1.1e-22
AWC53927.1|3187935_3188358_+	XRE family transcriptional regulator	NA	A0A0M4QX29	Bacillus_phage	97.1	2.0e-69
AWC55012.1|3188372_3188798_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M4RD70	Bacillus_phage	92.2	7.5e-72
AWC53928.1|3188811_3190236_+	recombinase family protein	NA	A0A1L2JY12	Aeribacillus_phage	41.0	3.0e-101
>prophage 1
CP024115	Bacillus cytotoxicus strain CH_3 plasmid pCh3_83, complete sequence	83526	59677	66931	83526	integrase	Bacillus_phage(33.33%)	8	53785:53800	69993:70008
53785:53800	attL	AAATGGATTAATGAAA	NA	NA	NA	NA
AWC55155.1|59677_60397_-	DNA (cytosine-5-)-methyltransferase	NA	A0A1I9KKE7	Lactobacillus_phage	52.0	7.4e-64
AWC55156.1|60950_61550_-	hypothetical protein	NA	A0A1Z1LZN4	Bacillus_phage	35.6	5.1e-10
AWC55157.1|61779_61986_-	hypothetical protein	NA	NA	NA	NA	NA
AWC55158.1|63188_63803_+	DNA recombinase	NA	A0A1V0E035	Clostridioides_phage	32.5	7.1e-15
AWC55159.1|63919_64876_+|integrase	integrase	integrase	A0A1B1P793	Bacillus_phage	34.3	1.2e-37
AWC55160.1|65319_65658_+	hypothetical protein	NA	NA	NA	NA	NA
AWC55161.1|65696_65882_+	DNA-binding protein	NA	A6M9A5	Geobacillus_virus	64.9	6.8e-14
AWC55162.1|66358_66931_-	hypothetical protein	NA	A0A0K2SUB9	Clostridium_phage	44.4	3.3e-14
69993:70008	attR	TTTCATTAATCCATTT	NA	NA	NA	NA
