The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024096	Bacillus cytotoxicus strain CH_39 chromosome, complete genome	4252957	157129	210997	4252957	transposase,protease,integrase	Bacillus_phage(26.67%)	55	156922:156970	174090:174138
156922:156970	attL	TGCTTCCATAGCTCAGCTGGTAGAGCACTTCCATGGTAAGGAAGAGGTC	NA	NA	NA	NA
AWC63450.1|157129_158056_+|integrase	integrase	integrase	A0A2I6UG75	Salinibacter_virus	24.5	5.5e-11
AWC67147.1|158361_159087_+	helix-turn-helix domain-containing protein	NA	A0A1I9S595	Bacillus_phage	28.6	2.0e-08
AWC63451.1|159579_159954_-	hypothetical protein	NA	NA	NA	NA	NA
AWC63452.1|161947_162562_+	hypothetical protein	NA	NA	NA	NA	NA
AWC63453.1|162567_162798_+	hypothetical protein	NA	NA	NA	NA	NA
AWC63454.1|162811_163048_+	hypothetical protein	NA	NA	NA	NA	NA
AWC63455.1|163077_163758_+	hypothetical protein	NA	NA	NA	NA	NA
AWC63456.1|163996_164821_+	hypothetical protein	NA	NA	NA	NA	NA
AWC63457.1|164835_165255_+	hypothetical protein	NA	NA	NA	NA	NA
AWC63458.1|165277_165487_+	hypothetical protein	NA	NA	NA	NA	NA
AWC63459.1|165507_165912_+	hypothetical protein	NA	NA	NA	NA	NA
AWC63460.1|166146_166797_+	hypothetical protein	NA	M1HN75	Bacillus_virus	34.6	2.1e-17
AWC63461.1|166904_167327_+	hypothetical protein	NA	A0A2P1JUJ6	Bacillus_phage	58.6	1.0e-33
AWC63462.1|167413_169600_+	hypothetical protein	NA	A0A2P1JUK2	Bacillus_phage	41.2	2.0e-11
AWC63463.1|169737_170022_+	hypothetical protein	NA	NA	NA	NA	NA
AWC63464.1|170038_170347_+	hypothetical protein	NA	NA	NA	NA	NA
AWC63465.1|170497_171349_+	DNA methyltransferase	NA	A0A1S5PRR3	Streptococcus_phage	52.3	6.7e-80
AWC63466.1|171332_172613_+	translation elongation factor	NA	NA	NA	NA	NA
AWC63467.1|172866_173190_+	hypothetical protein	NA	NA	NA	NA	NA
AWC63468.1|173252_173450_+	hypothetical protein	NA	NA	NA	NA	NA
AWC63469.1|173653_173869_+	hypothetical protein	NA	NA	NA	NA	NA
AWC63470.1|174911_176054_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.7	5.1e-51
174090:174138	attR	TGCTTCCATAGCTCAGCTGGTAGAGCACTTCCATGGTAAGGAAGAGGTC	NA	NA	NA	NA
AWC63471.1|176251_177145_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	31.1	7.9e-23
AWC63472.1|177398_178229_+	TIGR00159 family protein	NA	NA	NA	NA	NA
AWC63473.1|178221_179667_+	hypothetical protein	NA	NA	NA	NA	NA
AWC63474.1|179659_181006_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AWC63475.1|181490_183293_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q84421	Paramecium_bursaria_Chlorella_virus	40.3	3.1e-103
AWC63476.1|183523_184195_-	hypothetical protein	NA	A0A146ICT8	Staphylococcus_phage	55.6	1.1e-16
AWC63477.1|184620_185373_-|transposase	transposase	transposase	A0A059NT77	Lactococcus_phage	46.9	2.7e-56
AWC63478.1|185362_186658_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	27.1	8.5e-10
AWC63479.1|187529_188399_+	hypothetical protein	NA	A0A1X9I6E0	Streptococcus_phage	26.1	1.6e-07
AWC63480.1|188839_190033_+	radical SAM protein	NA	NA	NA	NA	NA
AWC63481.1|190025_191951_+	hypothetical protein	NA	NA	NA	NA	NA
AWC63482.1|191943_192534_+	radical SAM protein	NA	NA	NA	NA	NA
AWC63483.1|192520_193330_+	hypothetical protein	NA	NA	NA	NA	NA
AWC63484.1|194836_195541_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWC63485.1|196057_196801_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWC63486.1|197424_197664_-	hypothetical protein	NA	NA	NA	NA	NA
AWC63487.1|197710_197863_+	hypothetical protein	NA	NA	NA	NA	NA
AWC63488.1|198166_198823_+	hypothetical protein	NA	NA	NA	NA	NA
AWC67148.1|199056_199470_+	DUF1648 domain-containing protein	NA	NA	NA	NA	NA
AWC63489.1|200463_201630_+	MFS transporter	NA	NA	NA	NA	NA
AWC63490.1|201635_202097_+	hypothetical protein	NA	NA	NA	NA	NA
AWC63491.1|202099_202912_+	hypothetical protein	NA	NA	NA	NA	NA
AWC63492.1|202945_203227_+	hypothetical protein	NA	NA	NA	NA	NA
AWC63493.1|203231_204224_+	hypothetical protein	NA	NA	NA	NA	NA
AWC63494.1|204228_204483_+	hypothetical protein	NA	NA	NA	NA	NA
AWC63495.1|204479_205643_+	hypothetical protein	NA	NA	NA	NA	NA
AWC63496.1|205661_206897_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
AWC63497.1|206914_207646_+	adenylyltransferase	NA	S4VW33	Pandoravirus	31.3	4.1e-09
AWC63498.1|207786_208152_+	hypothetical protein	NA	NA	NA	NA	NA
AWC63499.1|208161_208365_+	hypothetical protein	NA	NA	NA	NA	NA
AWC63500.1|208306_208474_-	hypothetical protein	NA	NA	NA	NA	NA
AWC67149.1|209066_209489_+	hypothetical protein	NA	NA	NA	NA	NA
AWC63501.1|209845_210997_+|transposase	transposase	transposase	S6AND0	Bacillus_phage	80.4	9.1e-173
>prophage 2
CP024096	Bacillus cytotoxicus strain CH_39 chromosome, complete genome	4252957	287355	295333	4252957		uncultured_virus(33.33%)	6	NA	NA
AWC63569.1|287355_287640_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	52.7	5.8e-20
AWC63570.1|287674_289303_+	molecular chaperone GroEL	NA	A0A219YK78	uncultured_virus	56.9	1.5e-157
AWC63571.1|289729_291277_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	30.6	2.2e-20
AWC63572.1|291650_292976_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	31.8	4.4e-46
AWC63573.1|293118_293820_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.7	8.6e-41
AWC67152.1|293845_295333_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.2	1.3e-33
>prophage 3
CP024096	Bacillus cytotoxicus strain CH_39 chromosome, complete genome	4252957	328313	336685	4252957		Synechococcus_phage(33.33%)	8	NA	NA
AWC63584.1|328313_329615_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	31.6	2.0e-19
AWC63585.1|329709_330429_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	43.9	9.8e-48
AWC63586.1|330421_330676_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AWC63587.1|330672_331356_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AWC63588.1|331339_333559_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.2	2.0e-160
AWC63589.1|333543_334959_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.2	3.6e-54
AWC63590.1|335061_336105_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	48.0	2.7e-70
AWC63591.1|336097_336685_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.2	1.6e-24
>prophage 4
CP024096	Bacillus cytotoxicus strain CH_39 chromosome, complete genome	4252957	758214	796403	4252957	coat,transposase	Thermus_phage(20.0%)	39	NA	NA
AWC63935.1|758214_759345_+|transposase	transposase	transposase	S6C485	Thermus_phage	32.1	1.2e-12
AWC63936.1|759348_761439_+|transposase	transposase	transposase	NA	NA	NA	NA
AWC63937.1|761440_761821_+|transposase	transposase	transposase	NA	NA	NA	NA
AWC63938.1|761899_762373_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
AWC63939.1|762608_763307_-	recombinase	NA	M9Q1K0	Clostridium_phage	25.4	2.9e-12
AWC63940.1|763548_763956_+	transcriptional repressor	NA	NA	NA	NA	NA
AWC63941.1|763970_764942_+	ornithine cyclodeaminase	NA	NA	NA	NA	NA
AWC63942.1|764956_766069_-	hypothetical protein	NA	NA	NA	NA	NA
AWC63943.1|766153_766525_+	hypothetical protein	NA	NA	NA	NA	NA
AWC63944.1|767078_767735_-	hypothetical protein	NA	NA	NA	NA	NA
AWC63945.1|768060_768459_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWC63946.1|768609_769464_+	patatin family protein	NA	NA	NA	NA	NA
AWC63947.1|769599_770901_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	34.1	4.5e-51
AWC63948.1|771188_772055_+	NAD(P)-dependent oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	43.3	6.6e-59
AWC63949.1|772227_772989_+	L,D-transpeptidase	NA	NA	NA	NA	NA
AWC63950.1|773081_773354_+	hypothetical protein	NA	NA	NA	NA	NA
AWC63951.1|773404_773620_-	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
AWC63952.1|773691_774102_-	thioredoxin	NA	NA	NA	NA	NA
AWC63953.1|774114_774534_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
AWC63954.1|774664_775540_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
AWC63955.1|775727_775976_-	hypothetical protein	NA	NA	NA	NA	NA
AWC63956.1|776076_776574_-	hypothetical protein	NA	NA	NA	NA	NA
AWC63957.1|776628_777729_-	spore gernimation protein GerB	NA	NA	NA	NA	NA
AWC63958.1|777741_778824_-	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
AWC63959.1|778820_780332_-	spore germination protein	NA	NA	NA	NA	NA
AWC63960.1|780607_781168_+	nitroreductase	NA	NA	NA	NA	NA
AWC63961.1|781852_783265_+	stage V sporulation protein R	NA	NA	NA	NA	NA
AWC63962.1|783464_783905_-	hypothetical protein	NA	NA	NA	NA	NA
AWC63963.1|784060_785227_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
AWC63964.1|785574_787230_-	sodium:phosphate symporter	NA	NA	NA	NA	NA
AWC63965.1|787572_788775_-	MFS transporter	NA	NA	NA	NA	NA
AWC63966.1|789095_790184_+	DUF871 domain-containing protein	NA	NA	NA	NA	NA
AWC63967.1|790224_791406_-	ABC transporter permease	NA	NA	NA	NA	NA
AWC63968.1|791408_792083_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.5	6.1e-36
AWC63969.1|792079_793183_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AWC63970.1|793802_795119_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
AWC63971.1|795333_795903_-|coat	spore coat protein CotJC	coat	NA	NA	NA	NA
AWC63972.1|795915_796179_-|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
AWC63973.1|796187_796403_-|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
>prophage 5
CP024096	Bacillus cytotoxicus strain CH_39 chromosome, complete genome	4252957	1109696	1177149	4252957	coat,integrase,bacteriocin	Bacillus_phage(36.36%)	60	1170583:1170600	1178019:1178036
AWC64238.1|1109696_1110434_+|coat	spore coat protein	coat	I7I009	Enterobacteria_phage	44.7	2.8e-50
AWC64239.1|1110442_1110991_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A218MN57	uncultured_virus	43.2	1.7e-31
AWC64240.1|1111002_1111974_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	42.9	8.5e-71
AWC64241.1|1111985_1112837_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	40.2	9.5e-42
AWC64242.1|1113040_1113541_-	hypothetical protein	NA	NA	NA	NA	NA
AWC64243.1|1113976_1114450_-|coat	spore coat protein	coat	NA	NA	NA	NA
AWC64244.1|1114616_1116671_-	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	31.9	6.2e-79
AWC64245.1|1117196_1117715_-	hypothetical protein	NA	NA	NA	NA	NA
AWC64246.1|1117807_1118539_-	esterase family protein	NA	NA	NA	NA	NA
AWC64247.1|1118759_1119671_+	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AWC64248.1|1119891_1120281_-	hypothetical protein	NA	A0A0E3TB73	Enterococcus_phage	36.6	8.2e-09
AWC64249.1|1120452_1121919_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
AWC64250.1|1123751_1125245_+	lactate permease	NA	NA	NA	NA	NA
AWC64251.1|1125349_1126033_+	DUF2278 domain-containing protein	NA	NA	NA	NA	NA
AWC64252.1|1126079_1126913_-	hypothetical protein	NA	NA	NA	NA	NA
AWC64253.1|1127041_1127788_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
AWC64254.1|1127962_1129297_+	CoA-disulfide reductase	NA	NA	NA	NA	NA
AWC64255.1|1129425_1129836_+	DUF3908 domain-containing protein	NA	NA	NA	NA	NA
AWC64256.1|1130049_1131594_-	NADH oxidase	NA	NA	NA	NA	NA
AWC64257.1|1131654_1133607_-|bacteriocin	bacteriocin biosynthesis protein SagD	bacteriocin	NA	NA	NA	NA
AWC64258.1|1133600_1135526_-|bacteriocin	putative thiazole-containing bacteriocin maturation protein	bacteriocin	NA	NA	NA	NA
AWC64259.1|1135684_1136929_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
AWC64260.1|1137049_1139926_-	2-oxoglutarate dehydrogenase subunit E1	NA	NA	NA	NA	NA
AWC64261.1|1140894_1141077_+	DUF3976 domain-containing protein	NA	NA	NA	NA	NA
AWC64262.1|1141138_1142023_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWC64263.1|1142209_1143136_+	2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase	NA	NA	NA	NA	NA
AWC64264.1|1143205_1144729_+	5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AWC64265.1|1144782_1146255_+	4-hydroxyphenylacetate 3-monooxygenase, oxygenase component	NA	NA	NA	NA	NA
AWC64266.1|1146274_1147258_+	3,4-dihydroxyphenylacetate 2,3-dioxygenase	NA	NA	NA	NA	NA
AWC64267.1|1147315_1148182_+	cytidyltransferase	NA	NA	NA	NA	NA
AWC64268.1|1148242_1148572_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
AWC64269.1|1148561_1150112_+	cation acetate symporter	NA	NA	NA	NA	NA
AWC64270.1|1150132_1150924_+	4-hydroxyphenylacetate isomerase	NA	NA	NA	NA	NA
AWC64271.1|1150920_1151679_+	2-hydroxyhepta-2,4-diene-1,7-dioate isomerase	NA	NA	NA	NA	NA
AWC64272.1|1151751_1152150_+	5-carboxymethyl-2-hydroxymuconate isomerase	NA	NA	NA	NA	NA
AWC64273.1|1152468_1153581_+	tetratricopeptide repeat-containing protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	49.1	2.4e-93
AWC64274.1|1154231_1154600_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AWC64275.1|1155424_1155631_+	hypothetical protein	NA	NA	NA	NA	NA
AWC64276.1|1156281_1156599_+	DUF3884 domain-containing protein	NA	NA	NA	NA	NA
AWC67176.1|1158157_1158634_+	hypothetical protein	NA	NA	NA	NA	NA
AWC64277.1|1158656_1159064_+	hypothetical protein	NA	NA	NA	NA	NA
AWC64278.1|1160471_1160747_-	hypothetical protein	NA	NA	NA	NA	NA
AWC64279.1|1161744_1162665_-	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AWC64280.1|1162864_1163092_-	hypothetical protein	NA	NA	NA	NA	NA
AWC64281.1|1163141_1163402_-	hypothetical protein	NA	NA	NA	NA	NA
AWC64282.1|1163537_1163792_+	hypothetical protein	NA	NA	NA	NA	NA
AWC64283.1|1164298_1164952_+	hypothetical protein	NA	NA	NA	NA	NA
AWC64284.1|1165149_1165425_+	hypothetical protein	NA	NA	NA	NA	NA
AWC64285.1|1165742_1166837_-	tetratricopeptide repeat-containing protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	51.8	1.2e-100
AWC64286.1|1167099_1167471_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	54.4	2.1e-25
AWC64287.1|1167988_1168693_-	hypothetical protein	NA	NA	NA	NA	NA
AWC64288.1|1169077_1169251_-	hypothetical protein	NA	NA	NA	NA	NA
AWC64289.1|1169257_1169557_-	hypothetical protein	NA	NA	NA	NA	NA
AWC64290.1|1169602_1169836_-	TIGR04197 family type VII secretion effector	NA	NA	NA	NA	NA
1170583:1170600	attL	GTGACCAATATGTGACCA	NA	NA	NA	NA
AWC64291.1|1170611_1172318_-	hypothetical protein	NA	NA	NA	NA	NA
AWC64292.1|1172386_1173508_-	DUF4297 domain-containing protein	NA	NA	NA	NA	NA
AWC64293.1|1173630_1174332_-	hypothetical protein	NA	NA	NA	NA	NA
AWC64294.1|1174750_1175827_+	replication initiation factor	NA	NA	NA	NA	NA
AWC64295.1|1175841_1176039_+	DNA-binding protein	NA	A0A1B0T6C2	Bacillus_phage	41.2	4.3e-06
AWC64296.1|1176039_1177149_+|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	40.9	2.6e-60
1178019:1178036	attR	GTGACCAATATGTGACCA	NA	NA	NA	NA
>prophage 6
CP024096	Bacillus cytotoxicus strain CH_39 chromosome, complete genome	4252957	2353185	2421160	4252957	tail,holin,integrase,transposase,bacteriocin	Bacillus_phage(38.89%)	55	2348351:2348367	2382160:2382176
2348351:2348367	attL	TCCTTCTGCATCTAATA	NA	NA	NA	NA
AWC65347.1|2353185_2354333_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	66.4	1.8e-99
AWC65348.1|2354609_2356778_-|bacteriocin	bacteriocin-associated protein	bacteriocin	NA	NA	NA	NA
AWC65349.1|2356901_2357090_-	hypothetical protein	NA	NA	NA	NA	NA
AWC65350.1|2357074_2357344_-	hypothetical protein	NA	NA	NA	NA	NA
AWC65351.1|2358066_2358420_+|integrase	integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	34.1	6.5e-05
AWC65352.1|2358440_2358689_-	DUF4176 domain-containing protein	NA	NA	NA	NA	NA
AWC65353.1|2358689_2358878_-	hypothetical protein	NA	NA	NA	NA	NA
AWC65354.1|2358908_2359100_-	hypothetical protein	NA	NA	NA	NA	NA
AWC65355.1|2360387_2360750_-	DUF3958 domain-containing protein	NA	NA	NA	NA	NA
AWC65356.1|2360790_2361066_-	TIGR04197 family type VII secretion effector	NA	NA	NA	NA	NA
AWC65357.1|2361770_2364341_-	permease	NA	NA	NA	NA	NA
AWC65358.1|2364358_2365105_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	5.0e-31
AWC65359.1|2365470_2365794_-	hypothetical protein	NA	NA	NA	NA	NA
AWC65360.1|2365801_2366326_-	hypothetical protein	NA	NA	NA	NA	NA
AWC65361.1|2368459_2368843_-	hypothetical protein	NA	NA	NA	NA	NA
AWC65362.1|2369131_2369857_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	37.8	1.3e-36
AWC65363.1|2370421_2370610_-	transcriptional regulator	NA	S5M643	Brevibacillus_phage	42.4	3.7e-07
AWC65364.1|2370599_2370923_-	hypothetical protein	NA	NA	NA	NA	NA
AWC65365.1|2372179_2373160_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
AWC65366.1|2373222_2373471_-	hypothetical protein	NA	A0A288WFY7	Bacillus_phage	46.2	3.9e-12
AWC65367.1|2373743_2374793_-	oxidoreductase	NA	NA	NA	NA	NA
AWC65368.1|2375275_2375674_+	DUF2871 domain-containing protein	NA	NA	NA	NA	NA
AWC65369.1|2376572_2376833_-	DUF2642 domain-containing protein	NA	NA	NA	NA	NA
AWC65370.1|2376972_2377635_-	bacillithiol biosynthesis deacetylase BshB2	NA	NA	NA	NA	NA
AWC65371.1|2377650_2378001_-	DUF1806 domain-containing protein	NA	NA	NA	NA	NA
AWC65372.1|2378242_2379568_+	hypothetical protein	NA	NA	NA	NA	NA
AWC65373.1|2379907_2380435_-	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	66.3	4.8e-60
AWC65374.1|2382894_2383686_+	arylamine N-acetyltransferase	NA	NA	NA	NA	NA
2382160:2382176	attR	TCCTTCTGCATCTAATA	NA	NA	NA	NA
AWC65375.1|2383814_2385602_+	oligoendopeptidase F	NA	NA	NA	NA	NA
AWC65376.1|2385787_2387020_-	MFS transporter	NA	NA	NA	NA	NA
AWC65377.1|2387123_2387987_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWC65378.1|2388154_2389213_+	acyltransferase	NA	NA	NA	NA	NA
AWC65379.1|2389257_2390202_-	glycerophosphodiester phosphodiesterase	NA	A0A076G4Q2	Staphylococcus_phage	35.0	2.4e-38
AWC65380.1|2390680_2391223_-	N-acetyltransferase	NA	NA	NA	NA	NA
AWC65381.1|2391473_2391887_-	hypothetical protein	NA	NA	NA	NA	NA
AWC65382.1|2392429_2393278_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	47.9	1.4e-08
AWC65383.1|2393696_2394335_-	hypothetical protein	NA	NA	NA	NA	NA
AWC65384.1|2394361_2395174_-	hypothetical protein	NA	NA	NA	NA	NA
AWC65385.1|2395655_2397035_+	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	35.7	1.4e-21
AWC65386.1|2397188_2398859_-	peptidase M4 family protein	NA	NA	NA	NA	NA
AWC65387.1|2399508_2400984_+	SELO family protein	NA	A0A075BSJ0	Microcystis_phage	30.7	3.4e-47
AWC65388.1|2401099_2402485_-	2-hydroxy-acid oxidase	NA	NA	NA	NA	NA
AWC65389.1|2402909_2403587_-	methyltransferase	NA	G3MA03	Bacillus_virus	43.3	8.1e-20
AWC65390.1|2404402_2405314_-	hypothetical protein	NA	NA	NA	NA	NA
AWC65391.1|2405719_2406067_+	hypothetical protein	NA	NA	NA	NA	NA
AWC65392.1|2406208_2407285_+	hypothetical protein	NA	NA	NA	NA	NA
AWC65393.1|2408555_2408888_-	hypothetical protein	NA	NA	NA	NA	NA
AWC65394.1|2409057_2409270_+	XRE family transcriptional regulator	NA	A0A076G7N2	Bacillus_phage	51.5	9.0e-10
AWC65395.1|2409369_2409954_+	hypothetical protein	NA	NA	NA	NA	NA
AWC65396.1|2409994_2410819_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4J966	uncultured_Caudovirales_phage	51.1	7.2e-79
AWC65397.1|2410834_2411065_-|holin	phage holin	holin	A0A0S2MVE8	Bacillus_phage	73.3	4.1e-24
AWC65398.1|2411079_2411364_-	hypothetical protein	NA	NA	NA	NA	NA
AWC65399.1|2411403_2415900_-	hypothetical protein	NA	A0A0M4RER0	Bacillus_phage	45.3	2.8e-262
AWC65400.1|2415899_2417402_-|tail	phage tail protein	tail	A0A1B1P7W7	Bacillus_phage	73.9	5.0e-203
AWC65401.1|2417416_2421160_-|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	38.8	8.1e-53
>prophage 7
CP024096	Bacillus cytotoxicus strain CH_39 chromosome, complete genome	4252957	2429502	2442613	4252957		Bacillus_phage(41.67%)	17	NA	NA
AWC65415.1|2429502_2431206_-	hypothetical protein	NA	A0A142F1L6	Bacillus_phage	50.5	2.9e-159
AWC65416.1|2431205_2431679_-	hypothetical protein	NA	NA	NA	NA	NA
AWC65417.1|2432747_2433572_-	hypothetical protein	NA	NA	NA	NA	NA
AWC65418.1|2433967_2434534_-	hypothetical protein	NA	A0A2H4J2L4	uncultured_Caudovirales_phage	45.8	9.7e-35
AWC65419.1|2434545_2434923_-	hypothetical protein	NA	A0A0N9RZI0	Paenibacillus_phage	43.1	2.0e-15
AWC65420.1|2435307_2435946_-	hypothetical protein	NA	NA	NA	NA	NA
AWC65421.1|2435957_2436191_-	glutaredoxin family protein	NA	A0A1B1P8E0	Bacillus_phage	64.5	1.2e-23
AWC65422.1|2436187_2436793_-	hypothetical protein	NA	A0A2H4JAZ2	uncultured_Caudovirales_phage	41.2	7.7e-38
AWC65423.1|2436853_2437480_-	hypothetical protein	NA	J9Q953	Bacillus_phage	43.2	1.4e-34
AWC65424.1|2437481_2438114_-	hypothetical protein	NA	NA	NA	NA	NA
AWC65425.1|2438256_2438565_-	transglycosylase	NA	A0A0K2CZP5	Paenibacillus_phage	36.9	2.6e-05
AWC65426.1|2438564_2438960_-	alpha/beta hydrolase	NA	A0A2H4IZM2	uncultured_Caudovirales_phage	68.9	6.1e-44
AWC65427.1|2439245_2439773_-	hypothetical protein	NA	A0A0N9ST03	Paenibacillus_phage	44.6	3.2e-08
AWC65428.1|2439769_2439994_-	hypothetical protein	NA	U5Q038	Bacillus_phage	70.6	8.3e-22
AWC65429.1|2439993_2441040_-	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	58.6	4.8e-88
AWC65430.1|2441053_2441209_-	hypothetical protein	NA	NA	NA	NA	NA
AWC65431.1|2442109_2442613_-	hypothetical protein	NA	A0A0A0RUN2	Bacillus_phage	47.3	3.8e-30
>prophage 8
CP024096	Bacillus cytotoxicus strain CH_39 chromosome, complete genome	4252957	2448221	2459018	4252957		uncultured_Caudovirales_phage(37.5%)	18	NA	NA
AWC65436.1|2448221_2449445_-	hypothetical protein	NA	A0A288WGM1	Bacillus_phage	47.8	9.9e-101
AWC65437.1|2449559_2449763_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWC67230.1|2449826_2450012_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWC65438.1|2450019_2451036_-	hypothetical protein	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	43.2	6.8e-71
AWC65439.1|2451062_2452406_-	DNA helicase	NA	A0A2H4IZL9	uncultured_Caudovirales_phage	55.8	7.5e-134
AWC65440.1|2452502_2452787_-	hypothetical protein	NA	A0A0H3V0M3	Geobacillus_virus	44.0	5.4e-10
AWC65441.1|2453034_2453451_-	hypothetical protein	NA	A0A0K2CNU6	Brevibacillus_phage	57.1	8.5e-12
AWC65442.1|2453471_2453723_-	hypothetical protein	NA	NA	NA	NA	NA
AWC65443.1|2453769_2454021_-	hypothetical protein	NA	NA	NA	NA	NA
AWC65444.1|2454067_2454256_-	hypothetical protein	NA	NA	NA	NA	NA
AWC65445.1|2454619_2455384_-	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	56.5	3.7e-77
AWC65446.1|2455383_2456058_-	DUF723 domain-containing protein	NA	NA	NA	NA	NA
AWC67231.1|2456073_2456460_-	hypothetical protein	NA	A0A2H4J134	uncultured_Caudovirales_phage	36.2	5.5e-13
AWC65447.1|2456465_2456798_-	hypothetical protein	NA	NA	NA	NA	NA
AWC65448.1|2456784_2456943_-	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
AWC65449.1|2457024_2457369_-	hypothetical protein	NA	NA	NA	NA	NA
AWC65450.1|2457498_2458113_-	hypothetical protein	NA	NA	NA	NA	NA
AWC65451.1|2458124_2459018_-	hypothetical protein	NA	A0A0N9RZE9	Paenibacillus_phage	30.9	5.5e-16
>prophage 9
CP024096	Bacillus cytotoxicus strain CH_39 chromosome, complete genome	4252957	2620709	2636190	4252957	integrase	Bacillus_phage(72.73%)	29	2632424:2632438	2638948:2638962
AWC65593.1|2620709_2620919_-	DNA-binding protein	NA	A0A1Z1LZP5	Bacillus_phage	62.1	1.4e-15
AWC65594.1|2621166_2621382_-	hypothetical protein	NA	NA	NA	NA	NA
AWC65595.1|2621712_2622180_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	51.8	3.5e-30
AWC67236.1|2622917_2623193_-	DNA-binding protein	NA	A0A2H4JBQ8	uncultured_Caudovirales_phage	43.2	2.0e-09
AWC65596.1|2623161_2623359_-	hypothetical protein	NA	NA	NA	NA	NA
AWC65597.1|2623432_2623624_-	hypothetical protein	NA	NA	NA	NA	NA
AWC65598.1|2623722_2624103_-	ArpU family transcriptional regulator	NA	A0A0M4R397	Bacillus_phage	84.7	4.1e-53
AWC65599.1|2624107_2624395_-	hypothetical protein	NA	A6M999	Geobacillus_virus	70.2	4.2e-34
AWC65600.1|2624424_2624625_-	hypothetical protein	NA	NA	NA	NA	NA
AWC65601.1|2624656_2624863_-	hypothetical protein	NA	NA	NA	NA	NA
AWC65602.1|2624904_2625147_-	hypothetical protein	NA	A0A0S2MV78	Bacillus_phage	73.8	9.9e-29
AWC65603.1|2625176_2625404_-	hypothetical protein	NA	A0A288WFX6	Bacillus_phage	98.7	3.5e-36
AWC65604.1|2625444_2626083_-	hypothetical protein	NA	A0A0K2CP60	Brevibacillus_phage	49.0	1.5e-52
AWC65605.1|2626114_2626318_-	hypothetical protein	NA	NA	NA	NA	NA
AWC65606.1|2626731_2627520_-	hypothetical protein	NA	A0A0M4RU33	Bacillus_phage	39.7	1.5e-28
AWC65607.1|2627512_2627701_-	hypothetical protein	NA	A0A0M4RD83	Bacillus_phage	56.7	3.6e-10
AWC65608.1|2627685_2627901_-	hypothetical protein	NA	NA	NA	NA	NA
AWC65609.1|2627911_2628784_-	DNA replication protein	NA	A0A0M4RD64	Bacillus_phage	72.0	5.6e-114
AWC65610.1|2628713_2629502_-	phage replication protein	NA	A0A0M4S6Y4	Bacillus_phage	76.8	9.6e-89
AWC65611.1|2629502_2629772_-	hypothetical protein	NA	A0A0M4S680	Bacillus_phage	83.1	5.3e-39
AWC65612.1|2629752_2630607_-	hypothetical protein	NA	Q38143	Bacillus_phage	44.6	5.4e-53
AWC65613.1|2631757_2631997_-	hypothetical protein	NA	A0A0M4S677	Bacillus_phage	77.9	2.3e-22
AWC65614.1|2632323_2632506_-	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	43.5	4.4e-05
2632424:2632438	attL	ATTTCTTTCACTTCT	NA	NA	NA	NA
AWC65615.1|2632540_2632816_-	group-specific protein	NA	S5MC08	Brevibacillus_phage	59.3	3.6e-27
AWC65616.1|2632842_2633679_-	hypothetical protein	NA	A0A0M5M1L9	Bacillus_phage	84.9	2.6e-129
AWC65617.1|2633675_2633864_-	XRE family transcriptional regulator	NA	A0A1C8E998	Bacillus_phage	83.6	2.0e-21
AWC65618.1|2634136_2634556_+	XRE family transcriptional regulator	NA	A0A1C8E9A4	Bacillus_phage	89.2	1.1e-64
AWC65619.1|2634570_2634996_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1C8E988	Bacillus_phage	92.9	1.2e-72
AWC65620.1|2635032_2636190_+|integrase	site-specific integrase	integrase	A0A0S2SXP1	Bacillus_phage	76.1	1.2e-76
2638948:2638962	attR	ATTTCTTTCACTTCT	NA	NA	NA	NA
>prophage 10
CP024096	Bacillus cytotoxicus strain CH_39 chromosome, complete genome	4252957	2818472	2892440	4252957	tail,capsid,holin,portal,protease,head,integrase,tRNA,terminase	Bacillus_phage(77.78%)	85	2850015:2850032	2899161:2899178
AWC65777.1|2818472_2821238_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L9X8	Tupanvirus	27.3	2.8e-87
AWC65778.1|2821582_2822089_-	septum formation initiator	NA	NA	NA	NA	NA
AWC65779.1|2822181_2822955_-	RNA-binding protein	NA	NA	NA	NA	NA
AWC65780.1|2822969_2823233_-	YggT family protein	NA	NA	NA	NA	NA
AWC65781.1|2823239_2823710_-	cell division protein SepF	NA	NA	NA	NA	NA
AWC65782.1|2823728_2824403_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AWC65783.1|2824409_2825219_-	laccase domain-containing protein	NA	NA	NA	NA	NA
AWC65784.1|2825336_2825615_-	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
AWC65785.1|2825878_2826658_-	RNA polymerase sporulation sigma factor SigG	NA	A0A0Y0AU18	Bacillus_phage	43.4	3.4e-46
AWC65786.1|2826849_2827569_-	RNA polymerase sporulation sigma factor SigE	NA	A0A2H4JC68	uncultured_Caudovirales_phage	42.9	2.5e-19
AWC65787.1|2827588_2828515_-	sigma-E processing peptidase SpoIIGA	NA	NA	NA	NA	NA
AWC65788.1|2828730_2829885_-	cell division protein FtsZ	NA	NA	NA	NA	NA
AWC65789.1|2829924_2831229_-	cell division protein FtsA	NA	NA	NA	NA	NA
AWC65790.1|2831629_2832397_-	cell division protein DivIB	NA	NA	NA	NA	NA
AWC67243.1|2832494_2833400_-	UDP-N-acetylenolpyruvoylglucosamine reductase	NA	NA	NA	NA	NA
AWC65791.1|2833460_2834555_-	undecaprenyldiphospho-muramoylpentapeptide beta-N- acetylglucosaminyltransferase	NA	NA	NA	NA	NA
AWC67244.1|2834739_2835831_-	stage V sporulation protein E	NA	NA	NA	NA	NA
AWC65792.1|2835922_2837278_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
AWC65793.1|2837278_2838253_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
AWC65794.1|2838275_2839751_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
AWC65795.1|2840023_2841940_-	stage V sporulation protein D	NA	NA	NA	NA	NA
AWC67245.1|2842037_2844188_-	dihydropteridine reductase	NA	NA	NA	NA	NA
AWC65796.1|2844210_2844567_-	cell division protein FtsL	NA	NA	NA	NA	NA
AWC65797.1|2844582_2845515_-	ribosomal RNA small subunit methyltransferase H	NA	NA	NA	NA	NA
AWC67246.1|2845878_2847495_-	bacillithiol biosynthesis cysteine-adding enzyme BshC	NA	NA	NA	NA	NA
AWC67247.1|2847574_2848459_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AWC65798.1|2848760_2849234_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWC65799.1|2849329_2849851_-	RsfA family transcriptional regulator	NA	G3MB11	Bacillus_virus	47.8	4.0e-11
2850015:2850032	attL	GCTGCCCTAAAATAGCGG	NA	NA	NA	NA
AWC65800.1|2850110_2850284_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
AWC65801.1|2850345_2850846_-	hypothetical protein	NA	NA	NA	NA	NA
AWC65802.1|2851127_2851748_-	hypothetical protein	NA	Q2LIA9	Bacillus_phage	76.8	1.0e-85
AWC65803.1|2851689_2852871_-	cell division protein FtsK	NA	Q3HKZ7	Bacillus_phage	84.5	3.0e-195
AWC65804.1|2852988_2853171_-	hypothetical protein	NA	Q2I8E2	Bacillus_phage	88.3	2.2e-20
AWC65805.1|2853167_2853476_-	hypothetical protein	NA	A0A288WG08	Bacillus_phage	78.4	3.8e-41
AWC65806.1|2853659_2853869_+	XRE family transcriptional regulator	NA	Q2I8E4	Bacillus_phage	79.4	2.7e-22
AWC65807.1|2853871_2854360_+	hypothetical protein	NA	Q3HL01	Bacillus_phage	61.7	8.1e-46
AWC65808.1|2854395_2855460_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7AQV3	Bacillus_phage	85.9	2.3e-178
AWC65809.1|2855456_2855696_-|holin	holin	holin	A0A2H4J378	uncultured_Caudovirales_phage	87.3	1.2e-29
AWC65810.1|2855695_2855932_-	hypothetical protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	78.2	1.2e-07
AWC65811.1|2855973_2860005_-	peptidase S74	NA	H0USX5	Bacillus_phage	44.9	1.7e-242
AWC65812.1|2860001_2861495_-|tail	phage tail protein	tail	A0A2H4JC38	uncultured_Caudovirales_phage	83.7	1.2e-254
AWC65813.1|2861503_2865544_-|tail	phage tail tape measure protein	tail	H0USX3	Bacillus_phage	75.1	0.0e+00
AWC65814.1|2865760_2866075_-	hypothetical protein	NA	A0A288WFU6	Bacillus_phage	70.2	1.8e-35
AWC65815.1|2866123_2866735_-|tail	phage tail protein	tail	A0A2H4J8F3	uncultured_Caudovirales_phage	94.5	8.4e-101
AWC65816.1|2866735_2867095_-	DUF3168 domain-containing protein	NA	A0A0S2GLE3	Bacillus_phage	90.8	1.4e-55
AWC65817.1|2867091_2867526_-	hypothetical protein	NA	A0A288WGB7	Bacillus_phage	84.9	8.2e-66
AWC65818.1|2867518_2867842_-|head,tail	head-tail adaptor protein	head,tail	A0A288WG18	Bacillus_phage	85.0	8.0e-50
AWC65819.1|2867838_2868129_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A288WGQ6	Bacillus_phage	88.5	3.6e-41
AWC65820.1|2868146_2869322_-|capsid	phage major capsid protein	capsid	A0A288WG01	Bacillus_phage	88.0	2.5e-186
AWC67248.1|2869363_2869936_-|head,protease	HK97 family phage prohead protease	head,protease	Q2I8F8	Bacillus_phage	91.1	1.3e-95
AWC65821.1|2869925_2871236_-|portal	phage portal protein	portal	Q2LIC9	Bacillus_phage	89.2	6.4e-215
AWC65822.1|2871251_2872949_-|terminase	terminase large subunit	terminase	A0A288WFW5	Bacillus_phage	91.7	0.0e+00
AWC65823.1|2872945_2873428_-|terminase	phage terminase small subunit P27 family	terminase	Q2I8G1	Bacillus_phage	92.5	1.4e-74
AWC65824.1|2873527_2873911_-	HNH endonuclease	NA	Q2I8B2	Bacillus_phage	90.6	2.2e-62
AWC65825.1|2873976_2874216_-	hypothetical protein	NA	NA	NA	NA	NA
AWC65826.1|2874882_2875137_-	hypothetical protein	NA	A0A288WG25	Bacillus_phage	73.8	2.5e-30
AWC65827.1|2875156_2875348_-	hypothetical protein	NA	A0A288WFV5	Bacillus_phage	88.9	1.7e-23
AWC65828.1|2875353_2875572_-	hypothetical protein	NA	D2XR60	Bacillus_phage	73.6	3.3e-23
AWC65829.1|2875866_2876244_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	39.7	1.0e-16
AWC67249.1|2876301_2876622_-	hypothetical protein	NA	NA	NA	NA	NA
AWC67250.1|2876662_2876890_-	hypothetical protein	NA	A0A288WFX6	Bacillus_phage	68.0	2.2e-22
AWC65830.1|2876935_2877481_-	hypothetical protein	NA	A0A1I9S5V4	Bacillus_phage	78.0	3.5e-66
AWC65831.1|2877541_2877805_-	hypothetical protein	NA	NA	NA	NA	NA
AWC65832.1|2878565_2878964_-	hypothetical protein	NA	NA	NA	NA	NA
AWC65833.1|2878972_2879863_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
AWC65834.1|2879933_2880644_-	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
AWC65835.1|2880663_2881077_-	DUF1064 domain-containing protein	NA	A0A2P1JTY5	Anoxybacillus_phage	58.5	1.2e-34
AWC65836.1|2881069_2881564_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	A0A1B1P8C0	Bacillus_phage	70.6	3.2e-58
AWC65837.1|2881780_2882233_-	MFS transporter	NA	A0A0A7AQW3	Bacillus_phage	43.4	3.3e-33
AWC65838.1|2882247_2882730_-	hypothetical protein	NA	NA	NA	NA	NA
AWC65839.1|2882710_2882905_-	hypothetical protein	NA	NA	NA	NA	NA
AWC67251.1|2882910_2883603_-	DNA replication protein	NA	A0A0S2GLK2	Bacillus_phage	50.6	7.9e-63
AWC65840.1|2883673_2884639_-	DnaD domain protein	NA	H0USU2	Bacillus_phage	51.9	9.7e-43
AWC65841.1|2884813_2885620_-	recombinase RecT	NA	S6AVW6	Thermus_phage	66.9	3.4e-97
AWC65842.1|2885619_2885859_-	hypothetical protein	NA	NA	NA	NA	NA
AWC65843.1|2885873_2886809_-	hypothetical protein	NA	S6C475	Thermus_phage	59.5	1.9e-99
AWC65844.1|2886890_2887106_-	hypothetical protein	NA	NA	NA	NA	NA
AWC67252.1|2887281_2887575_-	hypothetical protein	NA	A0A0S2GLB6	Bacillus_phage	62.4	1.7e-27
AWC65845.1|2887582_2887903_-	hypothetical protein	NA	NA	NA	NA	NA
AWC65846.1|2888050_2888260_-	DNA-binding protein	NA	A0A0U4IIS1	Bacillus_phage	50.9	4.4e-09
AWC67253.1|2888382_2888592_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWC65847.1|2888757_2889096_+	XRE family transcriptional regulator	NA	H0UST7	Bacillus_phage	53.3	1.3e-21
AWC65848.1|2889377_2889512_-	hypothetical protein	NA	NA	NA	NA	NA
AWC65849.1|2889525_2890623_-	hypothetical protein	NA	NA	NA	NA	NA
AWC65850.1|2891309_2892440_+|integrase	site-specific integrase	integrase	A0A0U4JNS1	Bacillus_phage	37.4	1.7e-62
2899161:2899178	attR	CCGCTATTTTAGGGCAGC	NA	NA	NA	NA
>prophage 11
CP024096	Bacillus cytotoxicus strain CH_39 chromosome, complete genome	4252957	3162627	3198041	4252957	tail,holin,portal,head,terminase	Bacillus_phage(87.18%)	47	NA	NA
AWC66148.1|3162627_3163200_+	DUF4352 domain-containing protein	NA	A0A1B1P898	Bacillus_phage	84.9	1.5e-54
AWC66149.1|3163511_3163952_+	hypothetical protein	NA	NA	NA	NA	NA
AWC66150.1|3164026_3164848_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2GLD4	Bacillus_phage	85.3	5.9e-142
AWC66151.1|3164847_3165288_-|holin	holin	holin	A0A1B1P7S2	Bacillus_phage	86.3	8.3e-66
AWC67265.1|3165299_3165605_-	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	58.0	1.4e-27
AWC66152.1|3165670_3170107_-	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	48.8	0.0e+00
AWC66153.1|3170103_3171597_-|tail	phage tail protein	tail	A0A1B1P7W7	Bacillus_phage	75.5	4.4e-228
AWC66154.1|3171609_3174537_-|tail	phage tail tape measure protein	tail	A0A0A7AR36	Bacillus_phage	55.7	2.9e-183
AWC66155.1|3174542_3174809_-	hypothetical protein	NA	A0A0M4S6X7	Bacillus_phage	60.2	8.3e-21
AWC66156.1|3174844_3175282_-	hypothetical protein	NA	A0A0M4QX42	Bacillus_phage	32.7	3.6e-13
AWC66157.1|3175327_3175960_-	hypothetical protein	NA	A0A0M4R5F9	Bacillus_phage	79.1	5.7e-76
AWC66158.1|3175977_3176358_-	hypothetical protein	NA	A0A0M4RD75	Bacillus_phage	83.3	1.8e-56
AWC66159.1|3176354_3176771_-	hypothetical protein	NA	A0A0M4S6Z2	Bacillus_phage	76.8	2.7e-58
AWC66160.1|3176754_3177114_-	hypothetical protein	NA	A0A0M4S6Z9	Bacillus_phage	81.2	5.7e-49
AWC66161.1|3177095_3177434_-	hypothetical protein	NA	W8CYS9	Bacillus_phage	39.6	2.9e-10
AWC66162.1|3177470_3178313_-	hypothetical protein	NA	A0A0M5M1L4	Bacillus_phage	77.7	5.2e-117
AWC66163.1|3178326_3178917_-	DUF4355 domain-containing protein	NA	A0A0M3ULE7	Bacillus_phage	55.8	4.6e-19
AWC66164.1|3178986_3180012_-|head	phage head morphogenesis protein	head	A0A0M5M7Z2	Bacillus_phage	84.1	5.1e-159
AWC66165.1|3179998_3181354_-|portal	phage portal protein	portal	A0A0M4S669	Bacillus_phage	85.6	3.5e-200
AWC66166.1|3181365_3182670_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0M4R5F3	Bacillus_phage	95.2	9.5e-251
AWC66167.1|3182656_3183088_-|terminase	terminase small subunit	terminase	A0A0M4RU19	Bacillus_phage	74.1	6.4e-55
AWC66168.1|3183851_3184097_-	DNA-binding protein	NA	A0A290FZJ4	Caldibacillus_phage	57.5	5.1e-17
AWC66169.1|3184500_3184881_-	ArpU family transcriptional regulator	NA	A0A0M4R397	Bacillus_phage	84.7	1.1e-53
AWC66170.1|3184885_3185173_-	hypothetical protein	NA	A6M999	Geobacillus_virus	70.2	4.2e-34
AWC66171.1|3185200_3185623_-	hypothetical protein	NA	R9TLR2	Paenibacillus_phage	41.3	2.0e-21
AWC67266.1|3185873_3186158_-	hypothetical protein	NA	I7J4K9	Bacillus_phage	48.9	4.3e-15
AWC66172.1|3186192_3186387_-	hypothetical protein	NA	NA	NA	NA	NA
AWC66173.1|3186423_3186627_-	hypothetical protein	NA	NA	NA	NA	NA
AWC66174.1|3186662_3186905_-	hypothetical protein	NA	NA	NA	NA	NA
AWC66175.1|3186952_3187498_-	hypothetical protein	NA	A0A1I9S5V4	Bacillus_phage	78.0	3.5e-66
AWC67267.1|3187852_3188425_-	dUTPase	NA	A0A0A7AQI4	Bacillus_phage	77.0	1.2e-80
AWC66176.1|3188578_3189370_-	hypothetical protein	NA	A0A0M4RU33	Bacillus_phage	42.5	4.5e-30
AWC66177.1|3189356_3189551_-	hypothetical protein	NA	NA	NA	NA	NA
AWC66178.1|3189535_3189751_-	hypothetical protein	NA	NA	NA	NA	NA
AWC66179.1|3189753_3189936_-	hypothetical protein	NA	NA	NA	NA	NA
AWC67268.1|3189962_3190745_-	hypothetical protein	NA	U5PWH5	Bacillus_phage	38.3	2.9e-37
AWC66180.1|3190728_3191481_-	phage replication protein	NA	A0A0M4S6Y4	Bacillus_phage	67.4	2.1e-56
AWC66181.1|3191481_3191751_-	hypothetical protein	NA	A0A0M4S680	Bacillus_phage	83.1	5.3e-39
AWC66182.1|3191747_3192587_-	hypothetical protein	NA	Q38143	Bacillus_phage	45.1	3.1e-53
AWC66183.1|3192798_3193686_-	hypothetical protein	NA	S6C475	Thermus_phage	49.1	5.9e-71
AWC66184.1|3193730_3193964_-	hypothetical protein	NA	A0A0M4S677	Bacillus_phage	80.3	4.9e-25
AWC66185.1|3194283_3194478_-	hypothetical protein	NA	NA	NA	NA	NA
AWC66186.1|3194506_3195283_-	hypothetical protein	NA	A0A288WFS9	Bacillus_phage	62.9	2.7e-59
AWC66187.1|3195279_3195468_-	XRE family transcriptional regulator	NA	A0A0M3ULF9	Bacillus_phage	91.4	1.1e-22
AWC66188.1|3195740_3196163_+	XRE family transcriptional regulator	NA	A0A0M4QX29	Bacillus_phage	97.1	2.0e-69
AWC67269.1|3196177_3196603_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M4RD70	Bacillus_phage	92.2	7.5e-72
AWC66189.1|3196616_3198041_+	recombinase family protein	NA	A0A1L2JY12	Aeribacillus_phage	41.0	3.0e-101
