The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024109	Bacillus cytotoxicus strain CH_13 chromosome, complete genome	4082665	268952	276931	4082665		uncultured_virus(33.33%)	6	NA	NA
AWC43364.1|268952_269237_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	52.7	5.8e-20
AWC43365.1|269271_270900_+	molecular chaperone GroEL	NA	A0A219YK78	uncultured_virus	56.9	1.5e-157
AWC43366.1|271326_272874_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	30.6	2.2e-20
AWC43367.1|273247_274573_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	31.6	2.9e-45
AWC46811.1|274716_275418_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.7	8.6e-41
AWC46810.1|275443_276931_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.4	2.8e-33
>prophage 2
CP024109	Bacillus cytotoxicus strain CH_13 chromosome, complete genome	4082665	302412	310784	4082665		Synechococcus_phage(33.33%)	8	NA	NA
AWC43377.1|302412_303714_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	31.6	2.0e-19
AWC43378.1|303808_304528_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	43.9	9.8e-48
AWC43379.1|304520_304775_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AWC43380.1|304771_305455_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AWC43381.1|305438_307658_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.3	1.5e-160
AWC43382.1|307642_309058_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.2	8.1e-54
AWC43383.1|309160_310204_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	48.0	2.7e-70
AWC43384.1|310196_310784_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.2	1.6e-24
>prophage 3
CP024109	Bacillus cytotoxicus strain CH_13 chromosome, complete genome	4082665	1036095	1102246	4082665	bacteriocin,integrase,coat	Escherichia_phage(22.22%)	53	1075855:1075882	1104868:1104895
AWC43986.1|1036095_1036671_-|coat	spore coat protein	coat	NA	NA	NA	NA
AWC43987.1|1036792_1037152_+	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
AWC46830.1|1037276_1037435_+	cytochrome C oxidase subunit III	NA	NA	NA	NA	NA
AWC46831.1|1037501_1038437_-	glycosyl transferase family 2	NA	NA	NA	NA	NA
AWC43988.1|1038459_1039215_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWC43989.1|1044100_1044781_+	streptomycin biosynthesis protein StrF	NA	NA	NA	NA	NA
AWC43990.1|1044857_1045595_+|coat	spore coat protein	coat	I7I009	Enterobacteria_phage	44.7	2.8e-50
AWC43991.1|1045603_1046152_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A218MN57	uncultured_virus	43.2	1.7e-31
AWC43992.1|1046163_1047135_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	42.9	8.5e-71
AWC43993.1|1047146_1047998_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	40.2	9.5e-42
AWC43994.1|1048200_1048701_-	hypothetical protein	NA	NA	NA	NA	NA
AWC43995.1|1049136_1049610_-|coat	spore coat protein	coat	NA	NA	NA	NA
AWC43996.1|1049776_1051831_-	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	31.9	6.2e-79
AWC43997.1|1052356_1052875_-	hypothetical protein	NA	NA	NA	NA	NA
AWC43998.1|1052967_1053699_-	esterase family protein	NA	NA	NA	NA	NA
AWC43999.1|1053919_1054831_+	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AWC44000.1|1055051_1055441_-	hypothetical protein	NA	A0A0E3TB73	Enterococcus_phage	36.6	6.3e-09
AWC44001.1|1055612_1057079_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
AWC44002.1|1058911_1060405_+	lactate permease	NA	NA	NA	NA	NA
AWC44003.1|1060509_1061193_+	DUF2278 domain-containing protein	NA	NA	NA	NA	NA
AWC44004.1|1061239_1062073_-	hypothetical protein	NA	NA	NA	NA	NA
AWC44005.1|1062201_1062948_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
AWC44006.1|1063122_1064457_+	CoA-disulfide reductase	NA	NA	NA	NA	NA
AWC44007.1|1064585_1064996_+	DUF3908 domain-containing protein	NA	NA	NA	NA	NA
AWC44008.1|1065209_1066754_-	NADH oxidase	NA	NA	NA	NA	NA
AWC44009.1|1066814_1068767_-|bacteriocin	bacteriocin biosynthesis protein SagD	bacteriocin	NA	NA	NA	NA
AWC44010.1|1068760_1070686_-|bacteriocin	putative thiazole-containing bacteriocin maturation protein	bacteriocin	NA	NA	NA	NA
AWC44011.1|1070844_1072089_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
AWC44012.1|1072209_1075086_-	2-oxoglutarate dehydrogenase subunit E1	NA	NA	NA	NA	NA
1075855:1075882	attL	TCAAGATTCAGAGAGAAGCAAGGAAGAT	NA	NA	NA	NA
AWC44013.1|1076053_1076236_+	DUF3976 domain-containing protein	NA	NA	NA	NA	NA
AWC44014.1|1076297_1077182_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWC44015.1|1077368_1078295_+	2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase	NA	NA	NA	NA	NA
AWC44016.1|1078364_1079888_+	5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AWC44017.1|1079941_1081414_+	4-hydroxyphenylacetate 3-monooxygenase, oxygenase component	NA	NA	NA	NA	NA
AWC44018.1|1081433_1082417_+	3,4-dihydroxyphenylacetate 2,3-dioxygenase	NA	NA	NA	NA	NA
AWC44019.1|1082474_1083341_+	cytidyltransferase	NA	NA	NA	NA	NA
AWC44020.1|1083401_1083731_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
AWC44021.1|1083720_1085271_+	cation acetate symporter	NA	NA	NA	NA	NA
AWC44022.1|1085291_1086083_+	4-hydroxyphenylacetate isomerase	NA	NA	NA	NA	NA
AWC44023.1|1086079_1086838_+	2-hydroxyhepta-2,4-diene-1,7-dioate isomerase	NA	NA	NA	NA	NA
AWC44024.1|1086910_1087309_+	5-carboxymethyl-2-hydroxymuconate isomerase	NA	NA	NA	NA	NA
AWC44025.1|1087627_1088740_+	tetratricopeptide repeat-containing protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	49.1	2.4e-93
AWC44026.1|1089390_1089759_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AWC44027.1|1090583_1090790_+	hypothetical protein	NA	NA	NA	NA	NA
AWC44028.1|1091440_1091758_+	DUF3884 domain-containing protein	NA	NA	NA	NA	NA
AWC44029.1|1093815_1094223_+	hypothetical protein	NA	NA	NA	NA	NA
AWC44030.1|1097523_1097901_-	hypothetical protein	NA	NA	NA	NA	NA
AWC44031.1|1097917_1098178_-	hypothetical protein	NA	NA	NA	NA	NA
AWC44032.1|1098313_1098568_+	hypothetical protein	NA	NA	NA	NA	NA
AWC44033.1|1099074_1099728_+	hypothetical protein	NA	NA	NA	NA	NA
AWC44034.1|1099925_1100201_+	hypothetical protein	NA	NA	NA	NA	NA
AWC44035.1|1100518_1101613_-	tetratricopeptide repeat-containing protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	51.8	1.2e-100
AWC44036.1|1101874_1102246_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	54.4	2.1e-25
1104868:1104895	attR	TCAAGATTCAGAGAGAAGCAAGGAAGAT	NA	NA	NA	NA
>prophage 4
CP024109	Bacillus cytotoxicus strain CH_13 chromosome, complete genome	4082665	2637527	2711495	4082665	capsid,head,holin,protease,tail,tRNA,portal,integrase,terminase	Bacillus_phage(77.78%)	85	2669070:2669087	2718216:2718233
AWC45417.1|2637527_2640293_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L9X8	Tupanvirus	27.3	2.8e-87
AWC45418.1|2640637_2641144_-	septum formation initiator	NA	NA	NA	NA	NA
AWC45419.1|2641236_2642010_-	RNA-binding protein	NA	NA	NA	NA	NA
AWC45420.1|2642024_2642288_-	YggT family protein	NA	NA	NA	NA	NA
AWC45421.1|2642294_2642765_-	cell division protein SepF	NA	NA	NA	NA	NA
AWC45422.1|2642783_2643458_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AWC45423.1|2643464_2644274_-	laccase domain-containing protein	NA	NA	NA	NA	NA
AWC45424.1|2644391_2644670_-	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
AWC45425.1|2644933_2645713_-	RNA polymerase sporulation sigma factor SigG	NA	A0A0Y0AU18	Bacillus_phage	43.4	3.4e-46
AWC45426.1|2645904_2646624_-	RNA polymerase sporulation sigma factor SigE	NA	A0A2H4JC68	uncultured_Caudovirales_phage	42.9	2.5e-19
AWC45427.1|2646643_2647570_-	sigma-E processing peptidase SpoIIGA	NA	NA	NA	NA	NA
AWC45428.1|2647785_2648940_-	cell division protein FtsZ	NA	NA	NA	NA	NA
AWC45429.1|2648979_2650284_-	cell division protein FtsA	NA	NA	NA	NA	NA
AWC45430.1|2650684_2651452_-	cell division protein DivIB	NA	NA	NA	NA	NA
AWC46902.1|2651549_2652455_-	UDP-N-acetylenolpyruvoylglucosamine reductase	NA	NA	NA	NA	NA
AWC45431.1|2652515_2653610_-	undecaprenyldiphospho-muramoylpentapeptide beta-N- acetylglucosaminyltransferase	NA	NA	NA	NA	NA
AWC46903.1|2653794_2654886_-	stage V sporulation protein E	NA	NA	NA	NA	NA
AWC45432.1|2654977_2656333_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
AWC45433.1|2656333_2657308_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
AWC45434.1|2657330_2658806_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
AWC45435.1|2659078_2660995_-	stage V sporulation protein D	NA	NA	NA	NA	NA
AWC46904.1|2661092_2663243_-	dihydropteridine reductase	NA	NA	NA	NA	NA
AWC45436.1|2663265_2663622_-	cell division protein FtsL	NA	NA	NA	NA	NA
AWC45437.1|2663637_2664570_-	ribosomal RNA small subunit methyltransferase H	NA	NA	NA	NA	NA
AWC46905.1|2664933_2666550_-	bacillithiol biosynthesis cysteine-adding enzyme BshC	NA	NA	NA	NA	NA
AWC46906.1|2666629_2667514_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AWC45438.1|2667815_2668289_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWC45439.1|2668384_2668906_-	RsfA family transcriptional regulator	NA	G3MB11	Bacillus_virus	47.8	4.0e-11
2669070:2669087	attL	GCTGCCCTAAAATAGCGG	NA	NA	NA	NA
AWC45440.1|2669165_2669339_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
AWC45441.1|2669400_2669901_-	hypothetical protein	NA	NA	NA	NA	NA
AWC45442.1|2670182_2670803_-	hypothetical protein	NA	Q2LIA9	Bacillus_phage	76.8	1.0e-85
AWC45443.1|2670744_2671926_-	cell division protein FtsK	NA	Q3HKZ7	Bacillus_phage	84.5	3.0e-195
AWC45444.1|2672043_2672226_-	hypothetical protein	NA	Q2I8E2	Bacillus_phage	88.3	2.2e-20
AWC45445.1|2672222_2672531_-	hypothetical protein	NA	A0A288WG08	Bacillus_phage	78.4	3.8e-41
AWC45446.1|2672714_2672924_+	XRE family transcriptional regulator	NA	Q2I8E4	Bacillus_phage	79.4	2.7e-22
AWC45447.1|2672926_2673415_+	hypothetical protein	NA	Q3HL01	Bacillus_phage	61.7	8.1e-46
AWC45448.1|2673450_2674515_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7AQV3	Bacillus_phage	85.9	2.3e-178
AWC45449.1|2674511_2674751_-|holin	holin	holin	A0A2H4J378	uncultured_Caudovirales_phage	87.3	1.2e-29
AWC45450.1|2674750_2674987_-	hypothetical protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	78.2	1.2e-07
AWC45451.1|2675028_2679060_-	peptidase S74	NA	H0USX5	Bacillus_phage	44.9	1.7e-242
AWC45452.1|2679056_2680550_-|tail	phage tail protein	tail	A0A2H4JC38	uncultured_Caudovirales_phage	83.7	1.2e-254
AWC45453.1|2680558_2684599_-|tail	phage tail tape measure protein	tail	H0USX3	Bacillus_phage	75.1	0.0e+00
AWC45454.1|2684815_2685130_-	hypothetical protein	NA	A0A288WFU6	Bacillus_phage	70.2	1.8e-35
AWC45455.1|2685178_2685790_-|tail	phage tail protein	tail	A0A2H4J8F3	uncultured_Caudovirales_phage	94.5	8.4e-101
AWC45456.1|2685790_2686150_-	DUF3168 domain-containing protein	NA	A0A0S2GLE3	Bacillus_phage	90.8	1.4e-55
AWC45457.1|2686146_2686581_-	hypothetical protein	NA	A0A288WGB7	Bacillus_phage	84.9	8.2e-66
AWC45458.1|2686573_2686897_-|head,tail	head-tail adaptor protein	head,tail	A0A288WG18	Bacillus_phage	85.0	8.0e-50
AWC45459.1|2686893_2687184_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A288WGQ6	Bacillus_phage	88.5	3.6e-41
AWC45460.1|2687201_2688377_-|capsid	phage major capsid protein	capsid	A0A288WG01	Bacillus_phage	88.0	2.5e-186
AWC46907.1|2688418_2688991_-|head,protease	HK97 family phage prohead protease	head,protease	Q2I8F8	Bacillus_phage	91.1	1.3e-95
AWC45461.1|2688980_2690291_-|portal	phage portal protein	portal	Q2LIC9	Bacillus_phage	89.2	6.4e-215
AWC45462.1|2690306_2692004_-|terminase	terminase large subunit	terminase	A0A288WFW5	Bacillus_phage	91.7	0.0e+00
AWC45463.1|2692000_2692483_-|terminase	phage terminase small subunit P27 family	terminase	Q2I8G1	Bacillus_phage	92.5	1.4e-74
AWC45464.1|2692582_2692966_-	HNH endonuclease	NA	Q2I8B2	Bacillus_phage	90.6	2.2e-62
AWC45465.1|2693031_2693271_-	hypothetical protein	NA	NA	NA	NA	NA
AWC45466.1|2693937_2694192_-	hypothetical protein	NA	A0A288WG25	Bacillus_phage	73.8	2.5e-30
AWC45467.1|2694211_2694403_-	hypothetical protein	NA	A0A288WFV5	Bacillus_phage	88.9	1.7e-23
AWC45468.1|2694408_2694627_-	hypothetical protein	NA	D2XR60	Bacillus_phage	73.6	3.3e-23
AWC45469.1|2694921_2695299_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	39.7	1.0e-16
AWC46908.1|2695356_2695677_-	hypothetical protein	NA	NA	NA	NA	NA
AWC46909.1|2695717_2695945_-	hypothetical protein	NA	A0A288WFX6	Bacillus_phage	68.0	2.2e-22
AWC45470.1|2695990_2696536_-	hypothetical protein	NA	A0A1I9S5V4	Bacillus_phage	78.0	3.5e-66
AWC45471.1|2696596_2696860_-	hypothetical protein	NA	NA	NA	NA	NA
AWC45472.1|2697620_2698019_-	hypothetical protein	NA	NA	NA	NA	NA
AWC45473.1|2698027_2698918_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
AWC45474.1|2698988_2699699_-	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
AWC45475.1|2699718_2700132_-	DUF1064 domain-containing protein	NA	A0A2P1JTY5	Anoxybacillus_phage	58.5	1.2e-34
AWC45476.1|2700124_2700619_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	A0A1B1P8C0	Bacillus_phage	70.6	3.2e-58
AWC45477.1|2700835_2701288_-	MFS transporter	NA	A0A0A7AQW3	Bacillus_phage	43.4	3.3e-33
AWC45478.1|2701302_2701785_-	hypothetical protein	NA	NA	NA	NA	NA
AWC45479.1|2701765_2701960_-	hypothetical protein	NA	NA	NA	NA	NA
AWC46910.1|2701965_2702658_-	DNA replication protein	NA	A0A0S2GLK2	Bacillus_phage	50.6	7.9e-63
AWC45480.1|2702728_2703694_-	DnaD domain protein	NA	H0USU2	Bacillus_phage	51.9	9.7e-43
AWC45481.1|2703868_2704675_-	recombinase RecT	NA	S6AVW6	Thermus_phage	66.9	3.4e-97
AWC45482.1|2704674_2704914_-	hypothetical protein	NA	NA	NA	NA	NA
AWC45483.1|2704928_2705864_-	hypothetical protein	NA	S6C475	Thermus_phage	59.5	1.9e-99
AWC45484.1|2705945_2706161_-	hypothetical protein	NA	NA	NA	NA	NA
AWC46911.1|2706336_2706630_-	hypothetical protein	NA	A0A0S2GLB6	Bacillus_phage	62.4	1.7e-27
AWC45485.1|2706637_2706958_-	hypothetical protein	NA	NA	NA	NA	NA
AWC45486.1|2707105_2707315_-	DNA-binding protein	NA	A0A0U4IIS1	Bacillus_phage	50.9	4.4e-09
AWC46912.1|2707437_2707647_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWC45487.1|2707812_2708151_+	XRE family transcriptional regulator	NA	H0UST7	Bacillus_phage	53.3	1.3e-21
AWC45488.1|2708432_2708567_-	hypothetical protein	NA	NA	NA	NA	NA
AWC45489.1|2708580_2709678_-	hypothetical protein	NA	NA	NA	NA	NA
AWC45490.1|2710364_2711495_+|integrase	site-specific integrase	integrase	A0A0U4JNS1	Bacillus_phage	37.4	1.7e-62
2718216:2718233	attR	CCGCTATTTTAGGGCAGC	NA	NA	NA	NA
>prophage 5
CP024109	Bacillus cytotoxicus strain CH_13 chromosome, complete genome	4082665	2981625	3017039	4082665	head,holin,tail,portal,terminase	Bacillus_phage(87.18%)	47	NA	NA
AWC45787.1|2981625_2982198_+	DUF4352 domain-containing protein	NA	A0A1B1P898	Bacillus_phage	84.9	1.5e-54
AWC45788.1|2982509_2982950_+	hypothetical protein	NA	NA	NA	NA	NA
AWC45789.1|2983024_2983846_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2GLD4	Bacillus_phage	85.3	5.9e-142
AWC45790.1|2983845_2984286_-|holin	holin	holin	A0A1B1P7S2	Bacillus_phage	86.3	8.3e-66
AWC46923.1|2984297_2984603_-	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	58.0	1.4e-27
AWC45791.1|2984668_2989105_-	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	48.8	0.0e+00
AWC45792.1|2989101_2990595_-|tail	phage tail protein	tail	A0A1B1P7W7	Bacillus_phage	75.5	4.4e-228
AWC45793.1|2990607_2993535_-|tail	phage tail tape measure protein	tail	A0A0A7AR36	Bacillus_phage	55.7	2.9e-183
AWC45794.1|2993540_2993807_-	hypothetical protein	NA	A0A0M4S6X7	Bacillus_phage	60.2	8.3e-21
AWC45795.1|2993842_2994280_-	hypothetical protein	NA	A0A0M4QX42	Bacillus_phage	32.7	3.6e-13
AWC45796.1|2994325_2994958_-	hypothetical protein	NA	A0A0M4R5F9	Bacillus_phage	79.1	5.7e-76
AWC45797.1|2994975_2995356_-	hypothetical protein	NA	A0A0M4RD75	Bacillus_phage	83.3	1.8e-56
AWC45798.1|2995352_2995769_-	hypothetical protein	NA	A0A0M4S6Z2	Bacillus_phage	76.8	2.7e-58
AWC45799.1|2995752_2996112_-	hypothetical protein	NA	A0A0M4S6Z9	Bacillus_phage	81.2	5.7e-49
AWC45800.1|2996093_2996432_-	hypothetical protein	NA	W8CYS9	Bacillus_phage	39.6	2.9e-10
AWC45801.1|2996468_2997311_-	hypothetical protein	NA	A0A0M5M1L4	Bacillus_phage	77.7	5.2e-117
AWC45802.1|2997324_2997915_-	DUF4355 domain-containing protein	NA	A0A0M3ULE7	Bacillus_phage	55.8	4.6e-19
AWC45803.1|2997984_2999010_-|head	phage head morphogenesis protein	head	A0A0M5M7Z2	Bacillus_phage	84.1	5.1e-159
AWC45804.1|2998996_3000352_-|portal	phage portal protein	portal	A0A0M4S669	Bacillus_phage	85.6	3.5e-200
AWC45805.1|3000363_3001668_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0M4R5F3	Bacillus_phage	95.2	9.5e-251
AWC45806.1|3001654_3002086_-|terminase	terminase small subunit	terminase	A0A0M4RU19	Bacillus_phage	74.1	6.4e-55
AWC45807.1|3002849_3003095_-	DNA-binding protein	NA	A0A290FZJ4	Caldibacillus_phage	57.5	5.1e-17
AWC45808.1|3003498_3003879_-	ArpU family transcriptional regulator	NA	A0A0M4R397	Bacillus_phage	84.7	1.1e-53
AWC45809.1|3003883_3004171_-	hypothetical protein	NA	A6M999	Geobacillus_virus	70.2	4.2e-34
AWC45810.1|3004198_3004621_-	hypothetical protein	NA	R9TLR2	Paenibacillus_phage	41.3	2.0e-21
AWC46924.1|3004871_3005156_-	hypothetical protein	NA	I7J4K9	Bacillus_phage	48.9	4.3e-15
AWC45811.1|3005190_3005385_-	hypothetical protein	NA	NA	NA	NA	NA
AWC45812.1|3005421_3005625_-	hypothetical protein	NA	NA	NA	NA	NA
AWC45813.1|3005660_3005903_-	hypothetical protein	NA	NA	NA	NA	NA
AWC45814.1|3005950_3006496_-	hypothetical protein	NA	A0A1I9S5V4	Bacillus_phage	78.0	3.5e-66
AWC46925.1|3006850_3007423_-	dUTPase	NA	A0A0A7AQI4	Bacillus_phage	77.0	1.2e-80
AWC45815.1|3007576_3008368_-	hypothetical protein	NA	A0A0M4RU33	Bacillus_phage	42.5	4.5e-30
AWC45816.1|3008354_3008549_-	hypothetical protein	NA	NA	NA	NA	NA
AWC45817.1|3008533_3008749_-	hypothetical protein	NA	NA	NA	NA	NA
AWC45818.1|3008751_3008934_-	hypothetical protein	NA	NA	NA	NA	NA
AWC46926.1|3008960_3009743_-	hypothetical protein	NA	U5PWH5	Bacillus_phage	38.3	2.9e-37
AWC45819.1|3009726_3010479_-	phage replication protein	NA	A0A0M4S6Y4	Bacillus_phage	67.4	2.1e-56
AWC45820.1|3010479_3010749_-	hypothetical protein	NA	A0A0M4S680	Bacillus_phage	83.1	5.3e-39
AWC45821.1|3010745_3011585_-	hypothetical protein	NA	Q38143	Bacillus_phage	45.1	3.1e-53
AWC45822.1|3011796_3012684_-	hypothetical protein	NA	S6C475	Thermus_phage	49.1	5.9e-71
AWC45823.1|3012728_3012962_-	hypothetical protein	NA	A0A0M4S677	Bacillus_phage	80.3	4.9e-25
AWC45824.1|3013281_3013476_-	hypothetical protein	NA	NA	NA	NA	NA
AWC45825.1|3013504_3014281_-	hypothetical protein	NA	A0A288WFS9	Bacillus_phage	62.9	2.7e-59
AWC45826.1|3014277_3014466_-	XRE family transcriptional regulator	NA	A0A0M3ULF9	Bacillus_phage	91.4	1.1e-22
AWC45827.1|3014738_3015161_+	XRE family transcriptional regulator	NA	A0A0M4QX29	Bacillus_phage	97.1	2.0e-69
AWC46927.1|3015175_3015601_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M4RD70	Bacillus_phage	92.2	7.5e-72
AWC45828.1|3015614_3017039_+	recombinase family protein	NA	A0A1L2JY12	Aeribacillus_phage	41.0	3.0e-101
>prophage 6
CP024109	Bacillus cytotoxicus strain CH_13 chromosome, complete genome	4082665	4041335	4047988	4082665		uncultured_Caudovirales_phage(66.67%)	7	NA	NA
AWC46759.1|4041335_4041752_-	hypothetical protein	NA	A0A2H4J4V0	uncultured_Caudovirales_phage	46.3	5.0e-28
AWC46760.1|4041768_4042956_-	WXG100 family type VII secretion target	NA	A0A2H4J389	uncultured_Caudovirales_phage	69.0	1.1e-152
AWC46761.1|4043181_4044276_+	tetratricopeptide repeat-containing protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	63.1	2.3e-125
AWC46762.1|4044272_4044497_+	Phr family secreted Rap phosphatase inhibitor	NA	A0A2H4JBB8	uncultured_Caudovirales_phage	48.6	4.4e-07
AWC46763.1|4044715_4045996_-	translation elongation factor	NA	NA	NA	NA	NA
AWC46764.1|4045979_4046822_-	DNA methyltransferase	NA	A0A1S5PRR3	Streptococcus_phage	52.9	1.1e-79
AWC46765.1|4047400_4047988_-	resolvase	NA	A0JC18	Ralstonia_phage	39.3	1.2e-19
