The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024104	Bacillus cytotoxicus strain CH_23 chromosome, complete genome	4196763	269579	277557	4196763		uncultured_virus(33.33%)	6	NA	NA
AWC35330.1|269579_269864_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	52.7	5.8e-20
AWC35331.1|269898_271527_+	molecular chaperone GroEL	NA	A0A219YK78	uncultured_virus	56.9	1.5e-157
AWC35332.1|271953_273501_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	30.6	2.2e-20
AWC35333.1|273874_275200_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	31.8	4.4e-46
AWC35334.1|275342_276044_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.7	8.6e-41
AWC38817.1|276069_277557_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.4	2.8e-33
>prophage 2
CP024104	Bacillus cytotoxicus strain CH_23 chromosome, complete genome	4196763	310526	318898	4196763		Synechococcus_phage(33.33%)	8	NA	NA
AWC35344.1|310526_311828_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	31.6	2.0e-19
AWC35345.1|311922_312642_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	43.9	9.8e-48
AWC35346.1|312634_312889_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AWC35347.1|312885_313569_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AWC35348.1|313552_315772_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	2.0e-160
AWC35349.1|315756_317172_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	9.5e-55
AWC35350.1|317274_318318_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	48.0	2.7e-70
AWC35351.1|318310_318898_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.2	1.6e-24
>prophage 3
CP024104	Bacillus cytotoxicus strain CH_23 chromosome, complete genome	4196763	975801	1017040	4196763	capsid,terminase,head,portal,protease,tail	Bacillus_phage(44.44%)	50	NA	NA
AWC35863.1|975801_976620_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWC35864.1|976656_977016_+	hypothetical protein	NA	NA	NA	NA	NA
AWC38837.1|977065_977365_+	hypothetical protein	NA	NA	NA	NA	NA
AWC35865.1|977547_978810_+	peptidase M48	NA	NA	NA	NA	NA
AWC35866.1|978947_980669_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.6	6.2e-16
AWC38838.1|980891_981779_+	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AWC35867.1|982251_982911_+	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
AWC35868.1|983228_983873_+	S-layer protein	NA	NA	NA	NA	NA
AWC35869.1|985700_986978_+	isocitrate lyase	NA	NA	NA	NA	NA
AWC35870.1|987308_987512_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	61.3	1.0e-15
AWC35871.1|988149_989583_-	recombinase family protein	NA	A0A2P1JU08	Anoxybacillus_phage	47.3	7.0e-114
AWC35872.1|989614_990052_-	ImmA/IrrE family metallo-endopeptidase	NA	D6R412	Bacillus_phage	50.4	3.9e-31
AWC35873.1|990074_990482_-	XRE family transcriptional regulator	NA	A0A0M4QX29	Bacillus_phage	47.1	5.0e-25
AWC35874.1|990759_990960_+	XRE family transcriptional regulator	NA	A0A0C5AJQ3	Paenibacillus_phage	50.9	3.2e-09
AWC35875.1|991306_991657_+	hypothetical protein	NA	A0A2H4JBP9	uncultured_Caudovirales_phage	77.4	7.1e-44
AWC35876.1|991746_992064_+	hypothetical protein	NA	A0A2H4J830	uncultured_Caudovirales_phage	48.8	2.1e-15
AWC35877.1|992011_992212_+	hypothetical protein	NA	NA	NA	NA	NA
AWC35878.1|992213_992405_+	hypothetical protein	NA	NA	NA	NA	NA
AWC35879.1|992410_993112_+	DNA-binding protein	NA	A0A2H4JHI2	uncultured_Caudovirales_phage	58.1	3.6e-71
AWC35880.1|993111_993588_+	DUF669 domain-containing protein	NA	A0A1B2AQ07	Phage_Wrath	49.4	1.6e-30
AWC35881.1|993692_996047_+	DNA primase	NA	A0A1B2AQ05	Phage_Wrath	83.2	0.0e+00
AWC35882.1|996312_996741_+	hypothetical protein	NA	A0A2H4JFQ6	uncultured_Caudovirales_phage	78.7	3.4e-64
AWC35883.1|996743_997283_+	nuclease	NA	A0A0S2SXQ1	Bacillus_phage	53.1	8.6e-49
AWC35884.1|997284_997569_+	hypothetical protein	NA	A0A0H3V0M3	Geobacillus_virus	52.3	3.9e-16
AWC35885.1|997649_997994_+	organic solvent tolerance protein OstA	NA	A0A1B1P7N6	Bacillus_phage	56.6	2.5e-25
AWC35886.1|998077_998278_+	hypothetical protein	NA	A0A1L2JY31	Aeribacillus_phage	53.0	6.9e-12
AWC35887.1|998380_999184_+	hypothetical protein	NA	NA	NA	NA	NA
AWC35888.1|999207_1000392_+	transcriptional regulator	NA	A0A0A7RTT7	Clostridium_phage	27.9	1.6e-34
AWC35889.1|1000493_1000889_+	DUF1492 domain-containing protein	NA	A0A2H4JFW6	uncultured_Caudovirales_phage	86.3	2.2e-57
AWC35890.1|1001066_1001981_+	hypothetical protein	NA	C9E2Q0	Enterococcus_phage	35.9	5.6e-24
AWC35891.1|1002042_1002573_-	pilus assembly protein HicB	NA	A0A090DBV2	Clostridium_phage	51.1	7.5e-29
AWC38839.1|1002668_1002839_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
AWC35892.1|1003073_1003313_+	hydrolase	NA	NA	NA	NA	NA
AWC35893.1|1003326_1003623_+	HNH endonuclease	NA	A0A0S2SXR6	Bacillus_phage	64.0	1.7e-27
AWC35894.1|1003609_1003846_+	hypothetical protein	NA	A0A0S2GM40	Bacillus_phage	82.9	1.4e-24
AWC35895.1|1003960_1004347_+	hypothetical protein	NA	A0A0S2SXN4	Bacillus_phage	87.8	4.4e-55
AWC35896.1|1004343_1006062_+|terminase	terminase large subunit	terminase	A0A0S2SXJ7	Bacillus_phage	86.5	2.0e-301
AWC35897.1|1006084_1007254_+|portal	phage portal protein	portal	A0A1S5SFK2	Streptococcus_phage	58.1	2.5e-133
AWC35898.1|1007246_1007819_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0S2SXJ4	Bacillus_phage	69.5	1.0e-71
AWC35899.1|1007811_1008984_+|capsid	phage major capsid protein	capsid	A0A0S2SXJ6	Bacillus_phage	74.6	1.1e-154
AWC35900.1|1009001_1009181_+	hypothetical protein	NA	A0A0S2SXV2	Bacillus_phage	64.3	1.2e-12
AWC35901.1|1009173_1009467_+	hypothetical protein	NA	A0A0S2SXS0	Bacillus_phage	57.3	1.5e-23
AWC35902.1|1009453_1009798_+	hypothetical protein	NA	NA	NA	NA	NA
AWC35903.1|1009790_1010147_+	hypothetical protein	NA	D2XR21	Bacillus_phage	59.0	7.5e-33
AWC35904.1|1010143_1010473_+	hypothetical protein	NA	D2XR22	Bacillus_phage	96.3	1.4e-54
AWC35905.1|1010473_1011067_+|tail	phage tail protein	tail	D2XR23	Bacillus_phage	85.6	1.5e-94
AWC35906.1|1011073_1011430_+	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	70.8	2.0e-41
AWC35907.1|1011660_1013124_+	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	86.8	1.0e-189
AWC35908.1|1013342_1015523_+	hypothetical protein	NA	A0A2H4JC82	uncultured_Caudovirales_phage	70.4	2.1e-29
AWC35909.1|1015564_1017040_+|tail	phage tail protein	tail	D2XR27	Bacillus_phage	95.1	8.7e-285
>prophage 4
CP024104	Bacillus cytotoxicus strain CH_23 chromosome, complete genome	4196763	1021752	1028253	4196763	holin	uncultured_Caudovirales_phage(44.44%)	12	NA	NA
AWC35910.1|1021752_1022202_+	hypothetical protein	NA	A0A2H4J6F8	uncultured_Caudovirales_phage	94.6	1.4e-76
AWC35911.1|1022371_1022608_+	hypothetical protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	96.2	1.5e-18
AWC35912.1|1022607_1022847_+|holin	holin	holin	A0A2H4J378	uncultured_Caudovirales_phage	98.7	1.7e-33
AWC35913.1|1022843_1023908_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P878	Bacillus_phage	94.4	9.3e-196
AWC35914.1|1023946_1024489_-	hypothetical protein	NA	NA	NA	NA	NA
AWC35915.1|1024624_1024870_+	hypothetical protein	NA	NA	NA	NA	NA
AWC35916.1|1024871_1025720_+	AraC family transcriptional regulator	NA	A0A1B0RXG1	Streptococcus_phage	38.6	2.7e-20
AWC35917.1|1026024_1026387_-	hypothetical protein	NA	NA	NA	NA	NA
AWC35918.1|1026448_1026781_-	hypothetical protein	NA	A0A1B2AQ49	Phage_Wrath	49.1	4.1e-17
AWC35919.1|1026859_1027108_-	hypothetical protein	NA	A0A1B1P7Q5	Bacillus_phage	97.6	1.1e-38
AWC35920.1|1027104_1027329_-	transcriptional regulator	NA	A0A1B1P7Q3	Bacillus_phage	100.0	7.7e-36
AWC35921.1|1027422_1028253_-	cytosolic protein	NA	A0A2H4J9W9	uncultured_Caudovirales_phage	89.1	3.8e-120
>prophage 5
CP024104	Bacillus cytotoxicus strain CH_23 chromosome, complete genome	4196763	1098860	1164947	4196763	bacteriocin,coat,integrase	Escherichia_phage(18.18%)	58	1138558:1138585	1167569:1167596
AWC35986.1|1098860_1099436_-|coat	spore coat protein	coat	NA	NA	NA	NA
AWC35987.1|1099557_1099917_+	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
AWC38844.1|1100041_1100200_+	cytochrome C oxidase subunit III	NA	NA	NA	NA	NA
AWC38845.1|1100266_1101202_-	glycosyl transferase family 2	NA	NA	NA	NA	NA
AWC35988.1|1101224_1101980_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWC35989.1|1102169_1103015_-	macrocin O-methyltransferase	NA	A0A2R8FFV8	Cedratvirus	55.2	5.5e-58
AWC35990.1|1103140_1103815_-	hypothetical protein	NA	NA	NA	NA	NA
AWC38846.1|1104241_1105339_+	beta 1,4 glucosyltransferase	NA	A0A0N9QAD0	Chrysochromulina_ericina_virus	25.2	1.5e-10
AWC35991.1|1105423_1106110_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWC35992.1|1106106_1106784_+	streptomycin biosynthesis protein StrF	NA	NA	NA	NA	NA
AWC35993.1|1106803_1107484_+	streptomycin biosynthesis protein StrF	NA	NA	NA	NA	NA
AWC35994.1|1107560_1108298_+|coat	spore coat protein	coat	I7I009	Enterobacteria_phage	44.7	2.8e-50
AWC35995.1|1108306_1108855_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A218MN57	uncultured_virus	43.2	1.7e-31
AWC35996.1|1108866_1109838_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	42.9	8.5e-71
AWC35997.1|1109849_1110701_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	40.2	9.5e-42
AWC35998.1|1110903_1111404_-	hypothetical protein	NA	NA	NA	NA	NA
AWC35999.1|1111839_1112313_-|coat	spore coat protein	coat	NA	NA	NA	NA
AWC36000.1|1112479_1114534_-	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	31.9	6.2e-79
AWC36001.1|1115059_1115578_-	hypothetical protein	NA	NA	NA	NA	NA
AWC36002.1|1115670_1116402_-	esterase family protein	NA	NA	NA	NA	NA
AWC36003.1|1116622_1117534_+	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AWC36004.1|1117754_1118144_-	hypothetical protein	NA	A0A0E3TB73	Enterococcus_phage	36.6	6.3e-09
AWC36005.1|1118315_1119782_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
AWC36006.1|1121614_1123108_+	lactate permease	NA	NA	NA	NA	NA
AWC36007.1|1123212_1123896_+	DUF2278 domain-containing protein	NA	NA	NA	NA	NA
AWC36008.1|1123942_1124776_-	hypothetical protein	NA	NA	NA	NA	NA
AWC36009.1|1124904_1125651_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
AWC36010.1|1125825_1127160_+	CoA-disulfide reductase	NA	NA	NA	NA	NA
AWC36011.1|1127288_1127699_+	DUF3908 domain-containing protein	NA	NA	NA	NA	NA
AWC36012.1|1127912_1129457_-	NADH oxidase	NA	NA	NA	NA	NA
AWC36013.1|1129517_1131470_-|bacteriocin	bacteriocin biosynthesis protein SagD	bacteriocin	NA	NA	NA	NA
AWC36014.1|1131463_1133389_-|bacteriocin	putative thiazole-containing bacteriocin maturation protein	bacteriocin	NA	NA	NA	NA
AWC36015.1|1133547_1134792_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
AWC36016.1|1134912_1137789_-	2-oxoglutarate dehydrogenase subunit E1	NA	NA	NA	NA	NA
1138558:1138585	attL	TCAAGATTCAGAGAGAAGCAAGGAAGAT	NA	NA	NA	NA
AWC36017.1|1138756_1138939_+	DUF3976 domain-containing protein	NA	NA	NA	NA	NA
AWC36018.1|1139000_1139885_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWC36019.1|1140071_1140998_+	2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase	NA	NA	NA	NA	NA
AWC36020.1|1142643_1144116_+	4-hydroxyphenylacetate 3-monooxygenase, oxygenase component	NA	NA	NA	NA	NA
AWC36021.1|1144135_1145119_+	3,4-dihydroxyphenylacetate 2,3-dioxygenase	NA	NA	NA	NA	NA
AWC36022.1|1145176_1146043_+	cytidyltransferase	NA	NA	NA	NA	NA
AWC36023.1|1146103_1146433_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
AWC36024.1|1146422_1147973_+	cation acetate symporter	NA	NA	NA	NA	NA
AWC36025.1|1147993_1148785_+	4-hydroxyphenylacetate isomerase	NA	NA	NA	NA	NA
AWC36026.1|1148781_1149540_+	2-hydroxyhepta-2,4-diene-1,7-dioate isomerase	NA	NA	NA	NA	NA
AWC36027.1|1149612_1150011_+	5-carboxymethyl-2-hydroxymuconate isomerase	NA	NA	NA	NA	NA
AWC36028.1|1150329_1151442_+	tetratricopeptide repeat-containing protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	49.1	2.4e-93
AWC36029.1|1152092_1152461_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AWC36030.1|1153284_1153491_+	hypothetical protein	NA	NA	NA	NA	NA
AWC36031.1|1154141_1154459_+	DUF3884 domain-containing protein	NA	NA	NA	NA	NA
AWC36032.1|1156516_1156924_+	hypothetical protein	NA	NA	NA	NA	NA
AWC36033.1|1159222_1160143_-	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AWC36034.1|1160224_1160602_-	hypothetical protein	NA	NA	NA	NA	NA
AWC36035.1|1160618_1160879_-	hypothetical protein	NA	NA	NA	NA	NA
AWC36036.1|1161014_1161269_+	hypothetical protein	NA	NA	NA	NA	NA
AWC36037.1|1161775_1162429_+	hypothetical protein	NA	NA	NA	NA	NA
AWC36038.1|1162626_1162902_+	hypothetical protein	NA	NA	NA	NA	NA
AWC36039.1|1163219_1164314_-	tetratricopeptide repeat-containing protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	51.8	1.2e-100
AWC36040.1|1164575_1164947_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	54.4	2.1e-25
1167569:1167596	attR	TCAAGATTCAGAGAGAAGCAAGGAAGAT	NA	NA	NA	NA
>prophage 6
CP024104	Bacillus cytotoxicus strain CH_23 chromosome, complete genome	4196763	1978382	1986515	4196763		Bacillus_phage(50.0%)	9	NA	NA
AWC38883.1|1978382_1979300_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.3	7.6e-45
AWC36770.1|1979296_1980049_+	ABC transporter permease	NA	NA	NA	NA	NA
AWC36771.1|1980061_1980793_+	multidrug ABC transporter permease	NA	NA	NA	NA	NA
AWC36772.1|1981225_1981939_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	41.5	3.7e-39
AWC36773.1|1981939_1983346_+	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	24.4	3.2e-10
AWC36774.1|1983702_1984041_-	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	80.4	2.1e-40
AWC36775.1|1984057_1984561_-	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
AWC36776.1|1985223_1985502_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	61.9	5.1e-13
AWC36777.1|1985720_1986515_+	peptigoglycan-binding protein LysM	NA	A0A141HRV8	Bacillus_phage	40.7	6.3e-32
>prophage 7
CP024104	Bacillus cytotoxicus strain CH_23 chromosome, complete genome	4196763	2278047	2344211	4196763	holin,bacteriocin,transposase	Bacillus_phage(42.86%)	54	NA	NA
AWC37035.1|2278047_2278665_+|transposase	transposase	transposase	NA	NA	NA	NA
AWC38902.1|2279163_2279907_-	hypothetical protein	NA	A0A127AXI2	Bacillus_phage	44.5	1.7e-18
AWC37036.1|2280367_2281597_-	MFS transporter	NA	NA	NA	NA	NA
AWC37037.1|2282342_2282579_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37038.1|2282609_2283551_-|transposase	transposase	transposase	NA	NA	NA	NA
AWC37039.1|2285716_2286142_+	hypothetical protein	NA	NA	NA	NA	NA
AWC37040.1|2286116_2286410_+	hypothetical protein	NA	NA	NA	NA	NA
AWC37041.1|2286691_2287833_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	66.4	5.1e-99
AWC37042.1|2287868_2288486_-|bacteriocin	bacteriocin ABC transporter ATP-binding protein	bacteriocin	G9BWD6	Planktothrix_phage	34.3	2.9e-16
AWC37043.1|2288490_2290659_-|bacteriocin	bacteriocin-associated protein	bacteriocin	NA	NA	NA	NA
AWC37044.1|2290782_2290971_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37045.1|2290955_2291225_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37046.1|2292321_2292570_-	DUF4176 domain-containing protein	NA	NA	NA	NA	NA
AWC38903.1|2292570_2292732_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37047.1|2292770_2292962_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37048.1|2294651_2294927_-	TIGR04197 family type VII secretion effector	NA	NA	NA	NA	NA
AWC37049.1|2298218_2298965_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	5.0e-31
AWC37050.1|2299334_2299658_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37051.1|2299665_2300190_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37052.1|2302322_2302706_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37053.1|2303015_2303243_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37054.1|2305092_2306073_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
AWC37055.1|2306135_2306384_-	hypothetical protein	NA	A0A288WFY7	Bacillus_phage	46.2	3.9e-12
AWC37056.1|2306656_2307706_-	oxidoreductase	NA	NA	NA	NA	NA
AWC37057.1|2308188_2308587_+	DUF2871 domain-containing protein	NA	NA	NA	NA	NA
AWC37058.1|2309485_2309746_-	DUF2642 domain-containing protein	NA	NA	NA	NA	NA
AWC37059.1|2309885_2310548_-	bacillithiol biosynthesis deacetylase BshB2	NA	NA	NA	NA	NA
AWC37060.1|2310563_2310914_-	DUF1806 domain-containing protein	NA	NA	NA	NA	NA
AWC37061.1|2311155_2312481_+	hypothetical protein	NA	NA	NA	NA	NA
AWC37062.1|2312820_2313348_-	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	66.3	4.8e-60
AWC37063.1|2313354_2315256_-	mannonate oxidoreductase	NA	F2Y0V3	Organic_Lake_phycodnavirus	25.4	2.0e-15
AWC37064.1|2316729_2318517_+	oligoendopeptidase F	NA	NA	NA	NA	NA
AWC37065.1|2318702_2319935_-	MFS transporter	NA	NA	NA	NA	NA
AWC37066.1|2320038_2320902_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWC37067.1|2321069_2322128_+	acyltransferase	NA	NA	NA	NA	NA
AWC37068.1|2322172_2323117_-	glycerophosphodiester phosphodiesterase	NA	A0A076G4Q2	Staphylococcus_phage	35.0	2.4e-38
AWC37069.1|2323591_2324134_-	N-acetyltransferase	NA	NA	NA	NA	NA
AWC37070.1|2324384_2324798_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37071.1|2325376_2326225_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	47.9	1.4e-08
AWC37072.1|2326643_2327282_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37073.1|2327308_2328121_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37074.1|2328602_2329982_+	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	35.7	1.4e-21
AWC37075.1|2330135_2331806_-	peptidase M4 family protein	NA	NA	NA	NA	NA
AWC37076.1|2332541_2334017_+	SELO family protein	NA	A0A075BSJ0	Microcystis_phage	30.9	1.2e-47
AWC37077.1|2334132_2335518_-	2-hydroxy-acid oxidase	NA	NA	NA	NA	NA
AWC37078.1|2335942_2336620_-	methyltransferase	NA	G3MA03	Bacillus_virus	43.3	8.1e-20
AWC37079.1|2337435_2338347_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37080.1|2338752_2339100_+	hypothetical protein	NA	NA	NA	NA	NA
AWC37081.1|2339241_2340309_+	hypothetical protein	NA	NA	NA	NA	NA
AWC37082.1|2341558_2341891_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37083.1|2342062_2342266_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWC37084.1|2342345_2342930_+	hypothetical protein	NA	NA	NA	NA	NA
AWC37085.1|2342970_2343771_-	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	74.9	3.0e-122
AWC37086.1|2343770_2344211_-|holin	holin	holin	A0A1B1P7S2	Bacillus_phage	86.3	8.3e-66
>prophage 8
CP024104	Bacillus cytotoxicus strain CH_23 chromosome, complete genome	4196763	2348739	2392446	4196763	portal,integrase,capsid,tail	Bacillus_phage(46.67%)	56	2339786:2339845	2392536:2393057
2339786:2339845	attL	TGCCTGAAGAAGGTATGGTCGAAGTCGGCGAATTAAAAATACACCAAGCATCGCATGCCC	NA	NA	NA	NA
AWC37088.1|2348739_2350242_-|tail	phage tail protein	tail	A0A1B1P7W7	Bacillus_phage	72.4	7.2e-202
AWC37089.1|2350256_2353910_-|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	46.6	2.4e-57
AWC37090.1|2353956_2354274_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37091.1|2354315_2354690_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37092.1|2354747_2355278_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
AWC37093.1|2355296_2355704_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37094.1|2355706_2356066_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37095.1|2356065_2356440_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37096.1|2356443_2357250_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37097.1|2357246_2357603_-	hypothetical protein	NA	A0A142F1M2	Bacillus_phage	34.5	2.0e-09
AWC37098.1|2357608_2357821_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37099.1|2357820_2358846_-|capsid	minor capsid protein E	capsid	A0A142F1M0	Bacillus_phage	60.1	5.4e-108
AWC37100.1|2358909_2359296_-	hypothetical protein	NA	A0A142F1L9	Bacillus_phage	68.2	3.2e-45
AWC37101.1|2359318_2359870_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37102.1|2359870_2361412_-|portal	phage portal protein	portal	A0A142F1L7	Bacillus_phage	48.4	8.3e-137
AWC37103.1|2361427_2363131_-	hypothetical protein	NA	A0A142F1L6	Bacillus_phage	50.3	2.5e-158
AWC37104.1|2363130_2363604_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37105.1|2364672_2365497_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37106.1|2365892_2366459_-	hypothetical protein	NA	A0A2H4J2L4	uncultured_Caudovirales_phage	45.8	9.7e-35
AWC37107.1|2366470_2366848_-	hypothetical protein	NA	A0A0N9RZI0	Paenibacillus_phage	43.1	2.0e-15
AWC37108.1|2366852_2368430_-	DNA cytosine methyltransferase	NA	Q02778	Bacillus_phage	42.4	8.3e-108
AWC37109.1|2368426_2368657_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37110.1|2368658_2369297_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37111.1|2369308_2369542_-	glutaredoxin family protein	NA	A0A1B1P8E0	Bacillus_phage	64.5	1.2e-23
AWC37112.1|2369538_2370144_-	hypothetical protein	NA	A0A2H4JAZ2	uncultured_Caudovirales_phage	41.2	7.7e-38
AWC37113.1|2370204_2370831_-	hypothetical protein	NA	J9Q953	Bacillus_phage	44.9	3.3e-36
AWC38904.1|2370832_2371204_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37114.1|2371631_2371940_-	transglycosylase	NA	A0A0K2CZP5	Paenibacillus_phage	35.7	9.7e-05
AWC37115.1|2371939_2372335_-	alpha/beta hydrolase	NA	A0A2H4IZM2	uncultured_Caudovirales_phage	68.9	6.1e-44
AWC37116.1|2372620_2373148_-	hypothetical protein	NA	A0A0N9ST03	Paenibacillus_phage	44.6	3.2e-08
AWC37117.1|2373144_2373369_-	hypothetical protein	NA	U5Q038	Bacillus_phage	70.6	8.3e-22
AWC37118.1|2373368_2374415_-	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	58.6	4.8e-88
AWC37119.1|2374428_2374584_-	hypothetical protein	NA	NA	NA	NA	NA
AWC38905.1|2374576_2376760_-	DNA-directed DNA polymerase	NA	A0A142F1Q9	Bacillus_phage	54.6	7.2e-219
AWC37120.1|2376939_2378115_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37121.1|2378107_2378515_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37122.1|2378541_2379303_-	single-stranded DNA-binding protein	NA	A0A0N9SJW5	Paenibacillus_phage	49.2	7.9e-56
AWC37123.1|2379809_2380457_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWC37124.1|2380754_2381978_-	hypothetical protein	NA	A0A288WGM1	Bacillus_phage	47.8	9.9e-101
AWC37125.1|2382092_2382296_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWC38906.1|2382359_2382545_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWC37126.1|2382552_2383569_-	hypothetical protein	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	43.2	6.8e-71
AWC37127.1|2383595_2384939_-	DNA helicase	NA	A0A2H4IZL9	uncultured_Caudovirales_phage	55.8	2.6e-134
AWC37128.1|2385035_2385320_-	hypothetical protein	NA	A0A0H3V0M3	Geobacillus_virus	44.0	5.4e-10
AWC37129.1|2385567_2385984_-	hypothetical protein	NA	A0A0K2CNU6	Brevibacillus_phage	57.1	8.5e-12
AWC37130.1|2386021_2386561_-	hypothetical protein	NA	A0A1I9S5V4	Bacillus_phage	76.7	2.8e-71
AWC37131.1|2386606_2386792_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37132.1|2387158_2387923_-	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	56.5	3.7e-77
AWC37133.1|2387922_2388597_-	DUF723 domain-containing protein	NA	NA	NA	NA	NA
AWC38907.1|2388612_2388999_-	hypothetical protein	NA	A0A2H4J134	uncultured_Caudovirales_phage	36.2	3.2e-13
AWC37134.1|2389004_2389337_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37135.1|2389323_2389482_-	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
AWC37136.1|2389563_2389908_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37137.1|2390337_2390709_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AWC37138.1|2390705_2391107_-	helix-turn-helix domain-containing protein	NA	A0A142F1P0	Bacillus_phage	58.5	2.3e-30
AWC37139.1|2391315_2392446_+|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	36.5	3.1e-64
2392536:2393057	attR	TGCCTGAAGAAGGTATGGTCGAAGTCGGCGAATTAAAAATACACCAAGCATCGCATGCCCGCTACTTTGAAGACTTCTTAAAATTTGTCGAATATGAACGCTCCATGCCTGAAATTATGAAAACACAAGTAATGGACATGGTATACGACCAAATTGAAGATATATTTGAAGAAGGTACGGAAGAACGCGAACAATTCGACCAAGCGATGGAAGTATGGGCCGCTAGTCCGAAACGCGAAATTATGGAACAGTTTTCAACCGAAGAAATAATGGAAGCTACCGCTCAAATCGTCGAGCATGCTCCTGAAGTAGAATTAAAGGTTAAAGCCGATCACATTTCTGTGAAAGCTCTGCTTGCTGATTTCGGGGATCAAATACATATTGCAAAGGTAAATGACCGATACGTATTAATGATTGAGGCTGATACACTTACGTTTGAGAAAGGCTTCTCTCCGATTGAGTTTCTAAAGCCAGATGAATTGCAAGATGTGATTGAGCGGATTGAGAATAAGCAGCAATATT	NA	NA	NA	NA
>prophage 9
CP024104	Bacillus cytotoxicus strain CH_23 chromosome, complete genome	4196763	2742698	2817136	4196763	holin,tRNA,capsid,terminase,head,integrase,portal,protease,tail	Bacillus_phage(78.72%)	84	2774240:2774257	2823857:2823874
AWC37433.1|2742698_2745464_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L9X8	Tupanvirus	27.3	2.8e-87
AWC37434.1|2745808_2746315_-	septum formation initiator	NA	NA	NA	NA	NA
AWC37435.1|2746407_2747181_-	RNA-binding protein	NA	NA	NA	NA	NA
AWC37436.1|2747195_2747459_-	YggT family protein	NA	NA	NA	NA	NA
AWC37437.1|2747465_2747936_-	cell division protein SepF	NA	NA	NA	NA	NA
AWC37438.1|2747954_2748629_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AWC37439.1|2748635_2749445_-	laccase domain-containing protein	NA	NA	NA	NA	NA
AWC37440.1|2749562_2749841_-	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
AWC37441.1|2750104_2750884_-	RNA polymerase sporulation sigma factor SigG	NA	A0A0Y0AU18	Bacillus_phage	43.4	3.4e-46
AWC37442.1|2751075_2751795_-	RNA polymerase sporulation sigma factor SigE	NA	A0A2H4JC68	uncultured_Caudovirales_phage	42.9	2.5e-19
AWC37443.1|2751814_2752741_-	sigma-E processing peptidase SpoIIGA	NA	NA	NA	NA	NA
AWC37444.1|2752956_2754111_-	cell division protein FtsZ	NA	NA	NA	NA	NA
AWC37445.1|2754150_2755455_-	cell division protein FtsA	NA	NA	NA	NA	NA
AWC37446.1|2755855_2756623_-	cell division protein DivIB	NA	NA	NA	NA	NA
AWC38918.1|2756720_2757626_-	UDP-N-acetylenolpyruvoylglucosamine reductase	NA	NA	NA	NA	NA
AWC37447.1|2757686_2758781_-	undecaprenyldiphospho-muramoylpentapeptide beta-N- acetylglucosaminyltransferase	NA	NA	NA	NA	NA
AWC38919.1|2758965_2760057_-	stage V sporulation protein E	NA	NA	NA	NA	NA
AWC37448.1|2760148_2761504_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
AWC37449.1|2761504_2762479_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
AWC37450.1|2762501_2763977_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
AWC37451.1|2764249_2766166_-	stage V sporulation protein D	NA	NA	NA	NA	NA
AWC38920.1|2766263_2768414_-	dihydropteridine reductase	NA	NA	NA	NA	NA
AWC37452.1|2768436_2768793_-	cell division protein FtsL	NA	NA	NA	NA	NA
AWC37453.1|2768808_2769741_-	ribosomal RNA small subunit methyltransferase H	NA	NA	NA	NA	NA
AWC38921.1|2771799_2772684_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AWC37454.1|2772985_2773459_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWC37455.1|2773554_2774076_-	RsfA family transcriptional regulator	NA	G3MB11	Bacillus_virus	47.8	4.0e-11
2774240:2774257	attL	GCTGCCCTAAAATAGCGG	NA	NA	NA	NA
AWC37456.1|2774335_2774509_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
AWC37457.1|2774570_2775071_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37458.1|2775352_2775973_-	hypothetical protein	NA	Q2LIA9	Bacillus_phage	76.8	1.0e-85
AWC37459.1|2775914_2777096_-	cell division protein FtsK	NA	Q3HKZ7	Bacillus_phage	84.5	3.0e-195
AWC37460.1|2777213_2777396_-	hypothetical protein	NA	Q2I8E2	Bacillus_phage	88.3	2.2e-20
AWC37461.1|2777392_2777701_-	hypothetical protein	NA	A0A288WG08	Bacillus_phage	78.4	3.8e-41
AWC37462.1|2777884_2778094_+	XRE family transcriptional regulator	NA	Q2I8E4	Bacillus_phage	79.4	2.7e-22
AWC37463.1|2778096_2778585_+	hypothetical protein	NA	Q3HL01	Bacillus_phage	61.7	8.1e-46
AWC37464.1|2778620_2779685_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7AQV3	Bacillus_phage	85.9	2.3e-178
AWC37465.1|2779681_2779921_-|holin	holin	holin	A0A2H4J378	uncultured_Caudovirales_phage	87.3	1.2e-29
AWC37466.1|2779920_2780157_-	hypothetical protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	78.2	1.2e-07
AWC37467.1|2780198_2784845_-	hypothetical protein	NA	A0A1B1P7E6	Bacillus_phage	62.3	0.0e+00
AWC37468.1|2784841_2786335_-|tail	phage tail protein	tail	A0A2H4JC38	uncultured_Caudovirales_phage	83.7	1.2e-254
AWC37469.1|2786343_2790384_-|tail	phage tail tape measure protein	tail	H0USX3	Bacillus_phage	75.2	0.0e+00
AWC37470.1|2790600_2790915_-	hypothetical protein	NA	A0A288WFU6	Bacillus_phage	70.2	1.8e-35
AWC37471.1|2790963_2791575_-|tail	phage tail protein	tail	A0A2H4J8F3	uncultured_Caudovirales_phage	94.5	8.4e-101
AWC37472.1|2791575_2791935_-	DUF3168 domain-containing protein	NA	A0A0S2GLE3	Bacillus_phage	90.8	1.4e-55
AWC37473.1|2791931_2792366_-	hypothetical protein	NA	A0A288WGB7	Bacillus_phage	85.6	3.7e-66
AWC37474.1|2792358_2792682_-|head,tail	head-tail adaptor protein	head,tail	A0A288WG18	Bacillus_phage	85.0	8.0e-50
AWC37475.1|2792678_2792969_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A288WGQ6	Bacillus_phage	88.5	3.6e-41
AWC37476.1|2792986_2794162_-|capsid	phage major capsid protein	capsid	A0A288WG01	Bacillus_phage	88.0	2.5e-186
AWC38922.1|2794203_2794776_-|head,protease	HK97 family phage prohead protease	head,protease	Q2I8F8	Bacillus_phage	91.1	1.3e-95
AWC37477.1|2794765_2796076_-|portal	phage portal protein	portal	Q2LIC9	Bacillus_phage	89.2	6.4e-215
AWC37478.1|2796091_2797789_-|terminase	terminase large subunit	terminase	A0A288WFW5	Bacillus_phage	92.0	0.0e+00
AWC37479.1|2797785_2798271_-|terminase	phage terminase small subunit P27 family	terminase	A0A288WG26	Bacillus_phage	96.3	9.4e-79
AWC37480.1|2798370_2798754_-	HNH endonuclease	NA	Q2I8B2	Bacillus_phage	90.6	2.2e-62
AWC38923.1|2798960_2799326_-	hypothetical protein	NA	A0A288WG64	Bacillus_phage	75.0	1.2e-38
AWC37481.1|2799581_2799836_-	hypothetical protein	NA	A0A288WG25	Bacillus_phage	73.8	2.5e-30
AWC37482.1|2799855_2800047_-	hypothetical protein	NA	A0A288WFV5	Bacillus_phage	88.9	1.7e-23
AWC37483.1|2800052_2800271_-	hypothetical protein	NA	D2XR60	Bacillus_phage	73.6	3.3e-23
AWC37484.1|2800565_2800943_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	39.7	1.0e-16
AWC38924.1|2801000_2801321_-	hypothetical protein	NA	NA	NA	NA	NA
AWC38925.1|2801361_2801589_-	hypothetical protein	NA	A0A288WFX6	Bacillus_phage	68.0	2.2e-22
AWC37485.1|2801634_2802180_-	hypothetical protein	NA	A0A1I9S5V4	Bacillus_phage	78.0	3.5e-66
AWC37486.1|2802240_2802504_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37487.1|2802542_2803271_-	RNA polymerase subunit sigma-28	NA	A0A288WFV7	Bacillus_phage	46.9	6.4e-55
AWC37488.1|2803669_2804560_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
AWC37489.1|2804630_2805341_-	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
AWC37490.1|2805356_2805773_-	DUF1064 domain-containing protein	NA	A0A2P1JTY5	Anoxybacillus_phage	56.3	1.2e-34
AWC37491.1|2805765_2806260_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	A0A1B1P8C0	Bacillus_phage	70.6	3.2e-58
AWC37492.1|2806476_2806929_-	MFS transporter	NA	A0A0A7AQW3	Bacillus_phage	43.4	3.3e-33
AWC37493.1|2806943_2807426_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37494.1|2807406_2807601_-	hypothetical protein	NA	NA	NA	NA	NA
AWC38926.1|2807606_2808299_-	DNA replication protein	NA	A0A0S2GLK2	Bacillus_phage	50.6	7.9e-63
AWC37495.1|2808369_2809335_-	DnaD domain protein	NA	H0USU2	Bacillus_phage	51.9	9.7e-43
AWC37496.1|2809509_2810316_-	recombinase RecT	NA	S6AVW6	Thermus_phage	66.9	3.4e-97
AWC37497.1|2810315_2810555_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37498.1|2810569_2811505_-	hypothetical protein	NA	S6C475	Thermus_phage	59.5	1.9e-99
AWC37499.1|2811586_2811802_-	hypothetical protein	NA	NA	NA	NA	NA
AWC38927.1|2811977_2812271_-	hypothetical protein	NA	A0A0S2GLB6	Bacillus_phage	62.4	1.7e-27
AWC37500.1|2812278_2812599_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37501.1|2812746_2812956_-	DNA-binding protein	NA	A0A0U4IIS1	Bacillus_phage	50.9	4.4e-09
AWC38928.1|2813078_2813288_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWC37502.1|2813453_2813792_+	XRE family transcriptional regulator	NA	H0UST7	Bacillus_phage	53.3	1.3e-21
AWC37503.1|2814073_2814208_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37504.1|2814221_2815319_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37505.1|2816005_2817136_+|integrase	site-specific integrase	integrase	A0A0U4JNS1	Bacillus_phage	37.4	1.7e-62
2823857:2823874	attR	CCGCTATTTTAGGGCAGC	NA	NA	NA	NA
>prophage 10
CP024104	Bacillus cytotoxicus strain CH_23 chromosome, complete genome	4196763	3080667	3121649	4196763	holin,terminase,head,portal,tail	Bacillus_phage(87.76%)	56	NA	NA
AWC37795.1|3080667_3081150_-	ATPase	NA	E5DV79	Deep-sea_thermophilic_phage	48.1	8.3e-35
AWC37796.1|3081213_3081582_-	XRE family transcriptional regulator	NA	A0A0M5M3T1	Bacillus_phage	81.0	2.9e-11
AWC37797.1|3081604_3081871_-	hypothetical protein	NA	A0A0M4S677	Bacillus_phage	80.9	2.3e-23
AWC37798.1|3082190_3082385_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37799.1|3082413_3083190_-	hypothetical protein	NA	A0A288WFS9	Bacillus_phage	62.9	2.7e-59
AWC37800.1|3083186_3083375_-	XRE family transcriptional regulator	NA	A0A0M3ULF9	Bacillus_phage	91.4	1.1e-22
AWC37801.1|3083647_3084070_+	XRE family transcriptional regulator	NA	A0A0M4QX29	Bacillus_phage	97.1	2.0e-69
AWC38939.1|3084084_3084510_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M4RD70	Bacillus_phage	92.2	7.5e-72
AWC37802.1|3084523_3085948_+	recombinase family protein	NA	A0A1L2JY12	Aeribacillus_phage	42.4	7.2e-103
AWC37803.1|3086324_3086897_+	DUF4352 domain-containing protein	NA	A0A1B1P898	Bacillus_phage	84.9	1.5e-54
AWC37804.1|3087207_3087648_+	hypothetical protein	NA	NA	NA	NA	NA
AWC37805.1|3087722_3088544_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2GLD4	Bacillus_phage	85.3	5.9e-142
AWC37806.1|3088543_3088984_-|holin	holin	holin	A0A1B1P7S2	Bacillus_phage	86.3	8.3e-66
AWC37807.1|3089018_3093512_-	hypothetical protein	NA	A0A0M4RER0	Bacillus_phage	45.7	1.2e-265
AWC37808.1|3093512_3095006_-|tail	phage tail protein	tail	A0A1B1P7W7	Bacillus_phage	76.3	2.4e-229
AWC37809.1|3095018_3097946_-|tail	phage tail tape measure protein	tail	A0A0A7AR36	Bacillus_phage	55.7	2.9e-183
AWC37810.1|3097951_3098218_-	hypothetical protein	NA	A0A0M4S6X7	Bacillus_phage	60.2	8.3e-21
AWC37811.1|3098253_3098691_-	hypothetical protein	NA	A0A0M4QX42	Bacillus_phage	32.7	3.6e-13
AWC37812.1|3098736_3099369_-	hypothetical protein	NA	A0A0M4R5F9	Bacillus_phage	79.1	5.7e-76
AWC37813.1|3099386_3099767_-	hypothetical protein	NA	A0A0M4RD75	Bacillus_phage	83.3	1.8e-56
AWC37814.1|3099763_3100180_-	hypothetical protein	NA	A0A0M4S6Z2	Bacillus_phage	76.8	2.7e-58
AWC37815.1|3100163_3100523_-	hypothetical protein	NA	A0A0M4S6Z9	Bacillus_phage	81.2	5.7e-49
AWC37816.1|3100504_3100843_-	hypothetical protein	NA	W8CYS9	Bacillus_phage	39.6	2.9e-10
AWC37817.1|3100879_3101722_-	hypothetical protein	NA	A0A0M5M1L4	Bacillus_phage	77.7	5.2e-117
AWC37818.1|3101735_3102326_-	DUF4355 domain-containing protein	NA	A0A0M3ULE7	Bacillus_phage	55.8	4.6e-19
AWC37819.1|3102395_3103421_-|head	phage head morphogenesis protein	head	A0A0M5M7Z2	Bacillus_phage	84.1	5.1e-159
AWC37820.1|3103407_3104763_-|portal	phage portal protein	portal	A0A0M4S669	Bacillus_phage	85.6	3.5e-200
AWC37821.1|3104774_3106079_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0M4R5F3	Bacillus_phage	95.2	9.5e-251
AWC37822.1|3106065_3106497_-|terminase	terminase small subunit	terminase	A0A0M4RU19	Bacillus_phage	74.8	1.3e-55
AWC37823.1|3107260_3107506_-	DNA-binding protein	NA	A0A290FZJ4	Caldibacillus_phage	57.5	5.1e-17
AWC37824.1|3107909_3108290_-	ArpU family transcriptional regulator	NA	A0A0M4R397	Bacillus_phage	84.7	1.1e-53
AWC37825.1|3108294_3108582_-	hypothetical protein	NA	A6M999	Geobacillus_virus	73.4	2.9e-35
AWC38940.1|3108961_3109213_-	XRE family transcriptional regulator	NA	A0A0S2MV80	Bacillus_phage	92.7	1.3e-36
AWC37826.1|3109464_3109749_-	hypothetical protein	NA	I7J4K9	Bacillus_phage	48.9	4.3e-15
AWC37827.1|3109849_3110059_+	hypothetical protein	NA	NA	NA	NA	NA
AWC37828.1|3110119_3110551_-	hypothetical protein	NA	W8CYU3	Bacillus_phage	39.9	2.6e-19
AWC37829.1|3110580_3110784_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37830.1|3110805_3111339_-	hypothetical protein	NA	U5PUK4	Bacillus_phage	60.0	8.8e-54
AWC37831.1|3111381_3111588_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37832.1|3111666_3111867_-	hypothetical protein	NA	A0A1P8CWV4	Bacillus_phage	54.2	2.6e-06
AWC38941.1|3111903_3112476_-	dUTPase	NA	A0A0A7AQI4	Bacillus_phage	78.1	1.7e-82
AWC37833.1|3112629_3113421_-	hypothetical protein	NA	A0A0M4RU33	Bacillus_phage	42.1	3.8e-29
AWC37834.1|3113422_3113602_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37835.1|3113811_3114684_-	DNA replication protein	NA	A0A0M4RD64	Bacillus_phage	72.0	1.5e-114
AWC37836.1|3114613_3115417_-	phage replication protein	NA	A0A0M4S6Y4	Bacillus_phage	75.4	5.9e-86
AWC37837.1|3115417_3115687_-	hypothetical protein	NA	A0A0M4S680	Bacillus_phage	83.1	5.3e-39
AWC37838.1|3115700_3116372_-	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	44.2	8.0e-28
AWC37839.1|3116368_3116851_-	ATPase	NA	E5DV79	Deep-sea_thermophilic_phage	48.1	8.3e-35
AWC37840.1|3116914_3117283_-	XRE family transcriptional regulator	NA	A0A0M5M3T1	Bacillus_phage	81.0	2.9e-11
AWC37841.1|3117305_3117572_-	hypothetical protein	NA	A0A0M4S677	Bacillus_phage	80.9	2.3e-23
AWC37842.1|3117891_3118086_-	hypothetical protein	NA	NA	NA	NA	NA
AWC37843.1|3118114_3118891_-	hypothetical protein	NA	A0A288WFS9	Bacillus_phage	62.9	2.7e-59
AWC37844.1|3118887_3119076_-	XRE family transcriptional regulator	NA	A0A0M3ULF9	Bacillus_phage	91.4	1.1e-22
AWC37845.1|3119348_3119771_+	XRE family transcriptional regulator	NA	A0A0M4QX29	Bacillus_phage	97.1	2.0e-69
AWC38942.1|3119785_3120211_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M4RD70	Bacillus_phage	92.2	7.5e-72
AWC37846.1|3120224_3121649_+	recombinase family protein	NA	A0A1L2JY12	Aeribacillus_phage	42.4	7.2e-103
