The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP024098	Bacillus cytotoxicus strain CH_38 chromosome, complete genome	4215994	157123	210989	4215994	transposase,integrase,protease	Bacillus_phage(26.67%)	56	156916:156964	174084:174132
156916:156964	attL	TGCTTCCATAGCTCAGCTGGTAGAGCACTTCCATGGTAAGGAAGAGGTC	NA	NA	NA	NA
AWC27132.1|157123_158050_+|integrase	integrase	integrase	A0A2I6UG75	Salinibacter_virus	24.5	5.5e-11
AWC30758.1|158355_159081_+	helix-turn-helix domain-containing protein	NA	A0A1I9S595	Bacillus_phage	28.6	2.0e-08
AWC27133.1|159573_159948_-	hypothetical protein	NA	NA	NA	NA	NA
AWC27134.1|161941_162556_+	hypothetical protein	NA	NA	NA	NA	NA
AWC27135.1|162561_162792_+	hypothetical protein	NA	NA	NA	NA	NA
AWC27136.1|162805_163042_+	hypothetical protein	NA	NA	NA	NA	NA
AWC27137.1|163071_163752_+	hypothetical protein	NA	NA	NA	NA	NA
AWC27138.1|163990_164815_+	hypothetical protein	NA	NA	NA	NA	NA
AWC27139.1|164829_165249_+	hypothetical protein	NA	NA	NA	NA	NA
AWC27140.1|165271_165481_+	hypothetical protein	NA	NA	NA	NA	NA
AWC27141.1|165501_165906_+	hypothetical protein	NA	NA	NA	NA	NA
AWC27142.1|166140_166791_+	hypothetical protein	NA	M1HN75	Bacillus_virus	34.6	2.1e-17
AWC27143.1|166898_167321_+	hypothetical protein	NA	A0A2P1JUJ6	Bacillus_phage	58.6	1.0e-33
AWC27144.1|167407_169594_+	hypothetical protein	NA	A0A2P1JUK2	Bacillus_phage	41.2	2.0e-11
AWC27145.1|169731_170016_+	hypothetical protein	NA	NA	NA	NA	NA
AWC27146.1|170032_170341_+	hypothetical protein	NA	NA	NA	NA	NA
AWC27147.1|170491_171343_+	DNA methyltransferase	NA	A0A1S5PRR3	Streptococcus_phage	52.3	6.7e-80
AWC27148.1|171326_172607_+	translation elongation factor	NA	NA	NA	NA	NA
AWC27149.1|172860_173184_+	hypothetical protein	NA	NA	NA	NA	NA
AWC27150.1|173246_173444_+	hypothetical protein	NA	NA	NA	NA	NA
AWC27151.1|173647_173863_+	hypothetical protein	NA	NA	NA	NA	NA
AWC27152.1|174904_176047_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.7	5.1e-51
174084:174132	attR	TGCTTCCATAGCTCAGCTGGTAGAGCACTTCCATGGTAAGGAAGAGGTC	NA	NA	NA	NA
AWC27153.1|176244_177138_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	31.1	7.9e-23
AWC27154.1|177391_178222_+	TIGR00159 family protein	NA	NA	NA	NA	NA
AWC27155.1|178214_179660_+	hypothetical protein	NA	NA	NA	NA	NA
AWC27156.1|179652_180999_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AWC27157.1|181483_183286_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q84421	Paramecium_bursaria_Chlorella_virus	40.3	3.1e-103
AWC27158.1|183516_184188_-	hypothetical protein	NA	A0A146ICT8	Staphylococcus_phage	55.6	1.1e-16
AWC27159.1|184613_185366_-|transposase	transposase	transposase	A0A059NT77	Lactococcus_phage	46.9	2.7e-56
AWC27160.1|185355_186651_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	27.1	8.5e-10
AWC27161.1|187522_188392_+	hypothetical protein	NA	A0A1X9I6E0	Streptococcus_phage	26.1	1.6e-07
AWC27162.1|188832_190026_+	radical SAM protein	NA	NA	NA	NA	NA
AWC27163.1|190018_191944_+	hypothetical protein	NA	NA	NA	NA	NA
AWC27164.1|191936_192527_+	radical SAM protein	NA	NA	NA	NA	NA
AWC27165.1|192513_193323_+	hypothetical protein	NA	NA	NA	NA	NA
AWC27166.1|194829_195534_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWC27167.1|196050_196794_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWC27168.1|197259_197523_+	hypothetical protein	NA	NA	NA	NA	NA
AWC27169.1|197703_197856_+	hypothetical protein	NA	NA	NA	NA	NA
AWC27170.1|198159_198816_+	hypothetical protein	NA	NA	NA	NA	NA
AWC30759.1|199049_199463_+	DUF1648 domain-containing protein	NA	NA	NA	NA	NA
AWC27171.1|200456_201623_+	MFS transporter	NA	NA	NA	NA	NA
AWC27172.1|201628_202090_+	hypothetical protein	NA	NA	NA	NA	NA
AWC27173.1|202092_202905_+	hypothetical protein	NA	NA	NA	NA	NA
AWC27174.1|202938_203220_+	hypothetical protein	NA	NA	NA	NA	NA
AWC27175.1|203224_204217_+	hypothetical protein	NA	NA	NA	NA	NA
AWC27176.1|204221_204476_+	hypothetical protein	NA	NA	NA	NA	NA
AWC27177.1|204472_205636_+	hypothetical protein	NA	NA	NA	NA	NA
AWC27178.1|205654_206551_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
AWC27179.1|206538_206889_+	hypothetical protein	NA	NA	NA	NA	NA
AWC27180.1|206906_207638_+	adenylyltransferase	NA	S4VW33	Pandoravirus	31.3	4.1e-09
AWC27181.1|207778_208144_+	hypothetical protein	NA	NA	NA	NA	NA
AWC27182.1|208153_208357_+	hypothetical protein	NA	NA	NA	NA	NA
AWC27183.1|208298_208466_-	hypothetical protein	NA	NA	NA	NA	NA
AWC30760.1|209058_209481_+	hypothetical protein	NA	NA	NA	NA	NA
AWC27184.1|209837_210989_+|transposase	transposase	transposase	S6AND0	Bacillus_phage	80.4	9.1e-173
>prophage 2
CP024098	Bacillus cytotoxicus strain CH_38 chromosome, complete genome	4215994	287346	295324	4215994		uncultured_virus(33.33%)	6	NA	NA
AWC27251.1|287346_287631_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	52.7	5.8e-20
AWC27252.1|287665_289294_+	molecular chaperone GroEL	NA	A0A219YK78	uncultured_virus	56.9	1.5e-157
AWC27253.1|289720_291268_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	30.6	2.2e-20
AWC27254.1|291641_292967_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	31.8	4.4e-46
AWC27255.1|293109_293811_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.7	8.6e-41
AWC30763.1|293836_295324_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.2	1.3e-33
>prophage 3
CP024098	Bacillus cytotoxicus strain CH_38 chromosome, complete genome	4215994	328302	336674	4215994		Synechococcus_phage(33.33%)	8	NA	NA
AWC27266.1|328302_329604_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	31.6	2.0e-19
AWC27267.1|329698_330418_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	43.9	9.8e-48
AWC27268.1|330410_330665_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AWC27269.1|330661_331345_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AWC27270.1|331328_333548_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.2	2.0e-160
AWC27271.1|333532_334948_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.2	3.6e-54
AWC27272.1|335050_336094_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	48.0	2.7e-70
AWC27273.1|336086_336674_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.2	1.6e-24
>prophage 4
CP024098	Bacillus cytotoxicus strain CH_38 chromosome, complete genome	4215994	758197	796384	4215994	transposase,coat	Thermus_phage(20.0%)	39	NA	NA
AWC27616.1|758197_759328_+|transposase	transposase	transposase	S6C485	Thermus_phage	32.1	1.2e-12
AWC27617.1|759331_761422_+|transposase	transposase	transposase	NA	NA	NA	NA
AWC27618.1|761423_761804_+|transposase	transposase	transposase	NA	NA	NA	NA
AWC27619.1|761882_762356_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
AWC27620.1|762591_763290_-	recombinase	NA	M9Q1K0	Clostridium_phage	25.4	2.9e-12
AWC27621.1|763531_763939_+	transcriptional repressor	NA	NA	NA	NA	NA
AWC27622.1|763953_764925_+	ornithine cyclodeaminase	NA	NA	NA	NA	NA
AWC27623.1|764939_766052_-	hypothetical protein	NA	NA	NA	NA	NA
AWC27624.1|766135_766507_+	hypothetical protein	NA	NA	NA	NA	NA
AWC27625.1|767060_767717_-	hypothetical protein	NA	NA	NA	NA	NA
AWC27626.1|768042_768441_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWC27627.1|768591_769446_+	patatin family protein	NA	NA	NA	NA	NA
AWC27628.1|769581_770883_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	34.1	4.5e-51
AWC27629.1|771170_772037_+	NAD(P)-dependent oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	43.3	6.6e-59
AWC27630.1|772208_772970_+	L,D-transpeptidase	NA	NA	NA	NA	NA
AWC27631.1|773062_773335_+	hypothetical protein	NA	NA	NA	NA	NA
AWC27632.1|773385_773601_-	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
AWC27633.1|773672_774083_-	thioredoxin	NA	NA	NA	NA	NA
AWC27634.1|774095_774515_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
AWC27635.1|774645_775521_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
AWC27636.1|775708_775957_-	hypothetical protein	NA	NA	NA	NA	NA
AWC27637.1|776057_776555_-	hypothetical protein	NA	NA	NA	NA	NA
AWC27638.1|776609_777710_-	spore gernimation protein GerB	NA	NA	NA	NA	NA
AWC27639.1|777722_778805_-	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
AWC27640.1|778801_780313_-	spore germination protein	NA	NA	NA	NA	NA
AWC27641.1|780588_781149_+	nitroreductase	NA	NA	NA	NA	NA
AWC27642.1|781833_783246_+	stage V sporulation protein R	NA	NA	NA	NA	NA
AWC27643.1|783445_783886_-	hypothetical protein	NA	NA	NA	NA	NA
AWC27644.1|784041_785208_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
AWC27645.1|785555_787211_-	sodium:phosphate symporter	NA	NA	NA	NA	NA
AWC27646.1|787553_788756_-	MFS transporter	NA	NA	NA	NA	NA
AWC27647.1|789076_790165_+	DUF871 domain-containing protein	NA	NA	NA	NA	NA
AWC27648.1|790205_791387_-	ABC transporter permease	NA	NA	NA	NA	NA
AWC27649.1|791389_792064_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.5	6.1e-36
AWC27650.1|792060_793164_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AWC27651.1|793783_795100_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
AWC27652.1|795314_795884_-|coat	spore coat protein CotJC	coat	NA	NA	NA	NA
AWC27653.1|795896_796160_-|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
AWC27654.1|796168_796384_-|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
>prophage 5
CP024098	Bacillus cytotoxicus strain CH_38 chromosome, complete genome	4215994	1109603	1177055	4215994	bacteriocin,integrase,coat	Bacillus_phage(36.36%)	60	1170489:1170506	1177925:1177942
AWC27913.1|1109603_1110341_+|coat	spore coat protein	coat	I7I009	Enterobacteria_phage	44.7	2.8e-50
AWC27914.1|1110349_1110898_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A218MN57	uncultured_virus	43.2	1.7e-31
AWC27915.1|1110909_1111881_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	42.9	8.5e-71
AWC27916.1|1111892_1112744_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	40.2	9.5e-42
AWC27917.1|1112947_1113448_-	hypothetical protein	NA	NA	NA	NA	NA
AWC27918.1|1113882_1114356_-|coat	spore coat protein	coat	NA	NA	NA	NA
AWC27919.1|1114522_1116577_-	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	31.9	6.2e-79
AWC27920.1|1117102_1117621_-	hypothetical protein	NA	NA	NA	NA	NA
AWC27921.1|1117713_1118445_-	esterase family protein	NA	NA	NA	NA	NA
AWC27922.1|1118665_1119577_+	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AWC27923.1|1119797_1120187_-	hypothetical protein	NA	A0A0E3TB73	Enterococcus_phage	36.6	8.2e-09
AWC27924.1|1120358_1121825_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
AWC27925.1|1123657_1125151_+	lactate permease	NA	NA	NA	NA	NA
AWC27926.1|1125255_1125939_+	DUF2278 domain-containing protein	NA	NA	NA	NA	NA
AWC27927.1|1125985_1126819_-	hypothetical protein	NA	NA	NA	NA	NA
AWC27928.1|1126947_1127694_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
AWC27929.1|1127868_1129203_+	CoA-disulfide reductase	NA	NA	NA	NA	NA
AWC27930.1|1129331_1129742_+	DUF3908 domain-containing protein	NA	NA	NA	NA	NA
AWC27931.1|1129955_1131500_-	NADH oxidase	NA	NA	NA	NA	NA
AWC27932.1|1131560_1133513_-|bacteriocin	bacteriocin biosynthesis protein SagD	bacteriocin	NA	NA	NA	NA
AWC27933.1|1133506_1135432_-|bacteriocin	putative thiazole-containing bacteriocin maturation protein	bacteriocin	NA	NA	NA	NA
AWC27934.1|1135590_1136835_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
AWC27935.1|1136955_1139832_-	2-oxoglutarate dehydrogenase subunit E1	NA	NA	NA	NA	NA
AWC27936.1|1140800_1140983_+	DUF3976 domain-containing protein	NA	NA	NA	NA	NA
AWC27937.1|1141044_1141929_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWC27938.1|1142115_1143042_+	2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase	NA	NA	NA	NA	NA
AWC27939.1|1143111_1144635_+	5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AWC27940.1|1144688_1146161_+	4-hydroxyphenylacetate 3-monooxygenase, oxygenase component	NA	NA	NA	NA	NA
AWC27941.1|1146180_1147164_+	3,4-dihydroxyphenylacetate 2,3-dioxygenase	NA	NA	NA	NA	NA
AWC27942.1|1147221_1148088_+	cytidyltransferase	NA	NA	NA	NA	NA
AWC27943.1|1148148_1148478_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
AWC27944.1|1148467_1150018_+	cation acetate symporter	NA	NA	NA	NA	NA
AWC27945.1|1150038_1150830_+	4-hydroxyphenylacetate isomerase	NA	NA	NA	NA	NA
AWC27946.1|1150826_1151585_+	2-hydroxyhepta-2,4-diene-1,7-dioate isomerase	NA	NA	NA	NA	NA
AWC27947.1|1151657_1152056_+	5-carboxymethyl-2-hydroxymuconate isomerase	NA	NA	NA	NA	NA
AWC27948.1|1152374_1153487_+	tetratricopeptide repeat-containing protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	49.1	2.4e-93
AWC27949.1|1154137_1154506_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AWC27950.1|1155330_1155537_+	hypothetical protein	NA	NA	NA	NA	NA
AWC27951.1|1156187_1156505_+	DUF3884 domain-containing protein	NA	NA	NA	NA	NA
AWC30790.1|1158063_1158540_+	hypothetical protein	NA	NA	NA	NA	NA
AWC27952.1|1158562_1158970_+	hypothetical protein	NA	NA	NA	NA	NA
AWC27953.1|1160377_1160653_-	hypothetical protein	NA	NA	NA	NA	NA
AWC27954.1|1161650_1162571_-	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AWC27955.1|1162770_1162998_-	hypothetical protein	NA	NA	NA	NA	NA
AWC27956.1|1163047_1163308_-	hypothetical protein	NA	NA	NA	NA	NA
AWC27957.1|1163443_1163698_+	hypothetical protein	NA	NA	NA	NA	NA
AWC27958.1|1164204_1164858_+	hypothetical protein	NA	NA	NA	NA	NA
AWC27959.1|1165055_1165331_+	hypothetical protein	NA	NA	NA	NA	NA
AWC27960.1|1165648_1166743_-	tetratricopeptide repeat-containing protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	51.8	1.2e-100
AWC27961.1|1167005_1167377_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	54.4	2.1e-25
AWC27962.1|1167894_1168599_-	hypothetical protein	NA	NA	NA	NA	NA
AWC27963.1|1168983_1169157_-	hypothetical protein	NA	NA	NA	NA	NA
AWC27964.1|1169163_1169463_-	hypothetical protein	NA	NA	NA	NA	NA
AWC27965.1|1169508_1169742_-	TIGR04197 family type VII secretion effector	NA	NA	NA	NA	NA
1170489:1170506	attL	GTGACCAATATGTGACCA	NA	NA	NA	NA
AWC27966.1|1170517_1172224_-	hypothetical protein	NA	NA	NA	NA	NA
AWC27967.1|1172292_1173414_-	DUF4297 domain-containing protein	NA	NA	NA	NA	NA
AWC27968.1|1173536_1174238_-	hypothetical protein	NA	NA	NA	NA	NA
AWC27969.1|1174656_1175733_+	replication initiation factor	NA	NA	NA	NA	NA
AWC27970.1|1175747_1175945_+	DNA-binding protein	NA	A0A1B0T6C2	Bacillus_phage	41.2	4.3e-06
AWC27971.1|1175945_1177055_+|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	40.9	2.6e-60
1177925:1177942	attR	GTGACCAATATGTGACCA	NA	NA	NA	NA
>prophage 6
CP024098	Bacillus cytotoxicus strain CH_38 chromosome, complete genome	4215994	2353167	2421143	4215994	bacteriocin,tail,integrase,holin,transposase	Bacillus_phage(36.84%)	56	2348333:2348349	2382143:2382159
2348333:2348349	attL	TCCTTCTGCATCTAATA	NA	NA	NA	NA
AWC29016.1|2353167_2354315_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	66.4	1.8e-99
AWC29017.1|2354591_2356760_-|bacteriocin	bacteriocin-associated protein	bacteriocin	NA	NA	NA	NA
AWC29018.1|2356883_2357072_-	hypothetical protein	NA	NA	NA	NA	NA
AWC29019.1|2357056_2357326_-	hypothetical protein	NA	NA	NA	NA	NA
AWC29020.1|2358048_2358402_+|integrase	integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	34.1	6.5e-05
AWC29021.1|2358422_2358671_-	DUF4176 domain-containing protein	NA	NA	NA	NA	NA
AWC29022.1|2358671_2358860_-	hypothetical protein	NA	NA	NA	NA	NA
AWC29023.1|2358890_2359082_-	hypothetical protein	NA	NA	NA	NA	NA
AWC29024.1|2360369_2360732_-	DUF3958 domain-containing protein	NA	NA	NA	NA	NA
AWC29025.1|2360772_2361048_-	TIGR04197 family type VII secretion effector	NA	NA	NA	NA	NA
AWC29026.1|2361752_2364323_-	permease	NA	NA	NA	NA	NA
AWC29027.1|2364340_2365087_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	5.0e-31
AWC29028.1|2365452_2365776_-	hypothetical protein	NA	NA	NA	NA	NA
AWC29029.1|2365783_2366308_-	hypothetical protein	NA	NA	NA	NA	NA
AWC29030.1|2368441_2368825_-	hypothetical protein	NA	NA	NA	NA	NA
AWC29031.1|2369113_2369839_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	37.8	1.3e-36
AWC29032.1|2370403_2370592_-	transcriptional regulator	NA	S5M643	Brevibacillus_phage	42.4	3.7e-07
AWC29033.1|2370581_2370905_-	hypothetical protein	NA	NA	NA	NA	NA
AWC29034.1|2372161_2373142_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
AWC29035.1|2373204_2373453_-	hypothetical protein	NA	A0A288WFY7	Bacillus_phage	46.2	3.9e-12
AWC29036.1|2373725_2374775_-	oxidoreductase	NA	NA	NA	NA	NA
AWC29037.1|2375257_2375656_+	DUF2871 domain-containing protein	NA	NA	NA	NA	NA
AWC29038.1|2376554_2376815_-	DUF2642 domain-containing protein	NA	NA	NA	NA	NA
AWC29039.1|2376954_2377617_-	bacillithiol biosynthesis deacetylase BshB2	NA	NA	NA	NA	NA
AWC29040.1|2377632_2377983_-	DUF1806 domain-containing protein	NA	NA	NA	NA	NA
AWC29041.1|2378224_2379550_+	hypothetical protein	NA	NA	NA	NA	NA
AWC29042.1|2379889_2380417_-	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	66.3	4.8e-60
AWC29043.1|2380423_2382325_-	mannonate oxidoreductase	NA	F2Y0V3	Organic_Lake_phycodnavirus	25.0	3.4e-15
2382143:2382159	attR	TCCTTCTGCATCTAATA	NA	NA	NA	NA
AWC29044.1|2382877_2383669_+	arylamine N-acetyltransferase	NA	NA	NA	NA	NA
AWC29045.1|2383797_2385585_+	oligoendopeptidase F	NA	NA	NA	NA	NA
AWC29046.1|2385770_2387003_-	MFS transporter	NA	NA	NA	NA	NA
AWC29047.1|2387106_2387970_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWC29048.1|2388137_2389196_+	acyltransferase	NA	NA	NA	NA	NA
AWC29049.1|2389240_2390185_-	glycerophosphodiester phosphodiesterase	NA	A0A076G4Q2	Staphylococcus_phage	35.0	2.4e-38
AWC29050.1|2390663_2391206_-	N-acetyltransferase	NA	NA	NA	NA	NA
AWC29051.1|2391456_2391870_-	hypothetical protein	NA	NA	NA	NA	NA
AWC29052.1|2392412_2393261_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	47.9	1.4e-08
AWC29053.1|2393679_2394318_-	hypothetical protein	NA	NA	NA	NA	NA
AWC29054.1|2394344_2395157_-	hypothetical protein	NA	NA	NA	NA	NA
AWC29055.1|2395638_2397018_+	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	35.7	1.4e-21
AWC29056.1|2397171_2398842_-	peptidase M4 family protein	NA	NA	NA	NA	NA
AWC29057.1|2399491_2400967_+	SELO family protein	NA	A0A075BSJ0	Microcystis_phage	30.7	3.4e-47
AWC29058.1|2401082_2402468_-	2-hydroxy-acid oxidase	NA	NA	NA	NA	NA
AWC29059.1|2402892_2403570_-	methyltransferase	NA	G3MA03	Bacillus_virus	43.3	8.1e-20
AWC29060.1|2404385_2405297_-	hypothetical protein	NA	NA	NA	NA	NA
AWC29061.1|2405702_2406050_+	hypothetical protein	NA	NA	NA	NA	NA
AWC29062.1|2406191_2407268_+	hypothetical protein	NA	NA	NA	NA	NA
AWC29063.1|2408538_2408871_-	hypothetical protein	NA	NA	NA	NA	NA
AWC29064.1|2409040_2409253_+	XRE family transcriptional regulator	NA	A0A076G7N2	Bacillus_phage	51.5	9.0e-10
AWC29065.1|2409352_2409937_+	hypothetical protein	NA	NA	NA	NA	NA
AWC29066.1|2409977_2410802_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4J966	uncultured_Caudovirales_phage	51.1	7.2e-79
AWC29067.1|2410817_2411048_-|holin	phage holin	holin	A0A0S2MVE8	Bacillus_phage	73.3	4.1e-24
AWC29068.1|2411062_2411347_-	hypothetical protein	NA	NA	NA	NA	NA
AWC29069.1|2411386_2415883_-	hypothetical protein	NA	A0A0M4RER0	Bacillus_phage	45.3	2.8e-262
AWC29070.1|2415882_2417385_-|tail	phage tail protein	tail	A0A1B1P7W7	Bacillus_phage	73.9	5.0e-203
AWC29071.1|2417399_2421143_-|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	38.8	8.1e-53
>prophage 7
CP024098	Bacillus cytotoxicus strain CH_38 chromosome, complete genome	4215994	2429485	2442596	4215994		Bacillus_phage(41.67%)	17	NA	NA
AWC29085.1|2429485_2431189_-	hypothetical protein	NA	A0A142F1L6	Bacillus_phage	50.5	2.9e-159
AWC29086.1|2431188_2431662_-	hypothetical protein	NA	NA	NA	NA	NA
AWC29087.1|2432730_2433555_-	hypothetical protein	NA	NA	NA	NA	NA
AWC29088.1|2433950_2434517_-	hypothetical protein	NA	A0A2H4J2L4	uncultured_Caudovirales_phage	45.8	9.7e-35
AWC29089.1|2434528_2434906_-	hypothetical protein	NA	A0A0N9RZI0	Paenibacillus_phage	43.1	2.0e-15
AWC29090.1|2435290_2435929_-	hypothetical protein	NA	NA	NA	NA	NA
AWC29091.1|2435940_2436174_-	glutaredoxin family protein	NA	A0A1B1P8E0	Bacillus_phage	64.5	1.2e-23
AWC29092.1|2436170_2436776_-	hypothetical protein	NA	A0A2H4JAZ2	uncultured_Caudovirales_phage	41.2	7.7e-38
AWC29093.1|2436836_2437463_-	hypothetical protein	NA	J9Q953	Bacillus_phage	43.2	1.4e-34
AWC29094.1|2437464_2438097_-	hypothetical protein	NA	NA	NA	NA	NA
AWC29095.1|2438239_2438548_-	transglycosylase	NA	A0A0K2CZP5	Paenibacillus_phage	36.9	2.6e-05
AWC29096.1|2438547_2438943_-	alpha/beta hydrolase	NA	A0A2H4IZM2	uncultured_Caudovirales_phage	68.9	6.1e-44
AWC29097.1|2439228_2439756_-	hypothetical protein	NA	A0A0N9ST03	Paenibacillus_phage	44.6	3.2e-08
AWC29098.1|2439752_2439977_-	hypothetical protein	NA	U5Q038	Bacillus_phage	70.6	8.3e-22
AWC29099.1|2439976_2441023_-	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	58.6	4.8e-88
AWC29100.1|2441036_2441192_-	hypothetical protein	NA	NA	NA	NA	NA
AWC29101.1|2442092_2442596_-	hypothetical protein	NA	A0A0A0RUN2	Bacillus_phage	47.3	3.8e-30
>prophage 8
CP024098	Bacillus cytotoxicus strain CH_38 chromosome, complete genome	4215994	2448204	2459001	4215994		uncultured_Caudovirales_phage(37.5%)	18	NA	NA
AWC29106.1|2448204_2449428_-	hypothetical protein	NA	A0A288WGM1	Bacillus_phage	47.8	9.9e-101
AWC29107.1|2449542_2449746_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWC30846.1|2449809_2449995_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWC29108.1|2450002_2451019_-	hypothetical protein	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	43.2	6.8e-71
AWC29109.1|2451045_2452389_-	DNA helicase	NA	A0A2H4IZL9	uncultured_Caudovirales_phage	55.8	7.5e-134
AWC29110.1|2452485_2452770_-	hypothetical protein	NA	A0A0H3V0M3	Geobacillus_virus	44.0	5.4e-10
AWC29111.1|2453017_2453434_-	hypothetical protein	NA	A0A0K2CNU6	Brevibacillus_phage	57.1	8.5e-12
AWC29112.1|2453454_2453706_-	hypothetical protein	NA	NA	NA	NA	NA
AWC29113.1|2453752_2454004_-	hypothetical protein	NA	NA	NA	NA	NA
AWC29114.1|2454050_2454239_-	hypothetical protein	NA	NA	NA	NA	NA
AWC29115.1|2454602_2455367_-	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	56.5	3.7e-77
AWC29116.1|2455366_2456041_-	DUF723 domain-containing protein	NA	NA	NA	NA	NA
AWC30847.1|2456056_2456443_-	hypothetical protein	NA	A0A2H4J134	uncultured_Caudovirales_phage	36.2	5.5e-13
AWC29117.1|2456448_2456781_-	hypothetical protein	NA	NA	NA	NA	NA
AWC29118.1|2456767_2456926_-	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
AWC29119.1|2457007_2457352_-	hypothetical protein	NA	NA	NA	NA	NA
AWC29120.1|2457481_2458096_-	hypothetical protein	NA	NA	NA	NA	NA
AWC29121.1|2458107_2459001_-	hypothetical protein	NA	A0A0N9RZE9	Paenibacillus_phage	30.9	5.5e-16
>prophage 9
CP024098	Bacillus cytotoxicus strain CH_38 chromosome, complete genome	4215994	2620688	2636169	4215994	integrase	Bacillus_phage(72.73%)	29	2632403:2632417	2638927:2638941
AWC29262.1|2620688_2620898_-	DNA-binding protein	NA	A0A1Z1LZP5	Bacillus_phage	62.1	1.4e-15
AWC29263.1|2621145_2621361_-	hypothetical protein	NA	NA	NA	NA	NA
AWC29264.1|2621691_2622159_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	51.8	3.5e-30
AWC30852.1|2622896_2623172_-	DNA-binding protein	NA	A0A2H4JBQ8	uncultured_Caudovirales_phage	43.2	2.0e-09
AWC29265.1|2623140_2623338_-	hypothetical protein	NA	NA	NA	NA	NA
AWC29266.1|2623411_2623603_-	hypothetical protein	NA	NA	NA	NA	NA
AWC29267.1|2623701_2624082_-	ArpU family transcriptional regulator	NA	A0A0M4R397	Bacillus_phage	84.7	4.1e-53
AWC29268.1|2624086_2624374_-	hypothetical protein	NA	A6M999	Geobacillus_virus	70.2	4.2e-34
AWC29269.1|2624403_2624604_-	hypothetical protein	NA	NA	NA	NA	NA
AWC29270.1|2624635_2624842_-	hypothetical protein	NA	NA	NA	NA	NA
AWC29271.1|2624883_2625126_-	hypothetical protein	NA	A0A0S2MV78	Bacillus_phage	73.8	9.9e-29
AWC29272.1|2625155_2625383_-	hypothetical protein	NA	A0A288WFX6	Bacillus_phage	98.7	3.5e-36
AWC29273.1|2625423_2626062_-	hypothetical protein	NA	A0A0K2CP60	Brevibacillus_phage	49.0	1.5e-52
AWC29274.1|2626093_2626297_-	hypothetical protein	NA	NA	NA	NA	NA
AWC29275.1|2626710_2627499_-	hypothetical protein	NA	A0A0M4RU33	Bacillus_phage	39.7	1.5e-28
AWC29276.1|2627491_2627680_-	hypothetical protein	NA	A0A0M4RD83	Bacillus_phage	56.7	3.6e-10
AWC29277.1|2627664_2627880_-	hypothetical protein	NA	NA	NA	NA	NA
AWC29278.1|2627890_2628763_-	DNA replication protein	NA	A0A0M4RD64	Bacillus_phage	72.0	5.6e-114
AWC29279.1|2628692_2629481_-	phage replication protein	NA	A0A0M4S6Y4	Bacillus_phage	76.8	9.6e-89
AWC29280.1|2629481_2629751_-	hypothetical protein	NA	A0A0M4S680	Bacillus_phage	83.1	5.3e-39
AWC29281.1|2629731_2630586_-	hypothetical protein	NA	Q38143	Bacillus_phage	44.6	5.4e-53
AWC29282.1|2631736_2631976_-	hypothetical protein	NA	A0A0M4S677	Bacillus_phage	77.9	2.3e-22
AWC29283.1|2632302_2632485_-	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	43.5	4.4e-05
2632403:2632417	attL	ATTTCTTTCACTTCT	NA	NA	NA	NA
AWC29284.1|2632519_2632795_-	group-specific protein	NA	S5MC08	Brevibacillus_phage	59.3	3.6e-27
AWC29285.1|2632821_2633658_-	hypothetical protein	NA	A0A0M5M1L9	Bacillus_phage	84.9	2.6e-129
AWC29286.1|2633654_2633843_-	XRE family transcriptional regulator	NA	A0A1C8E998	Bacillus_phage	83.6	2.0e-21
AWC29287.1|2634115_2634535_+	XRE family transcriptional regulator	NA	A0A1C8E9A4	Bacillus_phage	89.2	1.1e-64
AWC29288.1|2634549_2634975_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1C8E988	Bacillus_phage	92.9	1.2e-72
AWC29289.1|2635011_2636169_+|integrase	site-specific integrase	integrase	A0A0S2SXP1	Bacillus_phage	76.1	1.2e-76
2638927:2638941	attR	ATTTCTTTCACTTCT	NA	NA	NA	NA
>prophage 10
CP024098	Bacillus cytotoxicus strain CH_38 chromosome, complete genome	4215994	2817321	2891288	4215994	tail,terminase,protease,head,tRNA,capsid,holin,portal,integrase	Bacillus_phage(77.78%)	85	2848863:2848880	2898009:2898026
AWC29442.1|2817321_2820087_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L9X8	Tupanvirus	27.3	2.8e-87
AWC29443.1|2820431_2820938_-	septum formation initiator	NA	NA	NA	NA	NA
AWC29444.1|2821030_2821804_-	RNA-binding protein	NA	NA	NA	NA	NA
AWC29445.1|2821818_2822082_-	YggT family protein	NA	NA	NA	NA	NA
AWC29446.1|2822088_2822559_-	cell division protein SepF	NA	NA	NA	NA	NA
AWC29447.1|2822577_2823252_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AWC29448.1|2823258_2824068_-	laccase domain-containing protein	NA	NA	NA	NA	NA
AWC29449.1|2824185_2824464_-	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
AWC29450.1|2824727_2825507_-	RNA polymerase sporulation sigma factor SigG	NA	A0A0Y0AU18	Bacillus_phage	43.4	3.4e-46
AWC29451.1|2825698_2826418_-	RNA polymerase sporulation sigma factor SigE	NA	A0A2H4JC68	uncultured_Caudovirales_phage	42.9	2.5e-19
AWC29452.1|2826437_2827364_-	sigma-E processing peptidase SpoIIGA	NA	NA	NA	NA	NA
AWC29453.1|2827579_2828734_-	cell division protein FtsZ	NA	NA	NA	NA	NA
AWC29454.1|2828772_2830077_-	cell division protein FtsA	NA	NA	NA	NA	NA
AWC29455.1|2830477_2831245_-	cell division protein DivIB	NA	NA	NA	NA	NA
AWC30859.1|2831342_2832248_-	UDP-N-acetylenolpyruvoylglucosamine reductase	NA	NA	NA	NA	NA
AWC29456.1|2832308_2833403_-	undecaprenyldiphospho-muramoylpentapeptide beta-N- acetylglucosaminyltransferase	NA	NA	NA	NA	NA
AWC30860.1|2833587_2834679_-	stage V sporulation protein E	NA	NA	NA	NA	NA
AWC29457.1|2834770_2836126_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
AWC29458.1|2836126_2837101_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
AWC29459.1|2837123_2838599_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
AWC29460.1|2838871_2840788_-	stage V sporulation protein D	NA	NA	NA	NA	NA
AWC30861.1|2840885_2843036_-	dihydropteridine reductase	NA	NA	NA	NA	NA
AWC29461.1|2843058_2843415_-	cell division protein FtsL	NA	NA	NA	NA	NA
AWC29462.1|2843430_2844363_-	ribosomal RNA small subunit methyltransferase H	NA	NA	NA	NA	NA
AWC30862.1|2844726_2846343_-	bacillithiol biosynthesis cysteine-adding enzyme BshC	NA	NA	NA	NA	NA
AWC30863.1|2846422_2847307_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
AWC29463.1|2847608_2848082_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AWC29464.1|2848177_2848699_-	RsfA family transcriptional regulator	NA	G3MB11	Bacillus_virus	47.8	4.0e-11
2848863:2848880	attL	GCTGCCCTAAAATAGCGG	NA	NA	NA	NA
AWC29465.1|2848958_2849132_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
AWC29466.1|2849193_2849694_-	hypothetical protein	NA	NA	NA	NA	NA
AWC29467.1|2849975_2850596_-	hypothetical protein	NA	Q2LIA9	Bacillus_phage	76.8	1.0e-85
AWC29468.1|2850537_2851719_-	cell division protein FtsK	NA	Q3HKZ7	Bacillus_phage	84.5	3.0e-195
AWC29469.1|2851836_2852019_-	hypothetical protein	NA	Q2I8E2	Bacillus_phage	88.3	2.2e-20
AWC29470.1|2852015_2852324_-	hypothetical protein	NA	A0A288WG08	Bacillus_phage	78.4	3.8e-41
AWC29471.1|2852507_2852717_+	XRE family transcriptional regulator	NA	Q2I8E4	Bacillus_phage	79.4	2.7e-22
AWC29472.1|2852719_2853208_+	hypothetical protein	NA	Q3HL01	Bacillus_phage	61.7	8.1e-46
AWC29473.1|2853243_2854308_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7AQV3	Bacillus_phage	85.9	2.3e-178
AWC29474.1|2854304_2854544_-|holin	holin	holin	A0A2H4J378	uncultured_Caudovirales_phage	87.3	1.2e-29
AWC29475.1|2854543_2854780_-	hypothetical protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	78.2	1.2e-07
AWC29476.1|2854821_2858853_-	peptidase S74	NA	H0USX5	Bacillus_phage	44.9	1.7e-242
AWC29477.1|2858849_2860343_-|tail	phage tail protein	tail	A0A2H4JC38	uncultured_Caudovirales_phage	83.7	1.2e-254
AWC29478.1|2860351_2864392_-|tail	phage tail tape measure protein	tail	H0USX3	Bacillus_phage	75.1	0.0e+00
AWC29479.1|2864608_2864923_-	hypothetical protein	NA	A0A288WFU6	Bacillus_phage	70.2	1.8e-35
AWC29480.1|2864971_2865583_-|tail	phage tail protein	tail	A0A2H4J8F3	uncultured_Caudovirales_phage	94.5	8.4e-101
AWC29481.1|2865583_2865943_-	DUF3168 domain-containing protein	NA	A0A0S2GLE3	Bacillus_phage	90.8	1.4e-55
AWC29482.1|2865939_2866374_-	hypothetical protein	NA	A0A288WGB7	Bacillus_phage	84.9	8.2e-66
AWC29483.1|2866366_2866690_-|head,tail	head-tail adaptor protein	head,tail	A0A288WG18	Bacillus_phage	85.0	8.0e-50
AWC29484.1|2866686_2866977_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A288WGQ6	Bacillus_phage	88.5	3.6e-41
AWC29485.1|2866994_2868170_-|capsid	phage major capsid protein	capsid	A0A288WG01	Bacillus_phage	88.0	2.5e-186
AWC30864.1|2868211_2868784_-|head,protease	HK97 family phage prohead protease	head,protease	Q2I8F8	Bacillus_phage	91.1	1.3e-95
AWC29486.1|2868773_2870084_-|portal	phage portal protein	portal	Q2LIC9	Bacillus_phage	89.2	6.4e-215
AWC29487.1|2870099_2871797_-|terminase	terminase large subunit	terminase	A0A288WFW5	Bacillus_phage	91.7	0.0e+00
AWC29488.1|2871793_2872276_-|terminase	phage terminase small subunit P27 family	terminase	Q2I8G1	Bacillus_phage	92.5	1.4e-74
AWC29489.1|2872375_2872759_-	HNH endonuclease	NA	Q2I8B2	Bacillus_phage	90.6	2.2e-62
AWC29490.1|2872824_2873064_-	hypothetical protein	NA	NA	NA	NA	NA
AWC29491.1|2873730_2873985_-	hypothetical protein	NA	A0A288WG25	Bacillus_phage	73.8	2.5e-30
AWC29492.1|2874004_2874196_-	hypothetical protein	NA	A0A288WFV5	Bacillus_phage	88.9	1.7e-23
AWC29493.1|2874201_2874420_-	hypothetical protein	NA	D2XR60	Bacillus_phage	73.6	3.3e-23
AWC29494.1|2874714_2875092_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	39.7	1.0e-16
AWC30865.1|2875149_2875470_-	hypothetical protein	NA	NA	NA	NA	NA
AWC30866.1|2875510_2875738_-	hypothetical protein	NA	A0A288WFX6	Bacillus_phage	68.0	2.2e-22
AWC29495.1|2875783_2876329_-	hypothetical protein	NA	A0A1I9S5V4	Bacillus_phage	78.0	3.5e-66
AWC29496.1|2876389_2876653_-	hypothetical protein	NA	NA	NA	NA	NA
AWC29497.1|2877413_2877812_-	hypothetical protein	NA	NA	NA	NA	NA
AWC29498.1|2877820_2878711_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
AWC29499.1|2878781_2879492_-	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
AWC29500.1|2879511_2879925_-	DUF1064 domain-containing protein	NA	A0A2P1JTY5	Anoxybacillus_phage	58.5	1.2e-34
AWC29501.1|2879917_2880412_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	A0A1B1P8C0	Bacillus_phage	70.6	3.2e-58
AWC29502.1|2880628_2881081_-	MFS transporter	NA	A0A0A7AQW3	Bacillus_phage	43.4	3.3e-33
AWC29503.1|2881095_2881578_-	hypothetical protein	NA	NA	NA	NA	NA
AWC29504.1|2881558_2881753_-	hypothetical protein	NA	NA	NA	NA	NA
AWC30867.1|2881758_2882451_-	DNA replication protein	NA	A0A0S2GLK2	Bacillus_phage	50.6	7.9e-63
AWC29505.1|2882521_2883487_-	DnaD domain protein	NA	H0USU2	Bacillus_phage	51.9	9.7e-43
AWC29506.1|2883661_2884468_-	recombinase RecT	NA	S6AVW6	Thermus_phage	66.9	3.4e-97
AWC29507.1|2884467_2884707_-	hypothetical protein	NA	NA	NA	NA	NA
AWC29508.1|2884721_2885657_-	hypothetical protein	NA	S6C475	Thermus_phage	59.5	1.9e-99
AWC29509.1|2885738_2885954_-	hypothetical protein	NA	NA	NA	NA	NA
AWC30868.1|2886129_2886423_-	hypothetical protein	NA	A0A0S2GLB6	Bacillus_phage	62.4	1.7e-27
AWC29510.1|2886430_2886751_-	hypothetical protein	NA	NA	NA	NA	NA
AWC29511.1|2886898_2887108_-	DNA-binding protein	NA	A0A0U4IIS1	Bacillus_phage	50.9	4.4e-09
AWC30869.1|2887230_2887440_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWC29512.1|2887605_2887944_+	XRE family transcriptional regulator	NA	H0UST7	Bacillus_phage	53.3	1.3e-21
AWC29513.1|2888225_2888360_-	hypothetical protein	NA	NA	NA	NA	NA
AWC29514.1|2888373_2889471_-	hypothetical protein	NA	NA	NA	NA	NA
AWC29515.1|2890157_2891288_+|integrase	site-specific integrase	integrase	A0A0U4JNS1	Bacillus_phage	37.4	1.7e-62
2898009:2898026	attR	CCGCTATTTTAGGGCAGC	NA	NA	NA	NA
>prophage 1
CP024100	Bacillus cytotoxicus strain CH_38 plasmid pCh38_83, complete sequence	83528	52014	59268	83528	integrase	Bacillus_phage(33.33%)	8	46122:46137	62330:62345
46122:46137	attL	AAATGGATTAATGAAA	NA	NA	NA	NA
AWC31016.1|52014_52734_-	DNA (cytosine-5-)-methyltransferase	NA	A0A1I9KKE7	Lactobacillus_phage	52.0	7.4e-64
AWC31017.1|53287_53887_-	hypothetical protein	NA	A0A1Z1LZN4	Bacillus_phage	35.6	5.1e-10
AWC31018.1|54116_54323_-	hypothetical protein	NA	NA	NA	NA	NA
AWC31019.1|55525_56140_+	DNA recombinase	NA	A0A1V0E035	Clostridioides_phage	32.5	7.1e-15
AWC31020.1|56256_57213_+|integrase	integrase	integrase	A0A1B1P793	Bacillus_phage	34.3	1.2e-37
AWC31021.1|57656_57995_+	hypothetical protein	NA	NA	NA	NA	NA
AWC31022.1|58033_58219_+	DNA-binding protein	NA	A6M9A5	Geobacillus_virus	64.9	6.8e-14
AWC31023.1|58695_59268_-	hypothetical protein	NA	A0A0K2SUB9	Clostridium_phage	44.4	3.3e-14
62330:62345	attR	TTTCATTAATCCATTT	NA	NA	NA	NA
