The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP022070	Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_321 chromosome, complete genome	4884508	96684	140993	4884508	portal,coat,tail,holin,protease,terminase,lysis,integrase	Enterobacteria_phage(69.23%)	66	88374:88390	150208:150224
88374:88390	attL	ACGCGAATTTCAATATC	NA	NA	NA	NA
AVV29034.1|96684_96864_-	hypothetical protein	NA	M1E3P7	Enterobacteria_phage	92.3	4.3e-13
ASE76614.1|96980_97343_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
ASE76615.1|97339_98272_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
ASE76616.1|98261_99719_+	hypothetical protein	NA	A8CG94	Salmonella_phage	100.0	1.3e-240
ASE76617.1|99777_101781_-	endorhamnosidase	NA	Q76H47	Enterobacteria_phage	100.0	0.0e+00
ASE76618.1|101916_102165_+	Arc family DNA-binding protein	NA	Q76H48	Enterobacteria_phage	100.0	1.8e-38
ASE76619.2|102185_102479_-	hypothetical protein	NA	Q76H12	Enterobacteria_phage	100.0	3.2e-50
ASE76620.1|102617_104594_-	DNA transfer protein	NA	Q76H13	Enterobacteria_phage	100.0	0.0e+00
ASE76621.1|104593_106030_-	DNA transfer protein	NA	Q76H14	Enterobacteria_phage	100.0	7.7e-246
ASE76622.1|106040_106730_-	DNA transfer protein	NA	A0A2H5BFK5	Salmonella_phage	100.0	2.9e-118
ASE76623.1|106732_107188_-	hypothetical protein	NA	E7C9U3	Salmonella_phage	99.3	5.2e-87
AVV29035.1|107187_107826_-|tail	phage tail protein	tail	A8CGD2	Salmonella_phage	100.0	6.3e-91
ASE76624.1|107829_109248_-	hypothetical protein	NA	A0A220NQZ5	Salmonella_phage	100.0	4.9e-277
ASE76625.1|109207_109708_-	hypothetical protein	NA	I6RSF6	Salmonella_phage	99.4	3.2e-90
ASE76626.1|109691_110252_-	hypothetical protein	NA	C6ZR11	Salmonella_phage	100.0	9.8e-104
ASE76627.1|110292_111585_-|coat	coat protein	coat	Q76H21	Enterobacteria_phage	100.0	1.1e-243
ASE76628.1|111584_112496_-	scaffolding protein	NA	Q5C834	Enterobacteria_phage	100.0	1.7e-161
ASE76629.1|112509_114687_-|portal	portal protein	portal	Q76H23	Enterobacteria_phage	100.0	0.0e+00
ASE76630.1|114686_116186_-|terminase	terminase	terminase	Q5C836	Enterobacteria_phage	100.0	1.7e-307
ASE76631.1|116163_116652_-	DNA-packaging protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
ASE76632.1|116655_117060_-	Decoration protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
ASE76633.1|117059_117449_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
ASE80847.1|117452_117695_-	DUF2560 domain-containing protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
ASE76634.1|117990_118443_-|lysis	lysis protein	lysis	E7C9T0	Salmonella_phage	100.0	5.0e-74
ASE76635.1|118439_118838_-	M15 family peptidase	NA	E7C9S9	Salmonella_phage	100.0	1.1e-69
ASE76636.1|118824_119142_-|holin	holin	holin	E7C9S8	Salmonella_phage	100.0	1.1e-54
ASE76637.1|119541_120060_-	DUF1133 domain-containing protein	NA	A0A192Y911	Salmonella_phage	100.0	9.0e-96
ASE76638.1|120056_120236_-	hypothetical protein	NA	A0A192Y814	Salmonella_phage	98.3	1.2e-23
ASE76639.1|120216_120420_-	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
ASE76640.1|120416_120641_-	protein ninY	NA	Q76H69	Enterobacteria_phage	100.0	6.3e-38
ASE76641.1|120637_121249_-	recombination protein NinG	NA	Q76H70	Enterobacteria_phage	100.0	7.9e-99
ASE76642.1|121241_121418_-	protein ninF	NA	Q76H71	Enterobacteria_phage	100.0	6.7e-27
ASE76643.1|121410_121752_-	DUF2591 domain-containing protein	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
ASE76644.1|121754_121931_-	NinE family protein	NA	Q76H73	Enterobacteria_phage	100.0	1.0e-27
ASE76645.1|121897_122071_-	protein ninD	NA	Q76H74	Enterobacteria_phage	100.0	2.3e-32
ASE76646.1|122067_122523_-	recombination protein NinB	NA	Q76H49	Enterobacteria_phage	100.0	4.7e-80
ASE76647.1|122578_122848_-	hypothetical protein	NA	Q76H50	Enterobacteria_phage	100.0	4.9e-45
ASE76648.1|122844_124221_-	replicative DNA helicase	NA	Q76H51	Enterobacteria_phage	100.0	1.9e-254
ASE76649.1|124217_125039_-	replication of DNA	NA	Q76H52	Enterobacteria_phage	100.0	5.2e-154
ASE76650.1|125221_125503_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
ASE76651.1|125613_125829_-	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
ASE76652.1|125939_126629_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
ASE76653.1|126793_127873_+	hypothetical protein	NA	A0A192Y6S0	Salmonella_phage	100.0	1.5e-193
ASE76654.1|127911_128115_-	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	100.0	2.0e-27
ASE76655.1|128478_128781_+	regulator	NA	Q76H58	Enterobacteria_phage	100.0	9.7e-50
ASE76656.1|128793_129381_-	superinfection exclusion protein B	NA	Q76H59	Enterobacteria_phage	100.0	1.4e-100
ASE76657.1|129594_129789_+	restriction endonuclease	NA	Q76H34	Enterobacteria_phage	100.0	1.9e-30
ASE80848.1|129929_130592_+	pentapeptide repeat-containing protein	NA	Q76H35	Enterobacteria_phage	100.0	1.8e-43
ASE76658.1|130625_130913_+	hypothetical protein	NA	Q76H36	Enterobacteria_phage	100.0	2.7e-49
ASE76659.1|131188_131503_+	superinfection exclusion protein	NA	Q76H37	Enterobacteria_phage	100.0	1.5e-56
ASE76660.1|131587_131746_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
ASE76661.1|131726_131915_+	protein kil	NA	I6S647	Salmonella_phage	100.0	3.7e-31
ASE76662.1|132044_132752_+	recombinase	NA	Q76H40	Enterobacteria_phage	100.0	3.1e-139
ASE76663.1|132751_133036_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
ASE76664.1|133082_133376_+	RecBCD nuclease inhibitor	NA	Q76H42	Enterobacteria_phage	100.0	1.4e-48
ASE76665.1|133386_133557_+	DUF2737 domain-containing protein	NA	Q76H43	Enterobacteria_phage	100.0	1.6e-25
ASE76666.1|133553_134063_+	hypothetical protein	NA	Q76H44	Enterobacteria_phage	100.0	2.8e-89
ASE76667.1|134059_134293_+	hypothetical protein	NA	NA	NA	NA	NA
ASE76668.1|134279_134924_+	DUF551 domain-containing protein	NA	Q76H45	Enterobacteria_phage	99.5	1.4e-122
AVV29036.1|134923_135208_+	DUF4752 domain-containing protein	NA	Q76H46	Enterobacteria_phage	100.0	1.6e-49
ASE76669.1|135200_135485_+	ASCH domain-containing protein	NA	Q76H28	Enterobacteria_phage	100.0	1.4e-50
ASE76670.1|135696_136047_+	DNA-binding protein	NA	Q76H29	Enterobacteria_phage	100.0	3.7e-61
ASE80849.1|136418_137087_+|integrase	site-specific integrase	integrase	Q76H30	Enterobacteria_phage	100.0	4.7e-129
ASE76671.1|137292_138543_-	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
AVV29037.1|138554_139658_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
ASE76672.1|139940_140993_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
150208:150224	attR	ACGCGAATTTCAATATC	NA	NA	NA	NA
>prophage 2
CP022070	Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_321 chromosome, complete genome	4884508	897211	944255	4884508	tRNA,plate,tail	Burkholderia_phage(40.91%)	50	NA	NA
ASE77297.1|897211_898210_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
ASE77298.1|898297_899608_-	conjugal transfer protein	NA	NA	NA	NA	NA
ASE77299.1|899854_900370_+	transcriptional regulator Zur	NA	NA	NA	NA	NA
ASE80878.1|900468_900678_-	CsbD family protein	NA	NA	NA	NA	NA
ASE80879.1|900699_900813_-	hypothetical protein	NA	NA	NA	NA	NA
ASE77300.1|900809_902135_-	MATE family efflux transporter	NA	NA	NA	NA	NA
ASE77301.1|902313_902922_-	LexA repressor	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
ASE77302.1|903030_903399_-	diacylglycerol kinase	NA	NA	NA	NA	NA
ASE77303.1|903569_905990_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
ASE77304.1|906088_906961_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
ASE77305.1|906974_907472_-	chorismate--pyruvate lyase	NA	NA	NA	NA	NA
ASE77306.1|907652_908570_-	maltose operon protein MalM	NA	NA	NA	NA	NA
ASE77307.1|908733_910092_-	maltoporin	NA	NA	NA	NA	NA
ASE77308.1|910180_911290_-	maltose/maltodextrin import ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
ASE77309.1|911651_912842_+	maltose-binding periplasmic protein	NA	NA	NA	NA	NA
ASE77310.1|912973_914518_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
ASE77311.1|914532_915423_+	maltose ABC transporter permease	NA	NA	NA	NA	NA
ASE77312.1|915588_915999_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
ASE77313.1|916141_918238_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
ASE77314.1|918237_918975_-	hypothetical protein	NA	NA	NA	NA	NA
ASE77315.1|918971_919610_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
ASE77316.1|919673_919916_-	outer membrane protein	NA	NA	NA	NA	NA
ASE77317.1|920359_922009_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
ASE77318.1|922353_923703_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
ASE77319.1|923835_924183_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
ASE77320.1|924758_925046_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
ASE77321.1|925048_925654_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	3.2e-60
ASE77322.1|925666_925981_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
ASE77323.1|926140_926596_+	hypothetical protein	NA	NA	NA	NA	NA
ASE77324.1|926592_926790_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
ASE77325.1|926779_928207_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
ASE77326.1|928206_928731_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
ASE77327.1|928782_929100_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
ASE77328.1|929059_929188_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
ASE77329.1|929284_931639_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	6.9e-66
ASE77330.1|931638_932592_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
ASE77331.1|932591_932801_+	hypothetical protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
ASE77332.1|932788_933832_+	phage protein D	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
ASE77333.1|933841_934564_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
ASE77334.1|934891_935254_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
ASE77335.1|935250_936180_+	glycosyltransferase	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
ASE77336.1|936179_937727_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
ASE77337.1|937890_938250_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
ASE77338.1|938240_939356_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
ASE77339.1|939348_939981_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
ASE77340.1|939983_941729_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	7.1e-52
ASE77341.1|941733_942339_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
ASE77342.1|942335_942791_+	hypothetical protein	NA	NA	NA	NA	NA
ASE77343.1|943039_943330_+	hypothetical protein	NA	NA	NA	NA	NA
AVV29074.1|943526_944255_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 3
CP022070	Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_321 chromosome, complete genome	4884508	2525384	2537070	4884508	integrase,tail	Salmonella_virus(46.15%)	14	2524280:2524294	2537240:2537254
2524280:2524294	attL	CCCGTCGTGAAGCCA	NA	NA	NA	NA
ASE78691.1|2525384_2525870_-|tail	phage tail protein	tail	O80317	Escherichia_phage	91.9	1.1e-79
ASE78693.1|2528735_2529257_-	hypothetical protein	NA	Q6K1F4	Salmonella_virus	100.0	1.2e-92
ASE78694.1|2529253_2529478_-	hypothetical protein	NA	Q6K1F5	Salmonella_virus	98.6	1.1e-34
ASE78695.1|2529477_2529705_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	98.7	2.6e-31
ASE78696.1|2529772_2530111_-	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	92.9	2.3e-52
ASE78697.1|2530074_2530275_-	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	92.4	9.6e-30
ASE78698.1|2530282_2530792_-	hypothetical protein	NA	Q6K1F8	Salmonella_virus	98.8	3.6e-89
ASE78699.1|2530842_2531196_-	Cro/Cl family transcriptional regulator	NA	Q6K1F9	Salmonella_virus	100.0	2.3e-58
ASE78700.1|2531309_2532155_+	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	73.7	4.9e-115
ASE78701.1|2532163_2532502_+	DUF2511 domain-containing protein	NA	A0A0M3ULF8	Salmonella_phage	72.1	1.4e-41
ASE78702.1|2532526_2533576_+|integrase	integrase	integrase	A0A0M4S6G4	Salmonella_phage	90.3	5.4e-188
ASE78703.1|2533828_2535049_-	diguanylate cyclase	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
ASE78704.1|2535041_2535560_-	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
ASE78705.1|2535999_2537070_+	phospho-2-dehydro-3-deoxyheptonate aldolase Tyr-sensitive	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
2537240:2537254	attR	TGGCTTCACGACGGG	NA	NA	NA	NA
>prophage 4
CP022070	Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_321 chromosome, complete genome	4884508	2560177	2636845	4884508	portal,transposase,tRNA,head,tail,holin,protease,capsid,terminase,lysis,integrase	Salmonella_phage(37.93%)	95	2552258:2552274	2642692:2642708
2552258:2552274	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
ASE78721.1|2560177_2561215_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
ASE78722.1|2561330_2562020_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
ASE78723.1|2562338_2562722_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
ASE78724.1|2562783_2563371_-	cysteine/O-acetylserine efflux protein	NA	NA	NA	NA	NA
ASE80951.1|2563473_2564373_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
ASE78725.1|2564390_2565725_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
ASE78726.1|2565855_2566593_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase	tRNA	NA	NA	NA	NA
ASE78727.1|2566577_2568200_-	L-aspartate oxidase	NA	NA	NA	NA	NA
ASE78728.1|2568284_2568464_+	hypothetical protein	NA	NA	NA	NA	NA
ASE78729.1|2568624_2569200_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
ASE78730.1|2569231_2569882_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
ASE78731.1|2569881_2570838_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
ASE78732.1|2570834_2571314_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
ASE78733.1|2571343_2571460_+	transcriptional regulator	NA	NA	NA	NA	NA
ASE78734.1|2571811_2573041_+|integrase	integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
ASE78735.1|2573018_2573303_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
ASE78736.1|2573343_2573583_-	DUF4060 domain-containing protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
ASE78737.1|2573625_2574783_-	enterohemolysin	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
ASE78738.1|2574745_2577673_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.2	0.0e+00
ASE78739.1|2577799_2578150_-	DNA breaking-rejoining protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
ASE78740.1|2578171_2578330_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
ASE78741.1|2578786_2579449_-	hypothetical protein	NA	NA	NA	NA	NA
ASE78742.1|2579448_2579835_-	hypothetical protein	NA	NA	NA	NA	NA
ASE78743.1|2579827_2580667_-	chromosome partitioning protein ParA	NA	A0A1X9IGI7	Lactococcus_phage	33.3	1.5e-31
ASE78744.1|2580725_2581121_-	transcriptional regulator	NA	K7PM35	Enterobacteria_phage	61.4	1.9e-37
ASE78745.1|2581220_2581463_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	64.1	2.1e-23
ASE78746.1|2581422_2581797_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
AVV29166.1|2581888_2582725_+	replication protein	NA	K7PGT1	Enterobacteria_phage	48.5	4.6e-49
ASE78747.1|2582721_2583417_+	phage replication protein	NA	G8C7U6	Escherichia_phage	45.4	2.1e-55
ASE78748.1|2583430_2584129_+	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	85.7	2.1e-63
ASE78749.1|2584236_2584869_+	hypothetical protein	NA	NA	NA	NA	NA
ASE78750.1|2585111_2585345_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
ASE78751.1|2585461_2585710_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
ASE78752.1|2585744_2586347_+	hypothetical protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
ASE78753.1|2586346_2586553_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	97.1	1.7e-34
ASE78754.1|2586555_2587167_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
ASE78755.1|2587163_2587304_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
ASE78756.1|2587300_2587978_+	antiterminator	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
ASE78757.1|2587974_2588160_+	hypothetical protein	NA	NA	NA	NA	NA
ASE78758.1|2588250_2588814_+	hypothetical protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
ASE78759.1|2589320_2589509_+	hypothetical protein	NA	NA	NA	NA	NA
ASE78760.1|2589723_2590410_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
ASE80952.1|2590685_2591015_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
ASE78761.1|2590998_2591451_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	1.0e-79
ASE80953.1|2591468_2591921_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
ASE78762.1|2592156_2592558_-	inhibitor of g-type lysozyme	NA	NA	NA	NA	NA
AVV29167.1|2592592_2592787_+	hypothetical protein	NA	NA	NA	NA	NA
ASE78763.2|2592844_2593390_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
ASE78764.1|2593361_2595293_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
AVV29168.1|2595276_2595480_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
ASE78765.1|2595568_2597056_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	63.3	5.8e-180
ASE78766.1|2597045_2598542_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
ASE78767.1|2598554_2598902_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
ASE78768.1|2598956_2599985_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
ASE78769.1|2600042_2600402_+	DNA packaging protein	NA	NA	NA	NA	NA
ASE78770.1|2600412_2600796_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
ASE78771.1|2600823_2601402_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
ASE78772.2|2601450_2602581_-|transposase	transposase	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
ASE78773.1|2602689_2603091_+|tail	phage tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
ASE78774.1|2603098_2603845_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
ASE78775.1|2603895_2604291_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
ASE78776.1|2604287_2604626_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
ASE78777.1|2604597_2607693_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	1.7e-274
ASE78778.1|2607695_2608025_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
ASE78779.1|2608034_2608733_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
ASE78780.1|2608739_2609477_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	3.0e-129
ASE78781.1|2609374_2610022_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
ASE78782.1|2610083_2613446_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
ASE78783.1|2613484_2613727_+	hypothetical protein	NA	NA	NA	NA	NA
ASE78784.1|2613780_2616153_+|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	68.6	5.6e-92
ASE78785.1|2616149_2616974_+|tail	phage tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
ASE78786.1|2616963_2617542_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
AVV29169.1|2617638_2617866_-	phage virulence factor	NA	NA	NA	NA	NA
ASE78787.1|2617972_2618185_+	hypothetical protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
AVV29322.1|2618247_2618313_+	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
AVV29170.1|2618892_2619057_+|integrase	integrase	integrase	NA	NA	NA	NA
ASE78788.1|2618977_2619523_-|transposase	transposase	transposase	NA	NA	NA	NA
ASE78789.1|2619769_2619907_-	hypothetical protein	NA	NA	NA	NA	NA
AVV29171.1|2620367_2621861_-	type III secretion system protein	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
ASE78790.1|2622265_2624065_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
ASE78791.1|2624081_2625056_+	S26 family signal peptidase	NA	NA	NA	NA	NA
ASE78792.1|2625329_2626010_+	ribonuclease 3	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
ASE78793.1|2626006_2626912_+	GTPase Era	NA	NA	NA	NA	NA
ASE78794.1|2626923_2627652_+	DNA repair protein RecO	NA	NA	NA	NA	NA
ASE78795.1|2627663_2628395_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
ASE78796.1|2628394_2628775_+	holo-ACP synthase	NA	NA	NA	NA	NA
ASE78797.1|2628886_2629147_-	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
ASE78798.1|2629184_2630111_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
AVV29172.1|2630226_2631423_+	MFS transporter	NA	NA	NA	NA	NA
ASE78799.1|2631444_2632362_+	oxidoreductase	NA	NA	NA	NA	NA
ASE78800.1|2632400_2633249_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
ASE78801.1|2633364_2634258_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
ASE78802.1|2634268_2635630_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
ASE78803.1|2635633_2636269_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
ASE78804.1|2636293_2636845_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
2642692:2642708	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 5
CP022070	Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_321 chromosome, complete genome	4884508	3007585	3019876	4884508	holin,tail	Salmonella_phage(45.45%)	11	NA	NA
AVV29189.1|3007585_3009952_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
ASE80963.1|3010280_3011270_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
ASE79118.1|3011284_3011653_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
ASE79119.1|3011681_3013013_-	NTPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
ASE79120.1|3013309_3013639_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
ASE79122.1|3014231_3015473_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
ASE79123.1|3015475_3016003_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
ASE79124.1|3016380_3016824_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
AVV29190.1|3016877_3018707_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
ASE79125.1|3019054_3019345_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
ASE79126.1|3019372_3019876_+	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 6
CP022070	Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_321 chromosome, complete genome	4884508	3091927	3101098	4884508	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
ASE79190.1|3091927_3092875_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
ASE79191.1|3092858_3093590_+	ABC transporter permease	NA	NA	NA	NA	NA
ASE79192.1|3093570_3093678_-	hypothetical protein	NA	NA	NA	NA	NA
ASE79193.1|3093737_3094469_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
ASE79194.1|3094691_3096377_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
ASE79195.1|3096373_3097093_+	DNA-binding response regulator	NA	NA	NA	NA	NA
ASE79196.1|3097139_3097607_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
ASE79197.1|3097663_3098194_-	hypothetical protein	NA	NA	NA	NA	NA
ASE79198.1|3098365_3098824_-	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
ASE79199.1|3099064_3101098_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 7
CP022070	Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_321 chromosome, complete genome	4884508	3169406	3179912	4884508		Enterobacteria_phage(37.5%)	10	NA	NA
ASE79252.1|3169406_3170810_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
ASE79253.1|3170987_3171881_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
ASE79254.1|3172257_3173343_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
ASE79255.1|3173342_3174242_+	NAD(P)-dependent oxidoreductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
ASE79256.1|3174289_3175168_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
ASE79257.1|3175168_3175720_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
AVV29201.1|3175725_3176718_+	protein RfbI	NA	NA	NA	NA	NA
ASE79258.1|3176714_3177488_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
ASE79259.1|3177492_3178572_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
ASE79260.1|3178598_3179912_+	LPS biosynthesis protein	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 8
CP022070	Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_321 chromosome, complete genome	4884508	3265906	3316659	4884508	portal,head,tail,holin,protease,capsid,plate,terminase,lysis,integrase	Salmonella_phage(89.06%)	73	3260484:3260498	3276960:3276974
3260484:3260498	attL	AATCAGCGCCTGCTG	NA	NA	NA	NA
ASE79340.1|3265906_3266380_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
ASE79341.1|3267027_3267318_-	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
ASE79342.1|3267689_3268487_-	protein MtfA	NA	NA	NA	NA	NA
ASE79343.1|3268778_3269768_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	99.4	1.2e-194
ASE79344.1|3269769_3270012_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
ASE79345.1|3270036_3270606_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
ASE79346.1|3270609_3271443_-	hypothetical protein	NA	Q8HAA7	Salmonella_phage	100.0	4.7e-163
ASE79347.1|3271439_3272057_-	hypothetical protein	NA	Q8HAA6	Salmonella_phage	100.0	2.6e-113
ASE79348.1|3272053_3272569_-	DUF262 domain-containing protein	NA	Q8HAA5	Salmonella_phage	100.0	7.4e-98
ASE79349.1|3272565_3272796_-	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
ASE79350.1|3272866_3273406_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
ASE79351.1|3273542_3274370_-	DUF2303 domain-containing protein	NA	Q8HAA2	Salmonella_phage	100.0	7.5e-153
ASE79352.1|3274427_3274799_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
ASE79353.1|3274896_3275082_+	hypothetical protein	NA	NA	NA	NA	NA
ASE79354.1|3275613_3276309_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
ASE79355.1|3276282_3276468_+	amino acid permease	NA	NA	NA	NA	NA
ASE79356.1|3276406_3276631_+	XRE family transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
ASE79357.1|3276659_3277214_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
3276960:3276974	attR	AATCAGCGCCTGCTG	NA	NA	NA	NA
ASE79358.1|3277210_3278368_+	peptidase	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
ASE79359.1|3278364_3278589_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
ASE79360.1|3278585_3279404_+	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
ASE79361.1|3279363_3279888_+	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	2.4e-96
ASE79362.1|3279887_3280781_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
ASE79363.1|3280777_3281167_+	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
ASE79364.2|3281183_3282044_+	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	100.0	2.9e-163
ASE80972.1|3282051_3283041_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	4.9e-191
AVV29207.1|3283051_3283675_+	hypothetical protein	NA	Q8HA89	Salmonella_phage	100.0	9.1e-119
ASE79365.2|3283807_3284065_+	hypothetical protein	NA	Q8HA88	Salmonella_phage	100.0	5.2e-44
ASE79366.1|3283994_3284429_-	hypothetical protein	NA	NA	NA	NA	NA
ASE79367.1|3284590_3284935_+|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
ASE79368.1|3284937_3285552_+	endolysin	NA	Q8HA86	Salmonella_phage	100.0	9.3e-116
ASE80973.2|3285548_3286034_+|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	100.0	5.9e-81
ASE79369.1|3286246_3286666_+	KilA-N domain-containing protein	NA	Q8HA84	Salmonella_phage	100.0	4.8e-71
AVV29208.1|3286885_3287188_+	hypothetical protein	NA	Q8HA83	Salmonella_phage	100.0	3.6e-52
ASE79370.1|3287248_3287599_+	HNH endonuclease	NA	Q8HA82	Salmonella_phage	100.0	2.5e-65
AVV29209.1|3287715_3288219_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	3.6e-89
ASE79371.1|3288215_3289949_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	100.0	0.0e+00
ASE79372.1|3289960_3290143_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
ASE79373.1|3290142_3291384_+|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.8	2.0e-242
ASE79374.1|3291325_3292012_+|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	6.5e-126
ASE79375.1|3292026_3293232_+|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	100.0	1.6e-223
ASE79376.1|3293282_3293483_+	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
ASE79377.1|3293485_3293809_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
ASE79378.1|3293805_3294210_+|head,tail	head-tail adaptor protein	head,tail	Q8HAC9	Salmonella_phage	100.0	1.4e-72
ASE79379.1|3294181_3294694_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
ASE79380.1|3294690_3295251_+	hypothetical protein	NA	Q8HAC7	Salmonella_phage	100.0	3.0e-105
ASE79381.1|3295254_3295419_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
ASE79382.1|3295408_3296905_+|tail	phage tail protein	tail	Q8HAC5	Salmonella_phage	100.0	2.7e-278
ASE79383.1|3296904_3297261_+|tail	phage tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
ASE79384.1|3297257_3297584_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
ASE79385.1|3297668_3299597_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.8	0.0e+00
ASE79386.1|3299630_3300971_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
ASE79387.1|3300967_3302026_+|plate	baseplate protein	plate	Q8HAC0	Salmonella_phage	100.0	1.3e-202
ASE79388.1|3302025_3302559_+|plate	phage baseplate assembly protein V	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
AVV29210.1|3302563_3302977_+	hypothetical protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
AVV29211.1|3302948_3303497_+|head	head assembly protein	head	Q8HAB7	Salmonella_phage	99.5	2.3e-97
AVV29212.1|3303531_3304053_+|tail	phage tail protein	tail	Q8HAB6	Salmonella_phage	99.4	1.5e-93
ASE79390.1|3304055_3304643_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
ASE79391.1|3304629_3306192_+|tail	phage tail protein	tail	Q8HAB4	Salmonella_phage	99.8	7.5e-287
ASE79392.2|3306191_3306761_+|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	7.3e-107
AVV29213.1|3307045_3308053_-	non-LEE encoded effector protein NleB	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
ASE79393.1|3308265_3308487_+	DNA-binding protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
AVV29214.1|3308600_3308816_-	hypothetical protein	NA	NA	NA	NA	NA
AVV29215.1|3308897_3309140_+	hypothetical protein	NA	NA	NA	NA	NA
ASE79394.1|3309117_3309279_+	hypothetical protein	NA	NA	NA	NA	NA
ASE79395.1|3309405_3309825_+	protein UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
ASE79396.1|3309827_3311096_+	protein UmuC	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
ASE79397.1|3311550_3311763_+	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
ASE80974.1|3311773_3311962_+	cold-shock protein	NA	NA	NA	NA	NA
ASE79398.1|3312222_3313419_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
ASE79399.1|3314068_3314368_+	hypothetical protein	NA	NA	NA	NA	NA
ASE79400.1|3314459_3315155_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
ASE79401.1|3315228_3316659_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 9
CP022070	Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_321 chromosome, complete genome	4884508	3420715	3450950	4884508	protease,integrase,tail	Escherichia_phage(20.0%)	39	3424586:3424600	3443073:3443087
ASE79505.1|3420715_3420946_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
ASE79506.1|3421083_3421458_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
ASE79507.1|3421458_3422334_+	hypothetical protein	NA	NA	NA	NA	NA
ASE79508.1|3422350_3422704_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
ASE80980.1|3422761_3422881_+	hypothetical protein	NA	NA	NA	NA	NA
ASE79509.2|3423086_3423941_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.4	6.1e-73
ASE80981.1|3424000_3424495_-	RecE	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
3424586:3424600	attL	CAGACATTTGCCCGC	NA	NA	NA	NA
ASE79510.2|3424684_3424915_+	lytic enzyme	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
ASE79511.1|3424968_3425502_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
ASE79512.1|3425758_3425926_-	lytic enzyme	NA	NA	NA	NA	NA
ASE79513.1|3425990_3426179_-	hypothetical protein	NA	NA	NA	NA	NA
AVV29222.1|3426651_3427533_+|tail	phage tail protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
ASE79515.1|3427629_3427830_-	phage virulence factor	NA	NA	NA	NA	NA
ASE79516.1|3428020_3428137_-|tail	phage tail protein	tail	NA	NA	NA	NA
ASE79517.1|3428399_3428525_+	arsenic transporter	NA	NA	NA	NA	NA
ASE79518.1|3428653_3428920_+	hypothetical protein	NA	NA	NA	NA	NA
AVV29223.1|3429672_3430287_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
AVV29224.1|3430296_3430455_-	hypothetical protein	NA	NA	NA	NA	NA
ASE80983.2|3430587_3431502_-	protein PagO	NA	NA	NA	NA	NA
ASE80984.1|3432119_3432320_+	hypothetical protein	NA	NA	NA	NA	NA
ASE79520.1|3432610_3432868_+	hypothetical protein	NA	NA	NA	NA	NA
ASE79521.1|3432805_3433174_-|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	39.8	5.4e-18
ASE79522.1|3434637_3434778_-	hypothetical protein	NA	NA	NA	NA	NA
ASE79523.1|3435259_3435454_+	hypothetical protein	NA	NA	NA	NA	NA
ASE79524.1|3435582_3436002_+	N-acetyltransferase	NA	NA	NA	NA	NA
ASE79525.1|3436389_3436866_-	hypothetical protein	NA	NA	NA	NA	NA
ASE79526.1|3437195_3437591_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.8	9.2e-16
ASE79527.1|3438274_3438997_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
ASE80985.2|3439281_3439446_+	hypothetical protein	NA	NA	NA	NA	NA
ASE79528.1|3439669_3440320_+	serine/threonine-protein phosphatase 1	NA	A0A222YWF0	Escherichia_phage	51.4	1.1e-58
ASE79529.1|3440338_3440530_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
ASE79530.1|3440640_3440880_-	DUF1480 domain-containing protein	NA	NA	NA	NA	NA
ASE80986.1|3440994_3442434_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
ASE79531.1|3442511_3445151_-	MCE family protein	NA	NA	NA	NA	NA
3443073:3443087	attR	GCGGGCAAATGTCTG	NA	NA	NA	NA
ASE79532.1|3445113_3446397_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
ASE79533.2|3446438_3447023_+	GAF domain-containing protein	NA	NA	NA	NA	NA
ASE79534.1|3447120_3447807_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
ASE79535.2|3447826_3449875_+|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
AVV29225.1|3450068_3450950_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 10
CP022070	Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_321 chromosome, complete genome	4884508	4216016	4300752	4884508	portal,tRNA,tail,holin,protease,terminase,lysis,integrase	Salmonella_phage(45.45%)	95	4240110:4240129	4311898:4311917
ASE80256.1|4216016_4216697_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
ASE80257.1|4217042_4217252_-	hypothetical protein	NA	NA	NA	NA	NA
ASE80258.1|4217317_4217977_+	transmembrane protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
ASE80259.1|4218063_4218393_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
ASE80260.1|4218389_4218671_-	acylphosphatase	NA	NA	NA	NA	NA
ASE80261.1|4218719_4219499_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
ASE80262.1|4219524_4220073_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
ASE80263.1|4220287_4221499_+	ribosomal RNA large subunit methyltransferase I	NA	NA	NA	NA	NA
ASE80264.1|4221556_4221874_+	heat-shock protein HspQ	NA	NA	NA	NA	NA
ASE80265.1|4221918_4222335_-	CoA-binding protein	NA	NA	NA	NA	NA
ASE80266.1|4222505_4223168_+	DUF2057 domain-containing protein	NA	NA	NA	NA	NA
ASE80267.1|4223262_4223721_+	methylglyoxal synthase	NA	NA	NA	NA	NA
ASE80268.1|4223756_4225811_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
ASE80269.1|4225934_4226381_+	YccF domain-containing protein	NA	NA	NA	NA	NA
ASE80270.1|4226399_4228553_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
ASE80271.1|4228539_4229145_-	DNA transformation protein	NA	NA	NA	NA	NA
ASE80272.1|4229361_4229871_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
ASE81018.1|4230227_4231280_+	outer membrane protein A	NA	NA	NA	NA	NA
ASE80273.1|4231351_4231804_-	macrodomain Ter protein	NA	NA	NA	NA	NA
ASE80274.1|4231989_4233750_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
ASE80275.1|4233818_4234337_+	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
ASE80276.1|4234436_4234604_-	ribosome modulation factor	NA	NA	NA	NA	NA
ASE80277.1|4234859_4235423_-	hypothetical protein	NA	NA	NA	NA	NA
ASE80278.1|4235419_4237060_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
ASE80279.1|4237064_4238318_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
ASE80280.1|4238332_4240240_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
4240110:4240129	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
ASE80281.1|4240252_4242361_-	ribosomal RNA large subunit methyltransferase K/L	NA	NA	NA	NA	NA
ASE80282.1|4242459_4243569_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
ASE80283.1|4243565_4244108_-	cell division protein ZapC	NA	NA	NA	NA	NA
AVV29267.1|4244273_4245284_-	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
ASE80284.1|4245491_4248104_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
ASE80285.1|4248530_4248722_+	DNA-damage-inducible protein I	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
ASE80286.1|4248992_4249679_+	virulence protein	NA	NA	NA	NA	NA
AVV29268.1|4249663_4249963_+	hypothetical protein	NA	NA	NA	NA	NA
ASE80287.1|4250031_4250658_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
AVV29269.1|4251305_4252274_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
ASE80288.1|4252749_4253331_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
ASE80289.1|4253330_4255769_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
ASE80290.1|4255822_4256065_-	hypothetical protein	NA	NA	NA	NA	NA
AVV29270.1|4256103_4259454_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	68.6	0.0e+00
ASE80292.1|4259525_4260230_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
ASE80293.1|4260127_4260865_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
ASE80294.1|4260874_4261570_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
ASE80295.1|4261659_4262193_+	superoxide dismutase [Cu-Zn] SodC1	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
ASE80296.1|4262309_4262807_-	Ail/OmpX	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
ASE80297.1|4262905_4263238_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
ASE81019.1|4263234_4266222_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
ASE80298.1|4266301_4266631_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
AVV29271.1|4266627_4267026_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
ASE80299.1|4267071_4267821_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
ASE80300.1|4267832_4268234_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
ASE80301.1|4268230_4268797_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
ASE80302.1|4268777_4269077_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
ASE80303.1|4269069_4269393_-	recombinase RecA	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
AVV29330.1|4269483_4271565_-	peptidase S14	NA	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
ASE81020.1|4271488_4273006_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
ASE80304.1|4273032_4273239_-	primosomal replication protein PriB/PriC domain protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
AVV29272.1|4273235_4275374_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
ASE80305.1|4275330_4275864_-	DNA breaking-rejoining protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
AVV29331.1|4276071_4276551_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
ASE80306.1|4276568_4277021_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	96.6	1.5e-78
ASE81021.1|4277004_4277334_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
ASE80307.1|4277609_4278296_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
AVV29273.1|4278656_4279106_+	hypothetical protein	NA	NA	NA	NA	NA
ASE80308.1|4279241_4279367_-	hypothetical protein	NA	NA	NA	NA	NA
ASE80309.1|4279540_4279858_-	hypothetical protein	NA	NA	NA	NA	NA
ASE80310.1|4279924_4280722_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
ASE80311.1|4280711_4280858_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
ASE80312.1|4280854_4281466_-	protein NinG	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
ASE80313.1|4281468_4281675_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
ASE80314.1|4281674_4282277_-	hypothetical protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
ASE80315.1|4282359_4282581_-	hypothetical protein	NA	NA	NA	NA	NA
ASE80316.1|4282692_4282926_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
ASE80317.1|4283217_4283508_-	hypothetical protein	NA	NA	NA	NA	NA
ASE80318.1|4283585_4283897_-	hypothetical protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
ASE80319.1|4283893_4284241_-	DNA-binding protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
ASE80320.1|4284251_4285001_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
ASE80321.1|4285003_4285987_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
ASE80322.1|4286071_4286446_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
ASE80323.1|4286411_4286651_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
ASE81022.1|4286770_4287181_+	transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
ASE80324.1|4287230_4287491_+	hypothetical protein	NA	NA	NA	NA	NA
ASE80325.1|4287483_4287642_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
ASE80326.1|4287663_4287963_+	DNA breaking-rejoining protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
ASE80327.1|4288089_4290975_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
ASE80328.1|4290937_4292095_+	enterohemolysin	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
ASE80329.1|4292137_4292377_+	DUF4060 domain-containing protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
ASE80330.1|4292417_4292666_+	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
ASE80331.2|4292710_4294003_+|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
ASE80332.1|4294197_4295400_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
ASE80333.1|4295477_4296914_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
ASE80334.1|4297158_4298373_-	PLP-dependent lyase/thiolase	NA	NA	NA	NA	NA
ASE80335.1|4298459_4298693_+	hypothetical protein	NA	NA	NA	NA	NA
ASE80336.1|4298689_4299151_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
ASE80337.1|4299351_4300752_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
4311898:4311917	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
>prophage 11
CP022070	Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_321 chromosome, complete genome	4884508	4364918	4373650	4884508	transposase,protease	Enterobacteria_phage(14.29%)	9	NA	NA
ASE80386.1|4364918_4366173_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
ASE80387.1|4366636_4367095_-|transposase	IS200/IS605 family transposase IS200F	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
ASE80388.1|4367051_4367234_-	hypothetical protein	NA	NA	NA	NA	NA
AVV29275.1|4367286_4369563_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
ASE80389.1|4369593_4369914_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
ASE80390.1|4370237_4370459_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
ASE80391.1|4370413_4370608_-	hypothetical protein	NA	NA	NA	NA	NA
ASE80392.1|4370588_4372535_-	macrolide ABC transporter permease/ATP-binding protein MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
ASE80393.2|4372531_4373650_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 1
CP022071	Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_321 plasmid unnamed1, complete sequence	93862	25514	34810	93862	transposase	Escherichia_phage(28.57%)	12	NA	NA
ASE81082.1|25514_26195_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
AVV29336.1|26339_26528_-	hypothetical protein	NA	NA	NA	NA	NA
ASE81083.1|26576_26933_-	hypothetical protein	NA	NA	NA	NA	NA
ASE81084.1|26925_27396_-	hypothetical protein	NA	NA	NA	NA	NA
ASE81085.1|27906_28329_+	protein SamA	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
ASE81086.1|28328_29603_+	DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.5	3.0e-156
ASE81087.1|29684_30662_-	chromosome partitioning protein ParB	NA	A0A1B0V750	Salmonella_phage	53.2	5.2e-84
ASE81088.1|30658_31864_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
ASE81089.1|32278_33220_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
AVV29337.1|33251_33818_-	DUF2913 domain-containing protein	NA	NA	NA	NA	NA
ASE81090.1|33874_34210_-	hypothetical protein	NA	NA	NA	NA	NA
ASE81146.1|34393_34810_-	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
>prophage 1
CP022072	Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_321 plasmid unnamed2, complete sequence	42327	0	15072	42327		Escherichia_phage(33.33%)	17	NA	NA
ASE81150.1|1684_1927_+	relaxase	NA	NA	NA	NA	NA
ASE81151.1|1958_2636_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
ASE81152.1|2714_3914_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
ASE81153.1|3945_4830_-	EamA family transporter	NA	NA	NA	NA	NA
ASE81201.1|4967_5360_-	cysteine hydrolase	NA	NA	NA	NA	NA
AVV29346.1|8564_9074_-	peptidase M14	NA	NA	NA	NA	NA
ASE81154.1|9157_9508_-	hypothetical protein	NA	NA	NA	NA	NA
ASE81155.1|9658_9859_-	hypothetical protein	NA	NA	NA	NA	NA
ASE81156.1|10105_10381_-	nuclease	NA	NA	NA	NA	NA
ASE81158.1|11031_11805_-	hypothetical protein	NA	NA	NA	NA	NA
ASE81159.1|11949_12399_+	hypothetical protein	NA	A0A222YWI5	Escherichia_phage	67.1	5.0e-42
ASE81160.1|12506_12686_+	hypothetical protein	NA	NA	NA	NA	NA
ASE81161.2|12655_12841_+	hypothetical protein	NA	NA	NA	NA	NA
ASE81162.1|12937_13162_-	hypothetical protein	NA	NA	NA	NA	NA
ASE81163.1|13146_13230_+	Damage inducible protein	NA	NA	NA	NA	NA
ASE81164.1|13384_14029_-	resolvase	NA	A0A1V0E035	Clostridioides_phage	28.3	3.4e-07
ASE81165.1|14409_15072_+	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
>prophage 2
CP022072	Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_321 plasmid unnamed2, complete sequence	42327	19825	20576	42327		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
ASE81173.1|19825_20107_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	62.4	3.8e-24
ASE81174.1|20252_20576_+	hypothetical protein	NA	A0A0K1LL53	Rhodobacter_phage	46.1	9.2e-14
>prophage 3
CP022072	Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_321 plasmid unnamed2, complete sequence	42327	29254	40984	42327	transposase,integrase	Escherichia_phage(37.5%)	14	30029:30041	41317:41329
ASE81185.1|29254_29959_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
ASE81186.1|30020_30728_+	hypothetical protein	NA	NA	NA	NA	NA
30029:30041	attL	CCTGCAACTGGCC	NA	NA	NA	NA
ASE81187.1|30714_31566_+	replication protein	NA	NA	NA	NA	NA
ASE81188.1|31873_32689_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
ASE81189.2|32749_33553_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
ASE81190.1|33552_34389_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
ASE81191.1|34449_35154_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
ASE81193.1|35738_36599_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
ASE81194.1|36748_37150_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
ASE81195.1|37196_37901_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
ASE81196.2|38052_38526_-	trimethoprim-resistant dihydrofolate reductase DfrA5	NA	G3MBI7	Bacillus_virus	27.7	1.0e-13
ASE81197.1|38681_39695_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
ASE81198.1|39633_40248_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
ASE81199.1|40423_40984_+|transposase	transposase	transposase	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
41317:41329	attR	CCTGCAACTGGCC	NA	NA	NA	NA
