The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	0	14363	2578483		Catovirus(14.29%)	9	NA	NA
ASE57747.1|1756_2704_+	lipid kinase	NA	A0A1V0SBJ0	Catovirus	23.6	1.5e-11
ASE57748.1|2874_3423_-	5'(3')-deoxyribonucleotidase	NA	A0A0A0PKY7	Bacillus_phage	38.4	5.9e-29
ASE57749.1|3600_4656_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	27.2	2.3e-21
ASE57750.1|4814_6332_-	glycine/betaine ABC transporter permease	NA	NA	NA	NA	NA
ASE57751.1|6328_7291_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.5	4.8e-26
ASE57752.1|7596_9375_-	DNA helicase RecQ	NA	M1PGQ0	Moumouvirus	36.8	5.9e-78
AVK72399.1|9388_11272_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	30.4	1.1e-53
ASE57753.1|11384_12203_+	ZIP family metal transporter	NA	NA	NA	NA	NA
AVK72400.1|12422_14363_-	lipoteichoic acid synthase	NA	W6LM83	Streptococcus_phage	39.1	5.0e-107
>prophage 2
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	17678	25228	2578483		Pandoravirus(16.67%)	9	NA	NA
ASE57758.1|17678_18821_-	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	36.7	5.4e-24
ASE57759.1|18804_19398_-	type 1 glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	41.5	1.9e-36
ASE57760.1|19653_20325_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	54.9	1.2e-63
ASE57761.1|20326_20752_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
ASE57762.1|20744_21461_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.4	2.5e-51
ASE57763.1|21701_22295_+	hypothetical protein	NA	NA	NA	NA	NA
ASE57764.1|22363_22615_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
ASE57765.1|22832_23894_-	glycosyltransferase	NA	A0A192Y8W7	Salmonella_phage	42.3	8.7e-61
ASE57766.1|24388_25228_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.2	1.2e-52
>prophage 3
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	32940	33810	2578483		Bacillus_phage(100.0%)	1	NA	NA
ASE57773.1|32940_33810_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	51.5	1.9e-77
>prophage 4
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	40904	50187	2578483		Indivirus(25.0%)	9	NA	NA
ASE57780.1|40904_41813_-	oxidoreductase	NA	A0A1V0SDE7	Indivirus	25.9	1.1e-11
ASE57781.1|41846_42773_-	GTP-binding protein	NA	NA	NA	NA	NA
ASE57782.1|42999_43443_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
ASE57783.1|43651_45331_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	23.4	1.5e-14
ASE57784.1|45327_46959_-	cysteine ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	29.9	5.0e-15
ASE57785.1|47238_48114_+	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
ASE57786.1|48447_49149_+	hypothetical protein	NA	NA	NA	NA	NA
ASE57787.1|49153_49618_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
ASE57788.1|49620_50187_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	36.2	8.3e-18
>prophage 5
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	60960	62834	2578483		uncultured_virus(50.0%)	2	NA	NA
ASE57801.1|60960_62073_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	42.9	6.7e-80
ASE57802.1|62327_62834_-	cupin	NA	A0A291ATU0	Pandoravirus	35.0	6.9e-16
>prophage 6
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	75266	76298	2578483		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
ASE57814.1|75266_76298_-	alpha/beta hydrolase	NA	A0A0G2Y6Q1	Acanthamoeba_polyphaga_mimivirus	26.0	2.8e-16
>prophage 7
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	82576	90599	2578483		Klosneuvirus(25.0%)	6	NA	NA
ASE57822.1|82576_83380_-	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	28.6	1.1e-15
ASE57823.1|83696_84533_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	35.5	3.8e-43
ASE57824.1|85182_86412_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
ASE57825.1|86797_88516_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	40.9	1.1e-108
ASE57826.1|88740_90036_+	DUF1958 domain-containing protein	NA	NA	NA	NA	NA
ASE57827.1|90200_90599_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A222YWT0	Streptomyces_phage	39.9	1.7e-17
>prophage 8
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	98061	98784	2578483		Cedratvirus(100.0%)	1	NA	NA
ASE57835.1|98061_98784_+	metal ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	27.7	1.9e-11
>prophage 9
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	124992	128682	2578483		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
ASE57861.1|124992_126294_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	28.8	9.8e-22
ASE57862.1|126330_126810_-	N-acetyltransferase	NA	NA	NA	NA	NA
ASE57863.1|126943_127486_-	flavodoxin family protein	NA	NA	NA	NA	NA
ASE57864.1|127746_128682_-	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	23.1	3.7e-07
>prophage 10
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	142596	143253	2578483		Elephant_endotheliotropic_herpesvirus(100.0%)	1	NA	NA
ASE57875.1|142596_143253_-	uracil-DNA glycosylase	NA	U5U481	Elephant_endotheliotropic_herpesvirus	47.2	8.3e-46
>prophage 11
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	148404	149817	2578483		Burkholderia_virus(100.0%)	1	NA	NA
ASE57880.1|148404_149817_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	32.2	5.0e-56
>prophage 12
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	161397	162060	2578483		Enterococcus_phage(100.0%)	1	NA	NA
ASE57895.1|161397_162060_+	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	34.1	2.4e-24
>prophage 13
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	184490	185273	2578483		Escherichia_phage(100.0%)	1	NA	NA
ASE57915.1|184490_185273_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.2	7.4e-17
>prophage 14
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	189590	190388	2578483		Salmonella_phage(100.0%)	1	NA	NA
ASE57918.2|189590_190388_-	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	35.4	8.9e-34
>prophage 15
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	212056	215337	2578483		Catovirus(50.0%)	3	NA	NA
ASE57937.1|212056_213856_-	hypothetical protein	NA	A0A1V0SAI8	Catovirus	29.9	1.5e-28
ASE57938.1|213880_214648_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
ASE57939.1|214650_215337_-	capsular biosynthesis protein	NA	A0A1X9I5D6	Streptococcus_phage	34.7	1.5e-26
>prophage 16
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	218727	219918	2578483		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
ASE57945.1|218727_219918_-	glycine C-acetyltransferase	NA	D2TEZ5	Emiliania_huxleyi_virus	31.2	3.2e-43
>prophage 17
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	223083	234069	2578483		Streptococcus_phage(33.33%)	6	NA	NA
ASE57948.1|223083_225174_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.4	1.3e-63
ASE57949.1|225293_225764_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
ASE57950.1|225834_226248_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
ASE57951.1|226342_226597_-	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
ASE57952.1|226754_230378_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.7	2.8e-66
ASE57953.1|230517_234069_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	23.1	1.5e-48
>prophage 18
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	238134	242993	2578483	tRNA	Bacillus_virus(50.0%)	8	NA	NA
ASE57959.1|238134_238683_-	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	32.9	3.8e-12
ASE57960.1|238697_238877_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
ASE57961.1|239005_239149_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
ASE57962.1|239279_239855_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
ASE57963.1|239929_240451_-	hypothetical protein	NA	NA	NA	NA	NA
ASE57964.1|240447_241197_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
ASE59952.1|241204_241591_-	ribonuclease III	NA	NA	NA	NA	NA
ASE57965.1|241592_242993_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	30.8	5.9e-57
>prophage 19
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	248674	251137	2578483	protease	Enterobacteria_phage(100.0%)	1	NA	NA
ASE57969.1|248674_251137_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpC	protease	H6X3M6	Enterobacteria_phage	40.3	5.8e-132
>prophage 20
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	256179	257559	2578483		Streptococcus_phage(100.0%)	1	NA	NA
ASE57976.1|256179_257559_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.4	1.5e-20
>prophage 21
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	269556	279814	2578483	tRNA	Catovirus(20.0%)	9	NA	NA
ASE57977.1|269556_271044_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	40.6	5.1e-91
ASE57978.1|271566_272046_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
ASE57979.1|272042_272411_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
ASE57980.1|272388_273192_-	dihydropteroate synthase	NA	NA	NA	NA	NA
ASE57981.1|273413_274346_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	63.7	1.0e-105
ASE57982.1|274501_275383_-	redox-regulated molecular chaperone Hsp33	NA	NA	NA	NA	NA
ASE57983.1|275589_277680_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	H8ZJI5	Ostreococcus_tauri_virus	49.0	4.2e-107
ASE57984.1|277974_278514_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	29.8	1.4e-11
ASE57985.1|278518_279814_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	M1I2W1	Paramecium_bursaria_Chlorella_virus	24.3	1.1e-09
>prophage 22
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	289000	293713	2578483		Hokovirus(50.0%)	5	NA	NA
ASE57994.1|289000_289966_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	35.5	1.5e-48
ASE57995.1|290113_291469_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	NA	NA	NA	NA
ASE57996.1|292124_292430_-	stage V sporulation protein G	NA	NA	NA	NA	NA
ASE57997.1|292494_292869_-	RidA family protein	NA	NA	NA	NA	NA
ASE57998.1|292888_293713_-	pur operon repressor	NA	A0A1V0SKE5	Klosneuvirus	25.3	3.0e-08
>prophage 23
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	297671	300794	2578483	tRNA	Klosneuvirus(50.0%)	2	NA	NA
AVK72411.1|297671_299648_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	36.4	1.5e-93
ASE58004.1|299957_300794_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	48.0	9.9e-60
>prophage 24
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	304463	305081	2578483		Streptococcus_phage(100.0%)	1	NA	NA
ASE58010.1|304463_305081_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	48.3	1.3e-45
>prophage 25
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	313612	315915	2578483		Streptococcus_virus(50.0%)	2	NA	NA
ASE58014.1|313612_315325_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	41.9	9.7e-54
ASE58015.1|315384_315915_-	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	39.4	2.6e-29
>prophage 26
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	330059	334795	2578483		Ostreococcus_tauri_virus(33.33%)	5	NA	NA
ASE58024.1|330059_331304_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	30.9	4.9e-39
ASE58025.1|331414_332296_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
ASE58026.1|332496_332775_+	hypothetical protein	NA	NA	NA	NA	NA
ASE58027.2|332868_333852_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7NU10	Lactobacillus_phage	42.6	8.7e-23
ASE58028.1|334015_334795_-	arylamine N-acetyltransferase	NA	L7RDD0	Acanthamoeba_polyphaga_moumouvirus	28.0	7.7e-06
>prophage 27
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	345992	348745	2578483		Staphylococcus_phage(50.0%)	3	NA	NA
ASE58036.1|345992_346727_+	hypothetical protein	NA	A0A0D3MVF0	Staphylococcus_phage	42.6	4.5e-40
ASE58037.1|346792_348007_-	MFS transporter	NA	NA	NA	NA	NA
ASE58038.1|348232_348745_-	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	56.0	3.1e-48
>prophage 28
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	352771	352972	2578483		Lactococcus_phage(100.0%)	1	NA	NA
ASE58042.1|352771_352972_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.2	1.7e-18
>prophage 29
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	361545	378036	2578483	terminase,integrase	uncultured_Caudovirales_phage(30.77%)	21	359485:359500	375005:375020
359485:359500	attL	ATTATTCCCACTCGAT	NA	NA	NA	NA
ASE58052.1|361545_361965_-	FosB/FosD family fosfomycin resistance bacillithiol transferase	NA	Q2LI91	Bacillus_phage	63.2	1.2e-37
ASE58053.1|362255_362612_+	glyoxalase	NA	NA	NA	NA	NA
ASE58054.1|362678_363089_-	YolD-like family protein	NA	U3PG23	Staphylococcus_phage	69.1	3.1e-51
ASE58055.1|363202_363934_-	23S ribosomal RNA methyltransferase Erm	NA	E4ZFQ0	Streptococcus_phage	49.4	4.1e-62
ASE58056.1|364104_364437_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
ASE59953.1|364433_364712_-	hypothetical protein	NA	A0A2H4JEA5	uncultured_Caudovirales_phage	46.7	1.8e-18
ASE58057.1|364756_365293_-	pathogenicity island protein	NA	A0A2H4JB26	uncultured_Caudovirales_phage	50.3	6.0e-42
ASE58058.1|365318_365792_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JB21	uncultured_Caudovirales_phage	72.6	3.7e-56
ASE58059.1|366916_367390_-	hypothetical protein	NA	A0A1W6JPF7	Staphylococcus_phage	38.9	3.0e-29
ASE58060.1|367405_368023_-	hypothetical protein	NA	A0A1W6JPC6	Staphylococcus_phage	54.5	2.7e-54
ASE58061.1|368036_368243_-	hypothetical protein	NA	NA	NA	NA	NA
ASE59954.1|368327_368570_-	hypothetical protein	NA	NA	NA	NA	NA
ASE58062.1|369158_371495_-	DNA primase	NA	A0A2H4JCU9	uncultured_Caudovirales_phage	38.5	2.1e-123
ASE58063.1|371583_371892_-	hypothetical protein	NA	NA	NA	NA	NA
ASE58064.1|371893_372073_-	hypothetical protein	NA	NA	NA	NA	NA
ASE58065.1|372121_372382_-	hypothetical protein	NA	NA	NA	NA	NA
ASE58066.2|372382_372628_-	hypothetical protein	NA	NA	NA	NA	NA
ASE58067.1|372760_373687_+	hypothetical protein	NA	Q9AZH9	Lactococcus_phage	35.2	3.3e-16
ASE58068.1|373775_374912_+|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	42.9	4.6e-68
ASE59955.1|375005_376547_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.6	1.8e-22
375005:375020	attR	ATTATTCCCACTCGAT	NA	NA	NA	NA
ASE58069.1|376569_378036_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.7	1.2e-97
>prophage 30
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	386694	389619	2578483		Clostridium_phage(50.0%)	3	NA	NA
ASE58077.1|386694_387057_+	helix-turn-helix domain-containing protein	NA	A0A0A7RUJ5	Clostridium_phage	40.6	2.7e-06
ASE58078.1|387509_388079_+	peroxiredoxin	NA	NA	NA	NA	NA
ASE58079.1|388095_389619_+	alkyl hydroperoxide reductase subunit F	NA	A0A249XZT7	Enterococcus_phage	34.9	2.4e-43
>prophage 31
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	398185	413493	2578483	protease	uncultured_Caudovirales_phage(33.33%)	21	NA	NA
ASE58091.1|398185_399508_-	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	48.6	6.9e-108
ASE58092.1|399494_399929_-	transcriptional regulator	NA	NA	NA	NA	NA
ASE58093.1|400100_400505_-	hypothetical protein	NA	NA	NA	NA	NA
ASE58094.1|400691_401066_+	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
AVK72413.1|401432_402179_+	hypothetical protein	NA	A0A2H4JHA0	uncultured_Caudovirales_phage	43.4	1.3e-39
ASE58095.1|402318_403623_+	potassium transporter KtrB	NA	NA	NA	NA	NA
ASE58096.1|404183_404594_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
ASE58097.1|404838_406137_-	LysM peptidoglycan-binding domain-containing protein	NA	M1HNA7	Bacillus_virus	52.0	1.6e-16
ASE58098.1|406334_406523_-	hypothetical protein	NA	NA	NA	NA	NA
AVK72414.1|406723_407338_-|protease	protease	protease	NA	NA	NA	NA
ASE59957.1|407379_407775_-	hypothetical protein	NA	NA	NA	NA	NA
ASE58099.1|407819_408164_-	DUF4260 domain-containing protein	NA	NA	NA	NA	NA
ASE58100.1|408365_408704_+	hypothetical protein	NA	A0A2H4J741	uncultured_Caudovirales_phage	45.1	2.5e-09
ASE58101.1|408758_409172_+	DUF1093 domain-containing protein	NA	NA	NA	NA	NA
ASE58102.1|409315_409588_-	hypothetical protein	NA	NA	NA	NA	NA
ASE58103.1|410406_410613_+	hypothetical protein	NA	NA	NA	NA	NA
ASE58104.1|410637_410859_+	hypothetical protein	NA	NA	NA	NA	NA
ASE58105.1|411136_411379_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
ASE58106.1|411428_411941_-	single-stranded DNA-binding protein	NA	A0A1W6JPL9	Staphylococcus_phage	68.2	6.3e-57
ASE58107.1|411959_412265_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
ASE58108.1|412686_413493_+	lysozyme	NA	A0A2P0ZKX1	Lactobacillus_phage	41.3	2.6e-33
>prophage 32
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	423572	433539	2578483		Staphylococcus_phage(75.0%)	9	NA	NA
ASE59958.1|423572_424862_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	80.4	7.3e-187
ASE58117.1|424864_425179_-	ArsR family transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	71.2	1.2e-37
ASE58118.1|425392_425956_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
ASE58119.1|426071_426494_+	hypothetical protein	NA	NA	NA	NA	NA
ASE58120.1|426674_427139_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
ASE58121.1|427419_428031_+	hypothetical protein	NA	NA	NA	NA	NA
ASE58122.1|428099_429671_-	acyl--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	33.5	4.0e-70
ASE58123.1|430179_431583_+	MFS transporter	NA	NA	NA	NA	NA
ASE58124.1|432513_433539_-	NAD-dependent formate dehydrogenase	NA	A0A1V0SBV6	Catovirus	33.3	1.0e-29
>prophage 33
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	437280	439092	2578483		Freshwater_phage(50.0%)	2	NA	NA
ASE58128.1|437280_437895_-	adenylyl-sulfate kinase	NA	A0A1B0XTK9	Freshwater_phage	38.6	2.6e-09
ASE58129.1|437913_439092_-	sulfate adenylyltransferase	NA	A0A2K9L4R9	Tupanvirus	31.8	1.4e-51
>prophage 34
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	449364	451931	2578483		Gordonia_phage(50.0%)	2	NA	NA
ASE58139.1|449364_450213_-	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHW0	Gordonia_phage	29.3	2.1e-09
ASE58140.1|450827_451931_+	cystathionine gamma-synthase	NA	A0A0B5JD48	Pandoravirus	27.0	2.1e-09
>prophage 35
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	467869	469396	2578483		Staphylococcus_phage(100.0%)	1	NA	NA
ASE58151.1|467869_469396_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.3	2.0e-34
>prophage 36
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	475084	475918	2578483		Staphylococcus_phage(100.0%)	1	NA	NA
ASE58156.1|475084_475918_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	65.0	1.3e-104
>prophage 37
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	483047	483887	2578483		Gordonia_phage(100.0%)	1	NA	NA
ASE58163.1|483047_483887_-	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHY8	Gordonia_phage	33.1	8.0e-09
>prophage 38
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	494122	503172	2578483	tRNA	Bacillus_virus(50.0%)	5	NA	NA
ASE58171.1|494122_496048_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.9	5.1e-144
ASE58172.1|496083_498786_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	34.8	1.4e-115
ASE58173.1|498848_499661_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
ASE58174.1|500057_501557_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	40.5	8.2e-97
ASE58175.1|501888_503172_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.6	5.4e-89
>prophage 39
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	509411	513692	2578483		Streptococcus_phage(33.33%)	3	NA	NA
ASE59961.1|509411_510812_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	48.6	1.1e-111
ASE58182.1|511107_512391_+	adenylosuccinate synthase	NA	A0A2P1EKE7	Megavirus	35.3	9.5e-70
ASE58183.1|512480_513692_-	glycosyl transferase	NA	Q0IKX4	Leucania_separata_nucleopolyhedrovirus	25.0	2.1e-10
>prophage 40
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	517060	522943	2578483		Bacillus_phage(66.67%)	5	NA	NA
ASE58186.1|517060_517762_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	39.2	6.0e-42
ASE58187.1|517774_519607_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	32.2	5.6e-31
ASE58188.1|519596_520937_+	hypothetical protein	NA	NA	NA	NA	NA
ASE58189.1|520937_521720_+	hypothetical protein	NA	NA	NA	NA	NA
ASE58190.1|522142_522943_+	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	38.0	2.9e-40
>prophage 41
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	532646	536047	2578483	transposase	Organic_Lake_phycodnavirus(50.0%)	4	NA	NA
ASE59962.1|532646_533420_+	phosphonates import ATP-binding protein PhnC	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.6	6.2e-08
ASE58196.1|533421_534216_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
ASE58197.1|534212_535028_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
AVK72418.1|535090_536047_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.6	1.1e-49
>prophage 42
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	541325	555449	2578483		Bacillus_phage(25.0%)	11	NA	NA
AVK72419.1|541325_543002_+	recombinase RecB	NA	A0A0S2SXR4	Bacillus_phage	29.2	1.6e-45
ASE58203.1|543107_543446_+	hypothetical protein	NA	NA	NA	NA	NA
ASE58204.1|543541_543853_+	hypothetical protein	NA	NA	NA	NA	NA
ASE58205.1|543868_544375_+	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
ASE58206.1|544701_544905_+	hypothetical protein	NA	NA	NA	NA	NA
ASE58207.1|544954_548077_-	DEAD/DEAH box helicase	NA	A0A220A398	Liberibacter_phage	29.1	1.4e-66
AVK72420.1|548060_549263_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
ASE58208.1|549252_550767_-	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	30.8	8.3e-49
ASE59963.1|551095_551815_+	hypothetical protein	NA	NA	NA	NA	NA
ASE58209.1|551811_552708_-	hypothetical protein	NA	NA	NA	NA	NA
ASE59964.1|553424_555449_+	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	29.7	1.5e-64
>prophage 43
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	561708	563722	2578483		Staphylococcus_phage(100.0%)	3	NA	NA
ASE58214.1|561708_562101_-	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	81.5	2.1e-57
ASE58215.1|562118_563408_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	81.4	6.2e-186
ASE58216.1|563407_563722_-	transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	74.0	4.7e-39
>prophage 44
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	569494	571504	2578483		Tupanvirus(100.0%)	1	NA	NA
ASE58222.1|569494_571504_+	catalase	NA	A0A2K9L572	Tupanvirus	47.0	2.5e-141
>prophage 45
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	588818	590192	2578483		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
ASE58238.1|588818_590192_+	deoxyribodipyrimidine photo-lyase	NA	F2Y1V1	Organic_Lake_phycodnavirus	31.6	2.8e-43
>prophage 46
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	604513	605752	2578483		Streptococcus_phage(100.0%)	1	NA	NA
ASE58245.1|604513_605752_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1S5SFL7	Streptococcus_phage	28.6	7.8e-29
>prophage 47
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	630762	637798	2578483		Planktothrix_phage(33.33%)	6	NA	NA
ASE58265.1|630762_631425_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.4	4.2e-29
ASE58266.1|631497_631905_+	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
ASE58267.1|632177_633482_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
ASE58268.1|633647_634376_-	NAD-dependent protein deacylase	NA	A0A2I2L319	Orpheovirus	32.2	6.0e-13
ASE59966.2|634645_635449_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
ASE58269.2|637195_637798_+	antibiotic acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	42.7	6.1e-19
>prophage 48
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	645092	651163	2578483		Herpes_simplex_virus(50.0%)	3	NA	NA
ASE58276.1|645092_648071_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	29.9	4.2e-129
ASE58277.1|648293_650039_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
ASE58278.1|650215_651163_+	glycosyltransferase	NA	F1C5B0	Cronobacter_phage	42.0	2.9e-60
>prophage 49
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	656541	658262	2578483		Clostridium_phage(50.0%)	2	NA	NA
ASE58282.1|656541_657009_-	helix-turn-helix domain-containing protein	NA	A0A0A7S0F1	Clostridium_phage	42.0	4.9e-08
ASE58283.1|657497_658262_+	2,4-dienoyl-CoA reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	1.7e-13
>prophage 50
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	673421	674150	2578483		Staphylococcus_phage(100.0%)	1	NA	NA
ASE58296.1|673421_674150_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.5	6.7e-28
>prophage 51
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	689895	693356	2578483		Enterococcus_phage(33.33%)	3	NA	NA
ASE58305.1|689895_691746_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	63.8	4.6e-235
ASE58306.1|691742_692279_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	L7TIP4	Escherichia_phage	40.1	5.4e-27
ASE58307.1|692360_693356_+	linear amide C-N hydrolase	NA	M1HS66	Paramecium_bursaria_Chlorella_virus	28.8	1.3e-26
>prophage 52
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	699550	700363	2578483		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
ASE58314.1|699550_700363_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	M4QNT1	Ostreococcus_lucimarinus_virus	36.2	6.5e-40
>prophage 53
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	715194	715545	2578483		Brochothrix_phage(100.0%)	1	NA	NA
ASE58329.1|715194_715545_+	DUF4064 domain-containing protein	NA	D7RWL4	Brochothrix_phage	56.2	2.3e-10
>prophage 54
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	720837	729824	2578483		Enterococcus_phage(33.33%)	6	NA	NA
ASE58334.1|720837_721596_-	nickel pincer cofactor biosynthesis protein LarB	NA	A0A288TYA6	Enterococcus_phage	44.2	2.2e-21
ASE58335.1|721617_722442_-	ATP-dependent sacrificial sulfur transferase LarE	NA	NA	NA	NA	NA
ASE58336.1|722457_723720_-	nickel-dependent lactate racemase	NA	NA	NA	NA	NA
ASE58337.1|723783_724941_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	36.1	9.9e-42
ASE58338.1|725072_726152_+	transcriptional regulator	NA	NA	NA	NA	NA
ASE58339.1|727190_729824_+	pyruvate, phosphate dikinase	NA	A0A2I7RQW7	Vibrio_phage	40.9	3.9e-94
>prophage 55
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	736966	738280	2578483		Klosneuvirus(100.0%)	1	NA	NA
ASE58346.1|736966_738280_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.9	1.2e-30
>prophage 56
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	742593	750604	2578483	holin	Prochlorococcus_phage(33.33%)	6	NA	NA
ASE58350.1|742593_743484_-	fructose bisphosphate aldolase	NA	A0A0K0KVJ8	Prochlorococcus_phage	26.8	1.0e-06
ASE58351.1|743609_744332_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
ASE58352.1|744816_746439_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	23.1	4.8e-18
ASE58353.1|746608_747169_-	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
ASE58354.1|747371_748865_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
ASE58355.1|748921_750604_+|holin	oxygen-dependent choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	33.4	2.5e-62
>prophage 57
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	758208	762029	2578483		Staphylococcus_phage(50.0%)	3	NA	NA
ASE58361.1|758208_759261_+	CapA family protein	NA	A0A0N9SJ77	Staphylococcus_phage	49.7	7.2e-100
ASE58362.1|759356_760298_-	purine nucleosidase	NA	NA	NA	NA	NA
ASE58363.1|760631_762029_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	29.9	8.2e-51
>prophage 58
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	765922	772251	2578483	transposase	Anomala_cuprea_entomopoxvirus(25.0%)	6	NA	NA
ASE58366.1|765922_766234_+	hypothetical protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	36.1	2.3e-09
ASE58367.1|766261_766936_-|transposase	IS6-like element IS257 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	99.6	6.8e-128
ASE58368.1|767126_767768_+	3-hexulose-6-phosphate synthase 2	NA	NA	NA	NA	NA
ASE58369.1|767923_768442_+	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
AVK72499.1|768945_770961_+	daunorubicin resistance protein DrrC	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	35.8	3.0e-102
ASE58370.1|771102_772251_-	glutathione-dependent formaldehyde dehydrogenase	NA	A0A2L2DIY2	Acanthamoeba_polyphaga_mimivirus	27.3	2.2e-09
>prophage 59
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	779697	781185	2578483		Salisaeta_icosahedral_phage(50.0%)	2	NA	NA
ASE58378.1|779697_780249_+	recombinase family protein	NA	I1ZBD6	Salisaeta_icosahedral_phage	41.0	2.9e-31
ASE58379.1|780297_781185_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	21.0	2.2e-09
>prophage 60
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	784850	786968	2578483		Staphylococcus_phage(100.0%)	1	NA	NA
ASE58382.1|784850_786968_-	CHAP domain-containing protein	NA	A0A249Y1A9	Staphylococcus_phage	45.8	4.3e-11
>prophage 61
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	797625	798300	2578483	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
ASE58390.1|797625_798300_-|transposase	IS6-like element IS257 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	99.6	6.8e-128
>prophage 62
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	802886	804071	2578483		Klosneuvirus(100.0%)	1	NA	NA
ASE58392.1|802886_804071_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.5	3.0e-38
>prophage 63
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	827029	827761	2578483		Bacillus_virus(100.0%)	1	NA	NA
ASE58414.1|827029_827761_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.4	1.8e-25
>prophage 64
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	834378	836791	2578483		Pandoravirus(50.0%)	2	NA	NA
ASE58420.1|834378_835668_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	A0A0B5JD48	Pandoravirus	23.5	3.1e-12
ASE58421.1|835885_836791_+	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	37.5	6.7e-46
>prophage 65
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	851391	852081	2578483		Bacillus_virus(100.0%)	1	NA	NA
AVK72432.1|851391_852081_+	peptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.4	2.0e-13
>prophage 66
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	861667	862450	2578483	protease	Staphylococcus_phage(100.0%)	1	NA	NA
ASE58447.1|861667_862450_+|protease	serine protease	protease	A0A2H4PQN3	Staphylococcus_phage	36.0	9.7e-17
>prophage 67
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	866969	882780	2578483		Staphylococcus_phage(25.0%)	14	NA	NA
ASE58449.1|866969_867554_+	M23 family peptidase	NA	G4KNQ9	Staphylococcus_phage	43.1	7.2e-17
ASE58450.1|867729_868395_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
ASE58451.1|868405_868759_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
ASE58452.1|868890_869319_+	6-pyruvoyl tetrahydrobiopterin synthase	NA	J9PV91	Bacillus_phage	32.4	4.6e-13
ASE58453.1|869832_870876_+	PTS transporter subunit IIC	NA	NA	NA	NA	NA
ASE58454.1|871400_872132_+	transglycosylase IsaA	NA	A0A0D3MVN5	Staphylococcus_phage	30.7	7.9e-13
ASE58455.1|872399_873557_+	N-succinyldiaminopimelate aminotransferase	NA	NA	NA	NA	NA
ASE58456.1|873582_874581_+	lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	31.2	1.5e-38
ASE58457.1|874631_874838_-	copper resistance protein CopZ	NA	NA	NA	NA	NA
ASE58458.1|874883_877268_-	copper-exporting P-type ATPase A	NA	A0A218MNH6	uncultured_virus	41.7	1.5e-132
ASE58459.1|877442_878894_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	49.2	6.2e-118
ASE58460.1|879093_879855_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.9	6.1e-32
ASE58461.1|879844_881740_+	ABC transporter permease	NA	NA	NA	NA	NA
ASE58462.1|881910_882780_+	KR domain-containing protein	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	43.3	8.4e-54
>prophage 68
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	905665	908315	2578483		uncultured_Caudovirales_phage(33.33%)	3	NA	NA
ASE58481.1|905665_905938_-	hypothetical protein	NA	A0A2H4IYD3	uncultured_Caudovirales_phage	46.2	3.5e-06
ASE58482.1|906058_906592_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	46.5	1.7e-36
ASE58483.1|906737_908315_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	23.6	1.2e-21
>prophage 69
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	913675	914107	2578483		Staphylococcus_phage(100.0%)	1	NA	NA
ASE58488.1|913675_914107_-	CHAP domain-containing protein	NA	A0A1X9I9L1	Staphylococcus_phage	39.1	6.1e-13
>prophage 70
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	918280	924024	2578483		Yellowstone_lake_phycodnavirus(50.0%)	3	NA	NA
ASE58492.1|918280_920023_+	pyruvate oxidase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.1e-34
ASE58493.1|920356_921751_+	YfcC family protein	NA	NA	NA	NA	NA
ASE58494.1|921987_924024_+	PTS glucose transporter subunit IICBA	NA	A0A2I7SAJ6	Vibrio_phage	43.1	1.3e-07
>prophage 71
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	938045	939383	2578483		Klosneuvirus(100.0%)	1	NA	NA
ASE58505.1|938045_939383_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.2	2.5e-20
>prophage 72
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	943544	948223	2578483		Catovirus(50.0%)	4	NA	NA
ASE58509.1|943544_945269_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.9	5.4e-12
ASE58510.1|945453_946038_+	transporter	NA	NA	NA	NA	NA
ASE58511.1|946039_946759_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
ASE58512.1|946768_948223_+	ABC transporter	NA	G9BWD6	Planktothrix_phage	29.3	6.0e-12
>prophage 73
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	954668	955739	2578483		Moumouvirus(100.0%)	1	NA	NA
ASE58516.1|954668_955739_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2P1ELD9	Moumouvirus	27.9	2.9e-19
>prophage 74
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	971289	974827	2578483		Bacillus_phage(100.0%)	2	NA	NA
ASE58532.1|971289_973071_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.8	1.9e-44
ASE58533.1|973063_974827_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.6	6.7e-50
>prophage 75
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1009122	1009827	2578483		Moumouvirus(100.0%)	1	NA	NA
ASE58558.1|1009122_1009827_+	oxidoreductase	NA	M1NMS3	Moumouvirus	25.8	1.4e-06
>prophage 76
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1015411	1016416	2578483		Pacmanvirus(100.0%)	1	NA	NA
ASE58566.1|1015411_1016416_-	histidinol-phosphate aminotransferase family protein	NA	A0A1X6WGT4	Pacmanvirus	21.9	1.5e-09
>prophage 77
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1026648	1027467	2578483		Hirudovirus(100.0%)	1	NA	NA
ASE59973.1|1026648_1027467_+	SDR family NAD(P)-dependent oxidoreductase	NA	V5L4T3	Hirudovirus	30.9	2.8e-06
>prophage 78
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1032169	1032820	2578483		Bacillus_virus(100.0%)	1	NA	NA
ASE58576.1|1032169_1032820_+	methionine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.7	3.1e-24
>prophage 79
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1040864	1042049	2578483		Mycoplasma_phage(100.0%)	1	NA	NA
ASE58584.1|1040864_1042049_+	CBS domain-containing protein	NA	Q6GZ03	Mycoplasma_phage	37.0	8.3e-20
>prophage 80
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1048490	1049231	2578483		Bacillus_virus(100.0%)	1	NA	NA
ASE58592.1|1048490_1049231_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	42.1	2.6e-40
>prophage 81
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1052341	1054117	2578483		Enterobacteria_phage(100.0%)	1	NA	NA
ASE58597.1|1052341_1054117_-	sensor protein LytS	NA	Q9EYF3	Enterobacteria_phage	30.3	5.9e-62
>prophage 82
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1070653	1071022	2578483		Staphylococcus_phage(100.0%)	1	NA	NA
ASE58610.1|1070653_1071022_-	hypothetical protein	NA	A0A2R3ZXP9	Staphylococcus_phage	55.7	5.7e-20
>prophage 83
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1099318	1099894	2578483		Staphylococcus_phage(100.0%)	1	NA	NA
ASE58637.1|1099318_1099894_+	hypothetical protein	NA	A0A1S6KVC6	Staphylococcus_phage	47.5	2.8e-45
>prophage 84
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1105520	1106300	2578483		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
ASE58640.1|1105520_1106300_+	3-oxoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.5	3.5e-19
>prophage 85
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1116587	1117619	2578483		Bacillus_virus(100.0%)	1	NA	NA
ASE58649.1|1116587_1117619_+	thioredoxin reductase	NA	G3MA85	Bacillus_virus	26.3	2.6e-17
>prophage 86
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1131080	1133630	2578483		Bacillus_phage(50.0%)	3	NA	NA
ASE58660.1|1131080_1131755_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	45.6	2.1e-52
ASE58661.1|1131909_1132962_+	ABC transporter permease	NA	NA	NA	NA	NA
ASE58662.1|1132961_1133630_+	hemin ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.2	2.7e-36
>prophage 87
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1137351	1138575	2578483		Salmonella_phage(100.0%)	1	NA	NA
ASE58666.1|1137351_1138575_+	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	26.6	7.5e-32
>prophage 88
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1155185	1156085	2578483		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
ASE58682.1|1155185_1156085_+	DUF4162 domain-containing protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	26.7	1.8e-14
>prophage 89
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1169861	1170743	2578483		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
ASE58692.1|1169861_1170743_+	KR domain-containing protein	NA	F2NZ40	Diadromus_pulchellus_ascovirus	45.9	7.7e-63
>prophage 90
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1174383	1174605	2578483		Macacine_betaherpesvirus(100.0%)	1	NA	NA
ASE58696.1|1174383_1174605_+	hypothetical protein	NA	A0A2I6AZV9	Macacine_betaherpesvirus	53.6	1.1e-13
>prophage 91
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1179385	1180030	2578483		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
ASE58701.1|1179385_1180030_+	HAD family hydrolase	NA	A7J6N1	Paramecium_bursaria_Chlorella_virus	26.5	6.5e-11
>prophage 92
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1197570	1200566	2578483		Staphylococcus_phage(50.0%)	3	NA	NA
ASE58719.1|1197570_1198347_+	autolysin	NA	H9A0W8	Staphylococcus_phage	42.9	9.9e-38
ASE58720.1|1198424_1199549_+	hypothetical protein	NA	NA	NA	NA	NA
ASE58721.1|1199609_1200566_-	hydroxyacid dehydrogenase	NA	A0A1M7XU89	Cedratvirus	31.7	2.5e-30
>prophage 93
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1214034	1214781	2578483		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
ASE58735.1|1214034_1214781_-	amino acid ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.1	1.5e-19
>prophage 94
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1222283	1223285	2578483		Tupanvirus(100.0%)	1	NA	NA
ASE58742.1|1222283_1223285_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.1	7.0e-52
>prophage 95
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1226444	1227050	2578483		Pithovirus(100.0%)	1	NA	NA
ASE58745.1|1226444_1227050_+	molybdenum ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.7	2.9e-13
>prophage 96
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1240868	1246965	2578483		Leptospira_phage(50.0%)	4	NA	NA
ASE58762.1|1240868_1244042_+	AcrB/AcrD/AcrF family protein	NA	S5VTK5	Leptospira_phage	22.3	1.6e-62
ASE58763.1|1244387_1244705_-	hypothetical protein	NA	NA	NA	NA	NA
ASE58765.1|1245095_1246004_+	AEC family transporter	NA	NA	NA	NA	NA
ASE58766.1|1246173_1246965_-	3-oxoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.4	8.9e-18
>prophage 97
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1251401	1252736	2578483		Moraxella_phage(100.0%)	1	NA	NA
ASE58769.1|1251401_1252736_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	31.9	3.3e-49
>prophage 98
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1268396	1270066	2578483		Planktothrix_phage(50.0%)	2	NA	NA
ASE58800.1|1268396_1269206_+	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	31.3	2.0e-17
ASE58801.1|1269202_1270066_+	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	24.8	1.8e-11
>prophage 99
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1277256	1278831	2578483		Vibrio_phage(100.0%)	1	NA	NA
ASE58810.1|1277256_1278831_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	23.1	9.4e-11
>prophage 100
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1288697	1289660	2578483		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
ASE58820.1|1288697_1289660_+	iron-dicitrate transporter subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.4	2.2e-15
>prophage 101
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1304616	1305522	2578483		Klosneuvirus(100.0%)	1	NA	NA
ASE58830.1|1304616_1305522_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	35.4	1.1e-27
>prophage 102
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1314931	1316737	2578483		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
ASE58838.1|1314931_1316737_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7J689	Paramecium_bursaria_Chlorella_virus	37.4	3.4e-97
>prophage 103
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1330686	1334247	2578483		Clostridium_phage(50.0%)	4	NA	NA
ASE58854.1|1330686_1331136_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	51.7	4.4e-38
ASE58855.1|1331320_1332031_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
ASE58856.1|1332215_1332878_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
ASE58857.1|1332945_1334247_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	60.1	1.4e-137
>prophage 104
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1343378	1344989	2578483		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
ASE58867.1|1343378_1344989_+	CTP synthetase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	2.2e-148
>prophage 105
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1352268	1360056	2578483		Bacillus_virus(25.0%)	9	NA	NA
ASE58874.1|1352268_1352868_+	thymidine kinase	NA	G3MBK1	Bacillus_virus	44.1	5.6e-33
ASE58875.1|1352867_1353944_+	peptide chain release factor 1	NA	NA	NA	NA	NA
ASE58876.1|1353930_1354767_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
ASE58877.1|1354860_1355904_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	36.8	2.8e-43
ASE58878.1|1355900_1356323_+	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
ASE58879.1|1356468_1356993_+	TIGR01440 family protein	NA	NA	NA	NA	NA
ASE58880.1|1357015_1358254_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	51.9	5.0e-100
ASE58881.1|1358273_1358903_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
ASE58882.1|1358925_1360056_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	27.4	4.5e-23
>prophage 106
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1370068	1370488	2578483		Staphylococcus_phage(100.0%)	1	NA	NA
ASE58896.1|1370068_1370488_+	single-stranded DNA-binding protein	NA	A0A1J0MFD7	Staphylococcus_phage	41.1	2.5e-19
>prophage 107
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1375900	1376548	2578483		Tunisvirus(100.0%)	1	NA	NA
ASE58902.1|1375900_1376548_-	HD domain-containing protein	NA	V9SGZ2	Tunisvirus	31.8	6.8e-08
>prophage 108
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1383948	1385469	2578483		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
ASE58910.1|1383948_1385469_+	DEAD/DEAH box family ATP-dependent RNA helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.4	3.1e-59
>prophage 109
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1390107	1393442	2578483		Clostridium_botulinum_C_phage(50.0%)	5	NA	NA
AVK72447.1|1390107_1390470_+	mRNA interferase MazF	NA	Q332J9	Clostridium_botulinum_C_phage	32.5	8.4e-08
ASE58917.1|1390806_1391808_+	serine/threonine protein phosphatase	NA	NA	NA	NA	NA
ASE58918.1|1391886_1392213_+	STAS domain-containing protein	NA	NA	NA	NA	NA
ASE58919.1|1392214_1392697_+	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
ASE58920.1|1392671_1393442_+	RNA polymerase sigma factor SigB	NA	A0A0A0RNH9	Bacillus_phage	33.9	3.7e-21
>prophage 110
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1406873	1411869	2578483		Micromonas_sp._RCC1109_virus(50.0%)	4	NA	NA
ASE58928.1|1406873_1408409_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	27.2	8.3e-12
ASE58929.1|1408559_1409564_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
ASE58930.1|1409608_1410082_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
ASE58931.1|1410078_1411869_-	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	29.7	2.7e-54
>prophage 111
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1415684	1421330	2578483	tRNA	Moraxella_phage(33.33%)	4	NA	NA
ASE58936.1|1415684_1416713_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	39.1	3.4e-62
ASE58937.1|1416861_1417284_+	VOC family protein	NA	NA	NA	NA	NA
ASE58938.1|1417435_1419082_-	DNA mismatch repair protein MutS	NA	F2QAF9	Pyramimonas_orientalis_virus	29.6	7.0e-17
ASE58939.1|1419401_1421330_-	ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	28.8	3.2e-53
>prophage 112
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1424857	1428100	2578483		Bacillus_phage(50.0%)	3	NA	NA
ASE58944.1|1424857_1426342_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	25.9	2.8e-17
ASE58945.1|1426338_1427307_+	carbohydrate kinase	NA	NA	NA	NA	NA
ASE58946.1|1427383_1428100_-	DNA-binding response regulator	NA	A0A2H4J4Z6	uncultured_Caudovirales_phage	33.9	3.6e-26
>prophage 113
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1435411	1451907	2578483	terminase,protease,integrase	Staphylococcus_phage(56.25%)	23	1437367:1437386	1453677:1453696
ASE58954.1|1435411_1435699_+	co-chaperone GroES	NA	A0A221S386	uncultured_virus	48.4	1.8e-13
ASE58955.1|1435761_1437384_+	molecular chaperone GroEL	NA	A0A240F779	uncultured_virus	53.4	5.4e-155
1437367:1437386	attL	ATGCCAGGTATGATGTAAAA	NA	NA	NA	NA
ASE58956.1|1437451_1438621_-|integrase	site-specific integrase	integrase	A0A1W6JPB2	Staphylococcus_phage	78.4	2.4e-176
ASE58957.1|1438641_1439388_-	transcriptional regulator	NA	NA	NA	NA	NA
ASE58958.1|1439555_1439774_+	XRE family transcriptional regulator	NA	A0A2H4JB11	uncultured_Caudovirales_phage	59.7	2.7e-17
ASE58959.1|1439777_1440086_+	helix-turn-helix domain-containing protein	NA	A0A1W6JPE8	Staphylococcus_phage	75.5	1.1e-35
ASE58960.1|1440082_1440271_+	hypothetical protein	NA	NA	NA	NA	NA
ASE58961.1|1440272_1440587_+	hypothetical protein	NA	NA	NA	NA	NA
ASE58962.1|1440687_1441575_+	mobile element-associated protein	NA	A0A1W6JQL5	Staphylococcus_phage	50.3	3.2e-77
ASE59979.1|1443817_1444060_+	hypothetical protein	NA	NA	NA	NA	NA
ASE58963.1|1444144_1444351_+	hypothetical protein	NA	NA	NA	NA	NA
ASE58964.1|1444364_1444982_+	hypothetical protein	NA	A0A1W6JPC6	Staphylococcus_phage	55.5	4.9e-56
ASE58965.1|1444993_1445467_+	hypothetical protein	NA	A0A1W6JPF7	Staphylococcus_phage	43.9	3.5e-30
ASE58966.1|1446635_1447109_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JB21	uncultured_Caudovirales_phage	71.3	2.3e-53
ASE58967.1|1447149_1447686_+	pathogenicity island protein	NA	A0A2H4JB26	uncultured_Caudovirales_phage	49.7	4.6e-42
ASE59980.1|1447730_1448009_+	hypothetical protein	NA	A0A2H4JEA5	uncultured_Caudovirales_phage	46.7	4.8e-19
ASE58968.1|1448005_1448341_+	hypothetical protein	NA	NA	NA	NA	NA
ASE58969.1|1448508_1449477_+|protease	CAAX protease	protease	NA	NA	NA	NA
ASE58970.2|1449578_1449770_+	hypothetical protein	NA	U3PCX8	Staphylococcus_phage	92.1	1.0e-28
ASE58971.1|1449779_1450190_+	YolD-like family protein	NA	U3PG23	Staphylococcus_phage	98.5	1.7e-73
ASE58972.1|1450218_1450707_-	ATP-binding protein	NA	A0A2H4JFX6	uncultured_Caudovirales_phage	100.0	3.2e-87
ASE58973.1|1450889_1451393_-	hypothetical protein	NA	A0A0H3U2S7	Staphylococcus_phage	67.7	1.1e-26
ASE58974.1|1451385_1451907_-	hypothetical protein	NA	A0A0H3U494	Staphylococcus_phage	83.2	1.0e-83
1453677:1453696	attR	ATGCCAGGTATGATGTAAAA	NA	NA	NA	NA
>prophage 114
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1460386	1461259	2578483		Staphylococcus_phage(100.0%)	1	NA	NA
ASE58985.1|1460386_1461259_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.3	1.1e-29
>prophage 115
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1466807	1467212	2578483		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
ASE58993.1|1466807_1467212_-	YolD-like family protein	NA	A0A2H4JEH6	uncultured_Caudovirales_phage	49.5	6.5e-25
>prophage 116
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1471418	1473190	2578483		Bacillus_virus(50.0%)	2	NA	NA
ASE58998.1|1471418_1471970_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	40.7	3.2e-30
ASE58999.1|1472107_1473190_+	pectate lyase	NA	U5PWM6	Bacillus_phage	33.7	4.9e-43
>prophage 117
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1477135	1488122	2578483		Bacillus_virus(40.0%)	10	NA	NA
ASE59002.1|1477135_1478605_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	44.7	1.3e-102
ASE59003.1|1478597_1479419_+	NAD(+) synthetase	NA	G3MA24	Bacillus_virus	50.2	1.3e-64
ASE59982.1|1479504_1480083_+	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
ASE59004.1|1480079_1480268_+	NETI motif-containing protein	NA	NA	NA	NA	NA
ASE59005.1|1480482_1481778_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.3	1.9e-17
ASE59006.1|1481864_1482167_+	hypothetical protein	NA	NA	NA	NA	NA
ASE59007.1|1482416_1483091_+	D-alanyl-D-alanine carboxypeptidase family protein	NA	NA	NA	NA	NA
ASE59008.1|1483209_1483899_+	heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
ASE59009.1|1483898_1486115_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	40.3	1.2e-131
ASE59010.1|1486118_1488122_+	DNA ligase (NAD(+)) LigA	NA	A0A0A8J9A9	Ralstonia_phage	36.0	7.3e-109
>prophage 118
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1494736	1499769	2578483		Streptococcus_phage(66.67%)	5	NA	NA
ASE59016.1|1494736_1495654_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	26.4	7.9e-18
ASE59017.1|1495739_1497101_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A1X9I6F4	Streptococcus_phage	43.9	2.9e-109
ASE59018.1|1497325_1497886_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
ASE59019.1|1498082_1499153_+	DNA polymerase IV	NA	NA	NA	NA	NA
ASE59020.1|1499214_1499769_-	DNA polymerase III subunit epsilon	NA	A0A1S5SEW3	Streptococcus_phage	39.4	2.8e-26
>prophage 119
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1503497	1504145	2578483	transposase	Bacillus_phage(100.0%)	1	NA	NA
ASE59024.1|1503497_1504145_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	48.6	8.8e-48
>prophage 120
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1508373	1509003	2578483		Bacillus_phage(100.0%)	1	NA	NA
ASE59030.1|1508373_1509003_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	25.9	8.9e-05
>prophage 121
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1523840	1525577	2578483		Bacillus_phage(100.0%)	1	NA	NA
ASE59046.1|1523840_1525577_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.5	1.7e-50
>prophage 122
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1542786	1543509	2578483		Planktothrix_phage(100.0%)	1	NA	NA
ASE59054.1|1542786_1543509_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.0	4.3e-35
>prophage 123
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1548797	1549625	2578483		Bodo_saltans_virus(100.0%)	1	NA	NA
ASE59061.1|1548797_1549625_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	26.2	6.9e-05
>prophage 124
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1567804	1568542	2578483		Staphylococcus_phage(100.0%)	1	NA	NA
ASE59075.1|1567804_1568542_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	4.5e-24
>prophage 125
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1576737	1612498	2578483	tRNA	Staphylococcus_phage(96.15%)	34	NA	NA
ASE59082.1|1576737_1578120_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	61.3	5.3e-167
AVK72501.1|1578154_1579144_+	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	49.5	3.2e-89
ASE59083.1|1579133_1579385_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	81.1	4.2e-30
ASE59084.1|1579444_1579921_+	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	53.5	4.8e-43
ASE59983.1|1579928_1580696_+	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	71.8	4.8e-101
ASE59085.1|1580791_1582381_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	81.8	8.5e-262
ASE59086.1|1582769_1583966_+	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	86.6	1.8e-195
ASE59087.1|1584064_1584973_+	hypothetical protein	NA	A0A2H4PQQ8	Staphylococcus_phage	75.8	1.1e-101
ASE59088.1|1585142_1585979_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	68.2	4.2e-111
ASE59089.1|1586249_1586606_-	camphor resistance protein CrcB	NA	NA	NA	NA	NA
ASE59090.1|1586602_1586968_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	62.8	3.3e-36
ASE59091.1|1587178_1587484_-	hypothetical protein	NA	NA	NA	NA	NA
AVK72456.1|1587768_1588482_+	transaldolase	NA	E3SKN5	Synechococcus_phage	36.3	2.9e-20
ASE59092.1|1589598_1590048_+	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	47.5	1.3e-21
ASE59093.1|1590055_1590481_-	hypothetical protein	NA	NA	NA	NA	NA
ASE59094.2|1590494_1591043_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4PQT5	Staphylococcus_phage	43.7	2.6e-24
ASE59095.1|1591185_1591410_+	hypothetical protein	NA	NA	NA	NA	NA
ASE59096.1|1591577_1592429_+	autolysin	NA	A0A0E3T9J6	Staphylococcus_phage	43.3	1.7e-38
ASE59097.1|1594310_1595237_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
ASE59098.1|1595411_1596878_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2H4PQX2	Staphylococcus_phage	58.6	5.5e-13
ASE59099.1|1597419_1598463_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	64.4	1.0e-130
ASE59100.1|1598469_1599102_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	64.8	5.0e-72
ASE59101.1|1599113_1600295_+	riboflavin biosynthesis protein RibBA	NA	A0A2H4PQS2	Staphylococcus_phage	71.2	4.2e-165
ASE59102.1|1600308_1600767_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	76.3	6.6e-58
AVK72457.1|1601031_1602033_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	68.5	7.3e-126
ASE59103.1|1602298_1603123_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
ASE59104.1|1603358_1604315_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
ASE59105.1|1604466_1604868_+	transcriptional regulator	NA	NA	NA	NA	NA
ASE59106.1|1604986_1605547_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	63.8	9.5e-67
ASE59107.1|1605543_1606497_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	83.3	7.3e-67
ASE59108.1|1606606_1607776_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	77.4	2.0e-167
ASE59109.1|1608304_1610719_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	85.6	0.0e+00
ASE59110.1|1610737_1611049_+	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	68.9	4.5e-34
ASE59111.1|1611229_1612498_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	77.2	1.5e-38
>prophage 126
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1622845	1628093	2578483		Staphylococcus_phage(50.0%)	3	NA	NA
AVK72458.1|1622845_1623709_+	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	89.1	2.1e-65
ASE59123.1|1623723_1624323_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
AVK72459.1|1624340_1628093_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	44.1	5.4e-81
>prophage 127
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1636477	1638187	2578483		Staphylococcus_phage(100.0%)	1	NA	NA
ASE59129.1|1636477_1638187_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	85.3	2.2e-239
>prophage 128
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1642006	1644835	2578483	tRNA,protease	Serratia_phage(50.0%)	2	NA	NA
ASE59132.1|1642006_1643269_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1S6UA79	Serratia_phage	41.2	1.3e-84
ASE59133.1|1643560_1644835_-|protease	serine protease	protease	W5SAB9	Pithovirus	28.0	3.8e-10
>prophage 129
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1648705	1652904	2578483		Staphylococcus_phage(50.0%)	4	NA	NA
ASE59136.1|1648705_1650322_-	phosphoglycerate dehydrogenase	NA	A0A2H4PQU8	Staphylococcus_phage	52.6	1.5e-59
ASE59137.1|1650314_1651475_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
ASE59138.1|1651639_1652080_-	SACOL1771 family peroxiredoxin	NA	NA	NA	NA	NA
ASE59139.1|1652157_1652904_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	28.0	3.5e-08
>prophage 130
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1657616	1662078	2578483	tRNA	Faustovirus(50.0%)	4	NA	NA
ASE59145.1|1657616_1658753_+	aminotransferase	NA	A0A1X7QGF3	Faustovirus	27.2	3.7e-25
ASE59146.1|1658749_1659973_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
ASE59147.1|1660027_1660801_+	hypothetical protein	NA	NA	NA	NA	NA
ASE59148.1|1661085_1662078_+	signal peptide peptidase SppA	NA	K4I1N3	Providencia_phage	30.6	4.2e-17
>prophage 131
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1674530	1677734	2578483		Streptomyces_phage(100.0%)	1	NA	NA
ASE59162.1|1674530_1677734_+	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	30.8	1.8e-133
>prophage 132
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1682412	1684173	2578483		Staphylococcus_phage(100.0%)	1	NA	NA
ASE59166.1|1682412_1684173_+	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	76.7	1.4e-31
>prophage 133
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1687421	1695221	2578483		Bacillus_phage(40.0%)	5	NA	NA
ASE59169.1|1687421_1688687_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	55.6	9.2e-09
ASE59170.1|1689109_1689820_+	DNA-binding response regulator	NA	A0A1J0GWE0	Alteromonas_phage	26.5	4.8e-07
ASE59171.1|1689819_1691508_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	36.3	4.6e-32
AVK72461.1|1691702_1694333_+	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	32.7	2.3e-46
ASE59172.1|1694348_1695221_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	30.1	1.0e-30
>prophage 134
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1699264	1710594	2578483	tRNA,protease	Brevibacillus_phage(20.0%)	10	NA	NA
ASE59177.1|1699264_1700188_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	30.7	2.7e-34
ASE59178.1|1700539_1702477_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	37.4	1.3e-118
ASE59179.1|1702920_1704411_+	amino acid permease	NA	NA	NA	NA	NA
ASE59986.1|1704623_1705151_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	31.7	5.9e-10
ASE59180.1|1705179_1705380_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
ASE59181.1|1705431_1705788_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
ASE59182.1|1706114_1706726_+	NUDIX domain-containing protein	NA	A0A060AB76	Staphylococcus_phage	41.9	1.0e-21
ASE59183.1|1706738_1707665_+	hypothetical protein	NA	NA	NA	NA	NA
AVK72462.1|1707834_1709145_+	trigger factor	NA	NA	NA	NA	NA
ASE59184.1|1709331_1710594_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	62.2	3.1e-142
>prophage 135
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1720505	1723136	2578483	tRNA	Catovirus(100.0%)	1	NA	NA
ASE59193.1|1720505_1723136_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	41.9	1.7e-158
>prophage 136
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1734238	1770925	2578483	tRNA,protease	uncultured_Mediterranean_phage(17.65%)	31	NA	NA
ASE59209.1|1734238_1735243_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.9	1.7e-05
ASE59210.1|1735245_1736271_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
ASE59211.1|1736291_1737437_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.0	2.5e-85
ASE59212.1|1737452_1737713_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	44.1	7.4e-06
ASE59213.1|1738095_1740372_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	34.6	1.7e-29
ASE59214.1|1740553_1742833_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.4	3.8e-69
ASE59215.1|1742845_1743364_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.2	6.6e-30
ASE59216.1|1743689_1745879_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	39.1	3.1e-12
ASE59217.1|1745891_1746344_+|tRNA	D-aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
ASE59218.1|1746340_1747216_+	cell wall amidase	NA	A0A067ZJB6	Vibrio_phage	30.4	3.9e-14
ASE59219.1|1747544_1748807_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
ASE59220.1|1748819_1750586_+|tRNA	aspartate--tRNA ligase	tRNA	K7Y9W2	Megavirus	40.2	1.9e-07
ASE59221.1|1750982_1751753_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
ASE59989.1|1751920_1753177_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	50.1	4.9e-103
ASE59222.1|1753290_1753710_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
ASE59223.2|1753835_1754018_+	CsbD family protein	NA	NA	NA	NA	NA
ASE59225.1|1754372_1755371_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
AVK72463.1|1755628_1755991_+	hypothetical protein	NA	NA	NA	NA	NA
ASE59990.1|1756159_1757296_+	ABC transporter ATP-binding protein	NA	A0A1V0SKJ1	Klosneuvirus	24.9	1.5e-18
ASE59226.1|1757356_1758499_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	28.0	1.6e-28
ASE59227.1|1758499_1759612_+|tRNA	tRNA(5-methylaminomethyl-2-thiouridine)- methyltransferase	tRNA	NA	NA	NA	NA
ASE59228.1|1759746_1760412_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
ASE59229.1|1760415_1762800_+	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	27.1	4.5e-49
ASE59230.1|1763147_1765778_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.0	3.8e-65
ASE59231.1|1765847_1766108_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
ASE59232.1|1766111_1766540_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
ASE59233.1|1766556_1766889_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
ASE59234.1|1767458_1768100_+	O-methyltransferase	NA	NA	NA	NA	NA
ASE59235.1|1768096_1769020_+|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	28.6	1.7e-20
ASE59991.1|1769075_1770302_+|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	31.6	3.8e-36
ASE59236.1|1770301_1770925_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.1	1.8e-34
>prophage 137
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1784025	1796384	2578483		Bacillus_phage(20.0%)	10	NA	NA
ASE59253.1|1784025_1784487_+	ComE operon protein 2	NA	F8WPT6	Bacillus_phage	55.1	1.4e-34
ASE59254.1|1784618_1786700_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332B9	Clostridium_botulinum_C_phage	32.8	1.1e-27
ASE59255.1|1786771_1787746_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
ASE59256.1|1787862_1788114_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
AVK72464.1|1788438_1790262_+	elongation factor 4	NA	A0A1S5SF82	Streptococcus_phage	23.8	7.5e-20
ASE59257.1|1790358_1791483_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
ASE59258.1|1791583_1792564_+	HrcA family transcriptional regulator	NA	NA	NA	NA	NA
ASE59259.1|1792590_1793202_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
ASE59260.1|1793257_1795102_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	46.6	7.6e-137
ASE59261.1|1795247_1796384_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	1.4e-24
>prophage 138
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1801552	1802500	2578483		Erwinia_phage(100.0%)	1	NA	NA
ASE59268.1|1801552_1802500_+	PhoH family protein	NA	W8D063	Erwinia_phage	46.2	1.1e-46
>prophage 139
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1805678	1819586	2578483	tRNA	Catovirus(28.57%)	13	NA	NA
ASE59274.1|1805678_1807070_-|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SAN4	Catovirus	27.0	2.3e-45
ASE59275.1|1807395_1808040_+	transcriptional regulator	NA	NA	NA	NA	NA
ASE59276.1|1808054_1808876_+	phosphoenolpyruvate synthase regulatory protein	NA	NA	NA	NA	NA
ASE59277.1|1808922_1810707_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	35.6	1.8e-50
ASE59278.1|1810848_1811955_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.1	2.4e-37
ASE59279.1|1812154_1812832_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
ASE59280.1|1812832_1813936_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
ASE59281.1|1814277_1815618_+	ATP-dependent helicase	NA	A0A1V0SBR7	Catovirus	34.0	1.1e-52
ASE59282.1|1815627_1816518_+	endonuclease	NA	A0A2H4UU70	Bodo_saltans_virus	32.1	6.9e-27
ASE59283.1|1816674_1817448_+	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.5	1.2e-19
ASE59284.1|1817444_1818305_+	metal ABC transporter permease	NA	NA	NA	NA	NA
ASE59285.1|1818294_1818708_+	transcriptional repressor	NA	NA	NA	NA	NA
ASE59286.1|1818986_1819586_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	54.2	5.4e-60
>prophage 140
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1825755	1826379	2578483		Streptococcus_phage(100.0%)	1	NA	NA
ASE59294.1|1825755_1826379_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	34.7	2.0e-28
>prophage 141
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1831922	1834740	2578483		Prochlorococcus_phage(100.0%)	2	NA	NA
ASE59302.1|1831922_1833275_+	glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	38.1	5.0e-61
ASE59303.1|1833261_1834740_+	glycine dehydrogenase	NA	E3ST28	Prochlorococcus_phage	41.5	1.8e-80
>prophage 142
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1841895	1844348	2578483		Indivirus(100.0%)	3	NA	NA
ASE59313.1|1841895_1843233_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	38.9	7.1e-44
ASE59314.1|1843225_1843471_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
ASE59315.1|1843460_1844348_+	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	25.6	2.1e-07
>prophage 143
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1849090	1850512	2578483		Erysipelothrix_phage(100.0%)	1	NA	NA
ASE59318.1|1849090_1850512_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.4	1.1e-39
>prophage 144
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1857190	1858600	2578483		Synechococcus_phage(100.0%)	1	NA	NA
ASE59325.1|1857190_1858600_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	A0A222YX62	Synechococcus_phage	28.9	1.7e-27
>prophage 145
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1862886	1864371	2578483		Cyanophage(100.0%)	1	NA	NA
ASE59329.1|1862886_1864371_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	37.8	9.0e-80
>prophage 146
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1869640	1879608	2578483		uncultured_Mediterranean_phage(28.57%)	11	NA	NA
ASE59336.1|1869640_1870528_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.4	5.1e-38
ASE59337.1|1870596_1871103_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
ASE59338.1|1871194_1871929_+	segregation and condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.5	1.4e-09
ASE59339.1|1871912_1872461_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	31.4	2.1e-10
ASE59340.1|1872453_1873191_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
ASE59341.1|1873317_1874043_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	42.6	1.1e-46
ASE59995.1|1874026_1875790_+	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	23.8	2.9e-21
ASE59342.1|1876217_1876763_+	ECF transporter S component	NA	NA	NA	NA	NA
ASE59343.1|1876918_1877167_-	ferredoxin	NA	A0A127AYY7	Bacillus_phage	48.0	4.9e-15
ASE59344.1|1877276_1878236_+	hypothetical protein	NA	NA	NA	NA	NA
AVK72466.1|1878228_1879608_+	ATP-dependent DNA helicase RecQ	NA	M1PGQ0	Moumouvirus	32.4	7.1e-55
>prophage 147
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1888565	1892143	2578483		Bacillus_phage(50.0%)	5	NA	NA
ASE59352.1|1888565_1888838_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	71.1	4.7e-27
ASE59353.1|1889291_1889864_+	heptaprenyl pyrophosphate synthase subunit A	NA	NA	NA	NA	NA
ASE59354.1|1889865_1890567_+	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
ASE59355.1|1890569_1891547_+	heptaprenyl diphosphate synthase	NA	NA	NA	NA	NA
ASE59356.1|1891693_1892143_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.8	6.3e-29
>prophage 148
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1900955	1908011	2578483	tRNA	unidentified_phage(25.0%)	5	NA	NA
ASE59365.1|1900955_1902155_+	[cytidine(C)-cytidine(C)-adenosine (A)]-adding enzyme	NA	H7BUW3	unidentified_phage	43.5	9.6e-40
ASE59366.1|1902147_1903119_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
ASE59367.1|1903145_1905848_+	ATP-dependent helicase DinG	NA	A0A1X9I5C8	Streptococcus_phage	28.0	3.9e-57
ASE59368.1|1905939_1907232_+|tRNA	asparagine--tRNA ligase	tRNA	M1PB22	Moumouvirus	30.0	1.3e-55
ASE59369.1|1907324_1908011_+	DnaD domain protein	NA	Q938N2	Temperate_phage	34.9	4.2e-08
>prophage 149
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1911615	1912242	2578483		Paenibacillus_phage(100.0%)	1	NA	NA
ASE59373.1|1911615_1912242_-	Holliday junction resolvase RecU	NA	R9TMF8	Paenibacillus_phage	34.1	1.3e-24
>prophage 150
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1922483	1938708	2578483		Staphylococcus_phage(37.5%)	21	NA	NA
ASE59380.1|1922483_1923365_+	flap endonuclease	NA	A0A1S6L2U4	Erwinia_phage	28.1	8.4e-17
ASE59381.1|1923640_1924048_-	ribonuclease H	NA	NA	NA	NA	NA
ASE59382.1|1924210_1924792_+	serine hydrolase family protein	NA	NA	NA	NA	NA
ASE59383.1|1924808_1925513_-	hypothetical protein	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	24.6	7.1e-11
ASE59384.1|1925764_1925959_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
ASE59385.1|1925976_1926234_+	scaffolding protein	NA	NA	NA	NA	NA
ASE59386.1|1926249_1927368_+	virulence factor C	NA	NA	NA	NA	NA
ASE59387.1|1927405_1927840_+	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
ASE59388.1|1928131_1929088_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	83.6	9.3e-163
ASE59389.1|1929182_1929668_+	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	76.6	5.7e-68
ASE59390.1|1929678_1930518_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	71.4	5.3e-45
ASE59391.1|1930648_1931176_+	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
ASE59392.1|1931168_1931597_+	peptide-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
ASE59393.1|1931611_1932112_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
ASE59394.1|1932111_1932333_+	YozE family protein	NA	NA	NA	NA	NA
ASE59395.1|1932488_1933964_+	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	29.9	1.1e-21
ASE59396.1|1933985_1934495_+	N-acetyltransferase	NA	NA	NA	NA	NA
ASE59397.1|1934505_1935582_+	undecaprenyldiphospho-muramoylpentapeptide beta-N- acetylglucosaminyltransferase	NA	NA	NA	NA	NA
ASE59398.1|1935594_1936209_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
ASE59399.1|1936693_1937356_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.6	7.1e-37
ASE59400.1|1937352_1938708_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	28.7	4.4e-25
>prophage 151
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1950775	1954799	2578483		Staphylococcus_phage(50.0%)	6	NA	NA
ASE59407.1|1950775_1951591_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	5.4e-10
ASE59408.1|1951592_1952297_+	ABC transporter permease	NA	NA	NA	NA	NA
ASE59409.1|1952405_1952606_-	Mid2-like cell wall stress sensor domain protein	NA	NA	NA	NA	NA
ASE59410.1|1952823_1953636_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
ASE59411.1|1953650_1953854_+	hypothetical protein	NA	NA	NA	NA	NA
ASE59412.1|1954007_1954799_+	MoxR family ATPase	NA	R4TG24	Halovirus	25.7	2.8e-11
>prophage 152
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1958398	1964672	2578483		Vibrio_phage(25.0%)	7	NA	NA
ASE59415.1|1958398_1960030_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	21.6	1.7e-10
ASE59416.1|1960079_1961213_-	toxic anion resistance protein TelA	NA	A0A291I9K4	Lactobacillus_phage	26.7	2.9e-30
ASE59417.1|1961247_1961868_-	5-bromo-4-chloroindolyl phosphate hydrolase	NA	NA	NA	NA	NA
ASE59418.1|1961881_1962151_-	acylphosphatase	NA	NA	NA	NA	NA
ASE59419.1|1962497_1962806_+	DUF1033 domain-containing protein	NA	NA	NA	NA	NA
ASE59420.1|1962993_1963194_+	cold-shock protein CspA	NA	Q9AZD3	Lactococcus_phage	64.6	2.5e-17
ASE59421.1|1963406_1964672_-	diaminopimelate decarboxylase	NA	A0A0P0YM38	Yellowstone_lake_phycodnavirus	22.7	2.0e-11
>prophage 153
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1972231	1974883	2578483		Staphylococcus_phage(50.0%)	2	NA	NA
ASE59429.1|1972231_1973062_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.3	4.6e-49
ASE59430.1|1973278_1974883_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	26.2	2.1e-50
>prophage 154
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1979388	1982788	2578483		Indivirus(50.0%)	3	NA	NA
ASE59435.1|1979388_1980264_+	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.1	5.9e-15
ASE59436.1|1980271_1980922_+	phosphate transport system regulatory protein PhoU	NA	NA	NA	NA	NA
ASE59437.1|1980976_1982788_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	46.5	2.0e-150
>prophage 155
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	1992540	1994888	2578483		Acinetobacter_phage(100.0%)	3	NA	NA
ASE59446.1|1992540_1993323_-	indole-3-glycerol-phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	38.4	9.3e-28
ASE59447.1|1993306_1994323_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	30.0	1.1e-31
ASE59448.1|1994291_1994888_-	glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	33.7	2.1e-24
>prophage 156
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2002936	2004199	2578483		Bacillus_phage(100.0%)	1	NA	NA
ASE59457.1|2002936_2004199_-	DNA repair protein	NA	O64031	Bacillus_phage	42.0	2.0e-88
>prophage 157
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2008225	2009716	2578483		Staphylococcus_phage(100.0%)	1	NA	NA
ASE59461.1|2008225_2009716_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.5	1.5e-18
>prophage 158
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2020793	2025187	2578483		Bacillus_virus(100.0%)	2	NA	NA
AVK72473.1|2020793_2023196_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	32.7	5.5e-103
ASE59998.1|2023192_2025187_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	41.4	7.7e-119
>prophage 159
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2030250	2031894	2578483		Vibrio_phage(100.0%)	1	NA	NA
ASE59474.1|2030250_2031894_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.0	3.6e-21
>prophage 160
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2035621	2036752	2578483		Staphylococcus_phage(100.0%)	1	NA	NA
ASE59477.1|2035621_2036752_-	exonuclease sbcCD subunit D	NA	A1YTR7	Staphylococcus_phage	24.7	6.1e-12
>prophage 161
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2041652	2047227	2578483		Phage_Wrath(25.0%)	6	NA	NA
ASE59483.1|2041652_2042276_+	LexA repressor	NA	A0A1B2APZ1	Phage_Wrath	63.8	4.5e-17
ASE59484.1|2042475_2043498_-	secretion protein	NA	U5Q0C0	Bacillus_phage	40.7	2.4e-15
ASE59485.1|2043501_2044488_-	guanosine monophosphate reductase	NA	Q4ZCY7	Staphylococcus_virus	90.5	4.7e-170
ASE59486.1|2044677_2044947_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
ASE59487.1|2045162_2045312_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
ASE59488.1|2045739_2047227_-	catalase	NA	A0A2K9L0T1	Tupanvirus	43.6	4.3e-90
>prophage 162
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2057904	2062172	2578483		Bacillus_phage(50.0%)	6	NA	NA
ASE59999.1|2057904_2058435_-	thermonuclease	NA	A0A1P8CWK6	Bacillus_phage	48.1	4.0e-22
ASE59499.1|2058606_2058798_+	hypothetical protein	NA	NA	NA	NA	NA
ASE59500.1|2058879_2059482_-	DNA-binding response regulator	NA	NA	NA	NA	NA
ASE59501.1|2059481_2060573_-	sensor histidine kinase	NA	NA	NA	NA	NA
ASE59502.1|2060569_2061304_-	ABC transporter permease	NA	NA	NA	NA	NA
ASE59503.1|2061305_2062172_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.7	8.5e-22
>prophage 163
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2067829	2068303	2578483		Canarypox_virus(100.0%)	1	NA	NA
ASE59507.1|2067829_2068303_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	40.1	1.3e-24
>prophage 164
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2074330	2081749	2578483		Acanthocystis_turfacea_Chlorella_virus(33.33%)	5	NA	NA
ASE59512.1|2074330_2075149_-	aquaporin family protein	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	36.0	2.1e-30
ASE59513.1|2075320_2076355_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
ASE59514.1|2076560_2077094_-	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
ASE59515.1|2077105_2079073_-	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	29.9	2.1e-60
ASE59516.1|2079085_2081749_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	25.1	1.9e-40
>prophage 165
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2086900	2087527	2578483		Staphylococcus_phage(100.0%)	1	NA	NA
AVK72478.1|2086900_2087527_-	hypothetical protein	NA	A0A0D3MVF0	Staphylococcus_phage	38.7	3.8e-40
>prophage 166
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2093813	2094863	2578483		Bacillus_phage(100.0%)	1	NA	NA
ASE59526.1|2093813_2094863_-	DNA recombination/repair protein RecA	NA	A0A0S2MVG1	Bacillus_phage	65.0	2.7e-123
>prophage 167
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2099346	2105105	2578483		Bacillus_virus(33.33%)	4	NA	NA
ASE59532.1|2099346_2100639_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	26.4	2.7e-16
ASE59533.1|2100638_2101928_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	25.7	2.5e-38
ASE59534.1|2101938_2102652_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
ASE59535.1|2102654_2105105_-	cell division protein FtsK	NA	S5VNE3	Mycobacterium_phage	47.7	9.0e-85
>prophage 168
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2115555	2124573	2578483		Bodo_saltans_virus(50.0%)	6	NA	NA
ASE59543.2|2115555_2117661_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.8	3.3e-19
ASE59544.1|2117665_2117983_-	hypothetical protein	NA	NA	NA	NA	NA
ASE59545.1|2117979_2118264_-	DUF448 domain-containing protein	NA	NA	NA	NA	NA
AVK72479.1|2118281_2119475_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
ASE59546.1|2119498_2119966_-	ribosome maturation factor	NA	NA	NA	NA	NA
AVK72480.1|2120256_2124573_-	PolC-type DNA polymerase III	NA	A0A0A8WJ41	Clostridium_phage	40.7	3.6e-20
>prophage 169
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2129109	2129874	2578483		Flavobacterium_phage(100.0%)	1	NA	NA
ASE59550.1|2129109_2129874_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	44.4	3.5e-27
>prophage 170
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2134327	2145292	2578483	tRNA,protease	Erwinia_phage(20.0%)	9	NA	NA
ASE59556.1|2134327_2135740_-	HslU--HslV peptidase ATPase subunit	NA	A0A1B2IDZ7	Erwinia_phage	27.0	4.7e-30
ASE59557.1|2135852_2136395_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
ASE59558.1|2136398_2137289_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	30.5	1.1e-27
ASE59559.1|2137407_2138715_-|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
ASE59560.1|2138869_2140936_-	DNA topoisomerase 1	NA	A0A1V0SCS0	Indivirus	38.8	1.5e-104
ASE59561.1|2141138_2142014_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
ASE59562.1|2142320_2143226_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	33.2	3.9e-17
ASE59563.1|2143247_2144414_-	succinyl-CoA ligase subunit beta	NA	NA	NA	NA	NA
ASE59564.1|2144521_2145292_-	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	42.0	1.1e-25
>prophage 171
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2163459	2165633	2578483		Acanthamoeba_polyphaga_moumouvirus(33.33%)	3	NA	NA
ASE59577.1|2163459_2164194_-	ribonuclease 3	NA	L7RCJ8	Acanthamoeba_polyphaga_moumouvirus	32.2	3.4e-24
ASE59578.1|2164421_2164655_-	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	61.7	3.5e-07
ASE59579.1|2164898_2165633_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.9	1.6e-16
>prophage 172
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2179135	2181190	2578483		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
ASE59593.1|2179135_2181190_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	L7RGQ5	Acanthamoeba_polyphaga_moumouvirus	32.1	4.8e-23
>prophage 173
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2184339	2185272	2578483	tRNA	Prochlorococcus_phage(100.0%)	1	NA	NA
ASE60001.1|2184339_2185272_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	31.0	5.6e-11
>prophage 174
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2189796	2196732	2578483		Methanothermobacter_phage(33.33%)	8	NA	NA
ASE59600.1|2189796_2191005_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.1	2.5e-43
ASE59601.1|2191241_2191454_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
ASE59602.1|2191453_2192077_-	guanylate kinase	NA	NA	NA	NA	NA
ASE59603.1|2192236_2193934_+	DUF814 domain-containing protein	NA	A0A0P0YM59	Yellowstone_lake_phycodnavirus	33.3	1.7e-05
ASE59604.1|2194036_2194444_-	hypothetical protein	NA	NA	NA	NA	NA
ASE59605.1|2194536_2195391_-	YitT family protein	NA	NA	NA	NA	NA
ASE59606.1|2195912_2196098_-	hypothetical protein	NA	NA	NA	NA	NA
ASE59607.1|2196120_2196732_-	orotate phosphoribosyltransferase	NA	S4W4D9	Pandoravirus	36.4	3.4e-25
>prophage 175
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2200688	2205303	2578483		Halovirus(33.33%)	4	NA	NA
ASE59610.1|2200688_2201789_-	carbamoyl-phosphate synthase small chain	NA	R4TGJ8	Halovirus	34.8	7.4e-63
ASE59611.1|2201788_2203063_-	dihydroorotase	NA	NA	NA	NA	NA
ASE59612.1|2203059_2203962_-	aspartate carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	31.4	1.0e-25
ASE59613.1|2203995_2205303_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	35.0	8.5e-58
>prophage 176
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2209235	2211986	2578483	tRNA	Klosneuvirus(100.0%)	1	NA	NA
ASE59618.1|2209235_2211986_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	27.8	6.7e-89
>prophage 177
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2235449	2245444	2578483	transposase,integrase	uncultured_Caudovirales_phage(42.86%)	12	2240469:2240490	2243873:2243894
AVK72502.1|2235449_2237807_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.9	6.2e-160
ASE59640.1|2237999_2238314_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
ASE59641.1|2238454_2239363_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	43.5	8.0e-47
ASE59642.1|2239323_2240007_-	hypothetical protein	NA	NA	NA	NA	NA
2240469:2240490	attL	GTGCCATGCCAGTGCCATAAAA	NA	NA	NA	NA
ASE59643.1|2240737_2240929_-	hypothetical protein	NA	A0A2H4J314	uncultured_Caudovirales_phage	58.9	1.2e-10
ASE59644.1|2241242_2241653_-	YolD-like family protein	NA	A0A2H4JEH6	uncultured_Caudovirales_phage	90.4	2.2e-68
ASE59645.1|2241662_2241854_-	hypothetical protein	NA	A0A2H4JGI3	uncultured_Caudovirales_phage	95.2	7.0e-30
ASE59646.1|2241949_2242198_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
ASE59647.1|2242489_2242741_-	hypothetical protein	NA	NA	NA	NA	NA
ASE59648.1|2242815_2243859_+|integrase	site-specific integrase	integrase	A0A1W6JQE7	Staphylococcus_phage	62.8	2.4e-119
ASE59649.1|2244353_2244863_-	metallophosphoesterase	NA	NA	NA	NA	NA
2243873:2243894	attR	GTGCCATGCCAGTGCCATAAAA	NA	NA	NA	NA
ASE59650.1|2244859_2245444_-	XTP/dITP diphosphatase	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	30.5	5.2e-15
>prophage 178
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2252029	2256496	2578483		Staphylococcus_phage(33.33%)	3	NA	NA
ASE59656.1|2252029_2252344_-	thiol reductase thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	47.6	6.6e-25
ASE59657.1|2252425_2254774_-	endonuclease MutS2	NA	F2QAF8	Phaeocystis_pouchetii_virus	24.9	3.0e-13
ASE59658.1|2254783_2256496_-	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	26.8	1.3e-18
>prophage 179
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2261343	2262402	2578483	tRNA	Orpheovirus(100.0%)	1	NA	NA
ASE59663.1|2261343_2262402_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	37.9	1.9e-31
>prophage 180
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2267081	2269987	2578483		uncultured_Mediterranean_phage(50.0%)	5	NA	NA
ASE59669.1|2267081_2267567_-	phosphopantetheine adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.4	7.1e-26
ASE59670.1|2267568_2268111_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
ASE59671.1|2268180_2268570_+	hypothetical protein	NA	NA	NA	NA	NA
ASE59672.1|2268680_2268932_-	DUF2129 domain-containing protein	NA	NA	NA	NA	NA
ASE59673.1|2269063_2269987_+	glycerophosphodiester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	25.5	1.9e-11
>prophage 181
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2283921	2285769	2578483		Erysipelothrix_phage(100.0%)	1	NA	NA
ASE59683.1|2283921_2285769_-	translational GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	23.5	3.1e-21
>prophage 182
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2294076	2302894	2578483		Mycoplasma_phage(25.0%)	9	NA	NA
ASE59693.1|2294076_2295171_-	spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	43.5	8.2e-38
ASE59694.1|2295183_2295723_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
ASE59695.1|2295864_2296143_-	hypothetical protein	NA	NA	NA	NA	NA
ASE59696.1|2296375_2297782_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.7	3.3e-47
ASE59697.1|2297785_2299087_-	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
ASE59698.1|2299231_2300209_-	alpha-ketoacid dehydrogenase subunit beta	NA	A0A0K0KW14	Prochlorococcus_phage	24.8	3.9e-07
ASE59699.1|2300212_2301325_-	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
ASE59700.1|2301591_2302218_-	hypothetical protein	NA	NA	NA	NA	NA
ASE59701.1|2302342_2302894_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.7	4.9e-15
>prophage 183
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2313295	2314465	2578483		Streptococcus_phage(100.0%)	1	NA	NA
ASE59712.1|2313295_2314465_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	42.6	1.6e-76
>prophage 184
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2317568	2332175	2578483		Prochlorococcus_phage(22.22%)	14	NA	NA
ASE59715.1|2317568_2318984_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.6	2.5e-15
ASE59716.1|2318976_2319783_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
ASE59717.1|2319875_2321120_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
ASE59718.1|2321144_2322623_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/inosine monophosphate cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.2	3.2e-77
ASE59719.1|2322638_2323205_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.2	9.7e-27
ASE59720.1|2323207_2324236_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	4.6e-67
ASE59721.1|2324228_2325716_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.7	1.6e-44
ASE59722.1|2325694_2327884_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.6	1.4e-137
ASE59723.1|2327876_2328548_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
ASE59724.1|2328547_2328808_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
ASE59725.1|2328810_2329512_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SE76	Cyanophage	42.5	6.8e-46
ASE59726.1|2329516_2330644_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
ASE59727.1|2330630_2331113_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.0	2.6e-20
ASE59728.1|2331317_2332175_+	bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/5,10-methylene-tetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	38.6	3.5e-36
>prophage 185
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2340935	2342594	2578483		Streptococcus_phage(100.0%)	1	NA	NA
ASE59737.1|2340935_2342594_-	phosphoglucomutase	NA	A0A1X9I671	Streptococcus_phage	36.3	9.3e-94
>prophage 186
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2345685	2350077	2578483		Staphylococcus_virus(100.0%)	1	NA	NA
ASE59741.1|2345685_2350077_+	autolysin	NA	Q4ZE13	Staphylococcus_virus	46.2	4.3e-53
>prophage 187
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2369093	2373980	2578483		Pithovirus(33.33%)	3	NA	NA
ASE59759.1|2369093_2370887_-	PDZ domain-containing protein	NA	W5SAB9	Pithovirus	26.6	3.8e-08
AVK72487.1|2371257_2372058_-	hypothetical protein	NA	S5MAL1	Bacillus_phage	38.9	3.9e-29
ASE59760.1|2372417_2373980_-	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	30.8	4.8e-15
>prophage 188
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2393738	2395547	2578483		Streptococcus_phage(100.0%)	1	NA	NA
ASE59778.1|2393738_2395547_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	24.2	1.1e-47
>prophage 189
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2401315	2403332	2578483		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
ASE59784.1|2401315_2402260_-	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.1	5.4e-06
ASE59785.1|2402249_2403332_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.4	1.1e-21
>prophage 190
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2410476	2415306	2578483		Cronobacter_phage(50.0%)	2	NA	NA
ASE59792.1|2410476_2413086_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	37.3	2.9e-118
AVK72489.1|2413473_2415306_-	acetyltransferase	NA	A0A166XZF2	Gordonia_phage	30.0	3.1e-29
>prophage 191
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2420986	2424646	2578483		Bacillus_virus(100.0%)	1	NA	NA
ASE59799.1|2420986_2424646_-	helicase-exonuclease AddAB subunit AddA	NA	G3MA40	Bacillus_virus	24.8	7.2e-22
>prophage 192
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2434917	2441577	2578483		Staphylococcus_phage(33.33%)	6	NA	NA
ASE59807.1|2434917_2435907_+	glycerophosphodiester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	34.7	1.1e-30
ASE59808.1|2436010_2437255_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
ASE59809.1|2437365_2438556_-	Ornithine aminotransferase 2	NA	A0A1V0SKB7	Klosneuvirus	28.8	5.0e-33
ASE59810.1|2438928_2440062_-	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
ASE59811.1|2440295_2440676_-	general stress protein	NA	NA	NA	NA	NA
ASE59812.1|2440983_2441577_-	peptidylprolyl isomerase	NA	A0A076FI46	Aureococcus_anophage	40.0	1.6e-24
>prophage 193
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2451775	2455301	2578483		Mycoplasma_phage(50.0%)	3	NA	NA
ASE59824.1|2451775_2453257_-	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	36.6	5.3e-48
ASE59825.1|2453498_2454707_-	NADH dehydrogenase	NA	NA	NA	NA	NA
ASE59826.1|2454941_2455301_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	41.6	4.9e-16
>prophage 194
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2459490	2462165	2578483		Pseudomonas_phage(50.0%)	2	NA	NA
ASE59832.1|2459490_2460705_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	28.7	2.1e-18
ASE59833.1|2460701_2462165_-	D-alanine--poly(phosphoribitol) ligase subunit 1	NA	A0A2K9L3I8	Tupanvirus	28.3	2.1e-36
>prophage 195
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2469172	2470021	2578483		Kurlavirus(100.0%)	1	NA	NA
ASE59843.1|2469172_2470021_-	DUF72 domain-containing protein	NA	A0A1S5XY79	Kurlavirus	29.0	2.5e-18
>prophage 196
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2475153	2478721	2578483		environmental_halophage(50.0%)	3	NA	NA
ASE59848.1|2475153_2476401_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	43.6	9.8e-104
ASE59849.1|2476550_2477858_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
ASE59850.1|2477959_2478721_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	26.4	3.2e-09
>prophage 197
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2483536	2487140	2578483		Planktothrix_phage(50.0%)	6	NA	NA
ASE59856.1|2483536_2484562_-	methionine import ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	38.2	7.7e-30
ASE59857.1|2484813_2485113_-	thioredoxin	NA	NA	NA	NA	NA
ASE59858.1|2485109_2485502_-	topiosmerase	NA	NA	NA	NA	NA
ASE59859.1|2485767_2486148_-	glycine cleavage system protein H	NA	NA	NA	NA	NA
ASE59860.1|2486320_2486677_-	arsenate reductase family protein	NA	NA	NA	NA	NA
ASE59861.1|2486819_2487140_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	35.4	4.0e-09
>prophage 198
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2505797	2507453	2578483		Bacillus_phage(50.0%)	3	NA	NA
ASE59885.1|2505797_2506217_-	FosB/FosD family fosfomycin resistance bacillithiol transferase	NA	Q2LI91	Bacillus_phage	61.2	5.5e-35
ASE59886.1|2506252_2506720_-	N-acetyltransferase	NA	NA	NA	NA	NA
ASE59887.1|2507261_2507453_-	hypothetical protein	NA	U3PCX8	Staphylococcus_phage	100.0	2.9e-31
>prophage 199
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2511633	2517983	2578483		Staphylococcus_phage(33.33%)	7	NA	NA
ASE59891.1|2511633_2512098_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	92.9	1.2e-75
ASE59892.1|2512120_2514511_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	38.4	2.4e-90
ASE59893.1|2514549_2515290_-	carboxylesterase	NA	NA	NA	NA	NA
ASE59894.1|2515423_2515657_-	protein-export membrane protein SecG	NA	NA	NA	NA	NA
ASE59895.1|2515725_2516187_-	hypothetical protein	NA	NA	NA	NA	NA
ASE59896.1|2516510_2516690_+	hypothetical protein	NA	NA	NA	NA	NA
ASE59897.1|2516678_2517983_-	enolase	NA	W6LP63	Streptococcus_phage	78.4	1.1e-190
>prophage 200
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2527368	2534553	2578483		Streptococcus_phage(40.0%)	6	NA	NA
ASE59907.1|2527368_2527953_-	ATP-dependent Clp endopeptidase, proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.8	4.8e-53
ASE59908.1|2529272_2530118_-	YitT family protein	NA	NA	NA	NA	NA
ASE59909.1|2530356_2531301_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.6	2.4e-54
AVK72492.1|2531339_2532350_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	40.8	6.2e-48
ASE59910.1|2532336_2533263_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	37.0	1.4e-09
AVK72493.1|2533608_2534553_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	49.5	7.2e-83
>prophage 201
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2538644	2541482	2578483		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVK72495.1|2538644_2541482_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.9	1.0e-310
>prophage 202
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2545073	2546027	2578483		Staphylococcus_phage(100.0%)	1	NA	NA
ASE59917.1|2545073_2546027_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A220BXB4	Staphylococcus_phage	41.3	1.2e-08
>prophage 203
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2551872	2554905	2578483		Streptococcus_phage(100.0%)	3	NA	NA
ASE59920.2|2551872_2553210_-	DNA/RNA helicase	NA	A0A1X9I5S6	Streptococcus_phage	33.3	6.2e-48
ASE59921.1|2553231_2554095_-	DegV family protein	NA	NA	NA	NA	NA
ASE59922.1|2554263_2554905_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	43.7	2.0e-36
>prophage 204
CP022056	Staphylococcus saprophyticus strain FDAARGOS_336 chromosome, complete genome	2578483	2567382	2577894	2578483		uncultured_Caudovirales_phage(57.14%)	9	NA	NA
ASE59936.1|2567382_2568183_-	iron ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.4	1.2e-14
ASE59937.1|2568179_2569139_-	iron ABC transporter permease	NA	NA	NA	NA	NA
ASE59938.1|2569128_2570097_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	78.3	2.6e-136
ASE59939.1|2570510_2571479_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	94.4	2.2e-175
ASE59940.1|2571602_2573708_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	90.0	0.0e+00
ASE59941.1|2573670_2574069_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	76.5	8.6e-54
ASE59942.1|2574795_2575683_+	EamA/RhaT family transporter	NA	NA	NA	NA	NA
ASE59943.1|2575696_2576197_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	72.3	2.0e-52
ASE59944.1|2576379_2577894_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	35.8	9.5e-69
>prophage 1
CP022055	Staphylococcus saprophyticus strain FDAARGOS_336 plasmid unnamed1, complete sequence	31132	5227	12471	31132	transposase	Staphylococcus_phage(33.33%)	9	NA	NA
ASE57725.1|5227_5902_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	96.9	2.7e-124
ASE57726.1|6353_6932_+	HTH domain-containing protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.7	6.4e-42
ASE57727.1|7057_7678_+	transposon DNA-invertase	NA	E5FFF9	Burkholderia_phage	32.2	7.2e-15
ASE57728.1|7732_7990_-	hypothetical protein	NA	NA	NA	NA	NA
ASE57729.1|8003_8546_-	resolvase	NA	NA	NA	NA	NA
ASE57730.1|8658_10110_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	51.8	4.6e-121
ASE57731.1|10123_10537_+	universal stress protein	NA	NA	NA	NA	NA
ASE57732.1|11163_11709_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	42.0	4.1e-30
ASE57733.1|11793_12471_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	98.2	4.2e-125
