The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP022053	Stenotrophomonas maltophilia strain FDAARGOS_325 chromosome, complete genome	4851512	628234	645910	4851512	transposase,capsid	Stenotrophomonas_phage(88.24%)	23	NA	NA
ASE51769.1|628234_629405_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.7	1.5e-90
ASE51770.1|629833_630349_+	hypothetical protein	NA	NA	NA	NA	NA
ASE51771.1|630389_630857_-	helix-turn-helix domain-containing protein	NA	Q4LAU6	Stenotrophomonas_phage	54.5	3.7e-24
ASE51772.1|630990_631218_+	hypothetical protein	NA	S0F3S0	Stenotrophomonas_phage	69.6	3.3e-10
ASE51773.1|631501_632608_+	replication protein	NA	S0F3I3	Stenotrophomonas_phage	95.7	1.2e-209
ASE51774.1|632614_632917_+	single-stranded DNA-binding protein	NA	B1NI78	Stenotrophomonas_phage	93.8	1.6e-44
ASE51775.1|632920_633178_+	hypothetical protein	NA	S0F2C2	Stenotrophomonas_phage	100.0	7.0e-41
ASE51776.1|633224_633359_+|capsid	capsid protein	capsid	NA	NA	NA	NA
ASE51779.1|634945_635344_+	hypothetical protein	NA	S0F3B3	Stenotrophomonas_phage	87.1	1.1e-56
AVK73105.1|635348_636641_+	Zona occludens toxin	NA	S0F2C3	Stenotrophomonas_phage	96.7	2.2e-244
ASE51780.1|636654_636906_-	hypothetical protein	NA	NA	NA	NA	NA
ASE51781.1|637180_637504_-	hypothetical protein	NA	S0F2C0	Stenotrophomonas_phage	94.4	8.5e-52
ASE51782.1|637708_638089_+	hypothetical protein	NA	B1NI82	Stenotrophomonas_phage	85.7	7.9e-57
AVK73240.1|638125_638356_-	hypothetical protein	NA	NA	NA	NA	NA
AVK73106.1|638575_639868_-	Zona occludens toxin	NA	S0F2C3	Stenotrophomonas_phage	96.3	2.5e-243
ASE51783.1|639872_640271_-	hypothetical protein	NA	S0F3B3	Stenotrophomonas_phage	87.1	1.1e-56
ASE51786.1|641857_641992_-|capsid	capsid protein	capsid	NA	NA	NA	NA
ASE51787.1|642038_642296_-	hypothetical protein	NA	S0F2C2	Stenotrophomonas_phage	100.0	7.0e-41
ASE51788.1|642299_642602_-	single-stranded DNA-binding protein	NA	B1NI78	Stenotrophomonas_phage	93.8	1.6e-44
ASE51789.1|642608_643715_-	replication protein	NA	S0F3I3	Stenotrophomonas_phage	95.4	4.5e-209
ASE51790.1|643877_644105_-	hypothetical protein	NA	NA	NA	NA	NA
ASE51791.2|644237_644759_+	hypothetical protein	NA	S0F2J2	Stenotrophomonas_phage	69.2	8.6e-38
ASE51792.1|644791_645910_+	two-component sensor histidine kinase	NA	A0A1B0VMK3	Pseudomonas_phage	38.1	6.6e-59
>prophage 2
CP022053	Stenotrophomonas maltophilia strain FDAARGOS_325 chromosome, complete genome	4851512	1070843	1101299	4851512	integrase,tail	Pseudomonas_phage(63.64%)	33	1074515:1074530	1104663:1104678
AVK73118.1|1070843_1071605_-	DNA adenine methylase	NA	Q5ZQW7	Pseudomonas_phage	56.6	3.6e-77
ASE52140.1|1071751_1072498_-	hypothetical protein	NA	NA	NA	NA	NA
ASE52141.1|1072503_1074768_-	hypothetical protein	NA	J9RWA5	Pseudomonas_phage	39.6	1.4e-137
1074515:1074530	attL	CCCTTGTCGCCGCCAA	NA	NA	NA	NA
ASE52142.1|1074760_1074988_-	hypothetical protein	NA	NA	NA	NA	NA
ASE52143.1|1074987_1075218_-	hypothetical protein	NA	A0A0S0MV97	Pseudomonas_phage	62.7	8.8e-19
ASE52144.1|1075228_1076014_-	DUF2163 domain-containing protein	NA	D2K0A8	Staphylococcus_phage	34.4	5.0e-37
ASE52145.2|1076007_1077624_-	hypothetical protein	NA	J9SU43	Pseudomonas_phage	42.4	4.8e-111
ASE52146.1|1077707_1078685_-	hypothetical protein	NA	A0A0S4L5N6	Pseudomonas_phage	26.1	5.4e-09
ASE52147.1|1078692_1079667_-	hypothetical protein	NA	A0A0S0N918	Pseudomonas_phage	26.3	2.9e-18
ASE52148.1|1079669_1083227_-|tail	phage tail tape-measure protein	tail	A0A1V0E8B0	Vibrio_phage	28.4	1.8e-25
ASE52149.1|1083353_1083872_-	hypothetical protein	NA	NA	NA	NA	NA
ASE52150.1|1083871_1084636_-	hypothetical protein	NA	Q5ZQX2	Pseudomonas_phage	45.4	7.2e-57
ASE52151.1|1084796_1085276_-	hypothetical protein	NA	A0A0S4L2X9	Pseudomonas_phage	45.8	4.0e-29
ASE52152.1|1085272_1085803_-	DUF1320 domain-containing protein	NA	Q5ZQX5	Pseudomonas_phage	45.3	8.5e-33
ASE52153.1|1085811_1086294_-	hypothetical protein	NA	NA	NA	NA	NA
ASE52154.1|1086454_1087399_-	hypothetical protein	NA	G8GWE7	Rhodobacter_phage	43.8	2.0e-69
ASE55301.1|1087427_1087736_-	DUF2190 domain-containing protein	NA	NA	NA	NA	NA
ASE52155.1|1087791_1088934_-	peptidase	NA	Q5ZQY0	Pseudomonas_phage	48.6	8.7e-67
ASE52156.1|1089148_1089727_-	phage virion morphogenesis protein	NA	A0A2H4J9E5	uncultured_Caudovirales_phage	53.0	9.0e-36
ASE52157.1|1089723_1090998_-	hypothetical protein	NA	J9STS2	Pseudomonas_phage	60.1	6.1e-85
ASE52158.1|1091001_1092525_-	DUF935 domain-containing protein	NA	Q5ZQY4	Pseudomonas_phage	58.6	3.3e-162
ASE52159.1|1092521_1094252_-	hypothetical protein	NA	A0A219VH72	Ochrobactrum_phage	42.3	6.7e-103
ASE52160.1|1094252_1094810_-	DUF3486 domain-containing protein	NA	A4JWJ3	Burkholderia_virus	47.0	3.3e-35
ASE55302.1|1094814_1095111_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.2	1.2e-31
ASE52161.1|1095118_1095433_-	hypothetical protein	NA	Q5ZQY8	Pseudomonas_phage	35.8	1.4e-11
ASE52162.1|1095691_1096174_-	hypothetical protein	NA	NA	NA	NA	NA
ASE52163.1|1096170_1096902_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	50.0	4.3e-35
ASE52164.1|1097103_1097487_-	hypothetical protein	NA	NA	NA	NA	NA
ASE52165.1|1097483_1097942_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVK73119.1|1098040_1098253_+	hypothetical protein	NA	NA	NA	NA	NA
ASE52166.1|1098285_1098558_+	hypothetical protein	NA	NA	NA	NA	NA
ASE52167.1|1098573_1099491_+	hypothetical protein	NA	NA	NA	NA	NA
ASE52168.1|1099493_1101299_+|integrase	integrase	integrase	Q6QIE0	Burkholderia_phage	43.7	3.2e-124
1104663:1104678	attR	TTGGCGGCGACAAGGG	NA	NA	NA	NA
>prophage 3
CP022053	Stenotrophomonas maltophilia strain FDAARGOS_325 chromosome, complete genome	4851512	1930023	2037214	4851512	transposase,capsid,integrase,tail,plate	Escherichia_phage(20.0%)	99	1923928:1923958	1994385:1994415
1923928:1923958	attL	CCGTGCCGACCAACGGTCGGCACCCACCGGA	NA	NA	NA	NA
ASE52921.1|1930023_1930938_+|transposase	IS110 family transposase ISStma7	transposase	Q75QL1	Wolbachia_phage	33.8	8.7e-25
ASE55336.1|1931166_1932066_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
ASE52922.1|1932113_1933097_-	aldo/keto reductase	NA	NA	NA	NA	NA
ASE52923.1|1933304_1934447_-	type IV pili twitching motility protein PilT	NA	NA	NA	NA	NA
ASE52924.1|1934547_1935585_-	type IV pili twitching motility protein PilT	NA	NA	NA	NA	NA
ASE52925.1|1935672_1936350_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
ASE52926.1|1936368_1937190_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
ASE52927.1|1937249_1938125_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
ASE52928.1|1938223_1938826_+	short chain dehydrogenase	NA	NA	NA	NA	NA
ASE52929.1|1938898_1939333_-	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
AVK73145.1|1939362_1940784_+	MFS transporter	NA	NA	NA	NA	NA
ASE52930.1|1940872_1942894_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
ASE52931.1|1942893_1943868_-	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
ASE52932.1|1944039_1944444_+	GFA family protein	NA	NA	NA	NA	NA
ASE55337.1|1944723_1946241_-	MFS transporter	NA	NA	NA	NA	NA
ASE52933.1|1946348_1947284_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
ASE52934.1|1947323_1948187_-	EamA/RhaT family transporter	NA	NA	NA	NA	NA
ASE52935.1|1948320_1949700_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
ASE52936.1|1949638_1950583_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
ASE52937.1|1950698_1951397_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
ASE52938.1|1951484_1952159_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
ASE52939.1|1952162_1952810_-	Qnr family pentapeptide repeat protein	NA	NA	NA	NA	NA
ASE52940.1|1952967_1953744_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
ASE52941.1|1953755_1954889_+	MFS transporter	NA	NA	NA	NA	NA
ASE52942.1|1954955_1956236_-	hypothetical protein	NA	NA	NA	NA	NA
ASE52943.1|1956403_1957909_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
ASE52944.1|1957920_1960059_-	TonB-dependent receptor	NA	NA	NA	NA	NA
ASE52945.1|1960188_1960584_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
ASE52946.1|1960794_1961049_-	hypothetical protein	NA	NA	NA	NA	NA
ASE52947.1|1961060_1961285_-	hypothetical protein	NA	NA	NA	NA	NA
AVK73146.1|1961771_1964108_+|integrase	integrase	integrase	D5LH15	Escherichia_phage	43.1	9.0e-135
ASE52948.1|1964108_1964384_+	hypothetical protein	NA	NA	NA	NA	NA
ASE52949.1|1964458_1964686_+	hypothetical protein	NA	NA	NA	NA	NA
ASE52950.1|1964727_1965366_+	hypothetical protein	NA	A0A2H4J8A1	uncultured_Caudovirales_phage	37.6	5.8e-20
ASE52951.1|1965518_1965902_+	hypothetical protein	NA	NA	NA	NA	NA
ASE52952.1|1966236_1966686_+	hypothetical protein	NA	NA	NA	NA	NA
AVK73147.1|1966682_1967033_+	hypothetical protein	NA	NA	NA	NA	NA
ASE52953.1|1967029_1967515_+	glycoside hydrolase	NA	D5LH07	Escherichia_phage	55.6	5.4e-42
ASE52954.1|1967511_1967889_+	hypothetical protein	NA	NA	NA	NA	NA
ASE52955.1|1968242_1968797_+	hypothetical protein	NA	NA	NA	NA	NA
ASE52956.1|1968793_1969384_+|plate	phage baseplate assembly protein V	plate	A0A193GYL5	Enterobacter_phage	37.7	3.6e-24
ASE52957.1|1969436_1969775_+|plate	phage baseplate protein	plate	A0A193GYY8	Enterobacter_phage	62.2	7.8e-32
ASE52958.1|1969777_1970674_+|plate	baseplate assembly protein	plate	V5YTH6	Pseudomonas_phage	56.5	6.4e-81
ASE52959.1|1970666_1971446_+|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	51.1	7.1e-44
ASE52960.1|1971453_1973421_+|tail	phage tail protein	tail	V9IQX0	Stenotrophomonas_phage	38.8	1.8e-104
ASE52961.1|1973422_1974082_+	hypothetical protein	NA	V9IQM3	Stenotrophomonas_phage	32.9	6.2e-17
ASE52962.1|1974188_1975391_+|tail	phage tail protein	tail	A0A088FVH5	Escherichia_phage	54.2	6.1e-127
ASE52963.1|1975393_1975897_+|tail	phage major tail tube protein	tail	A0A193GYM4	Enterobacter_phage	50.3	5.2e-40
ASE52964.1|1975977_1976268_+|tail	phage tail assembly protein	tail	A0A193GYZ8	Enterobacter_phage	57.3	5.5e-18
ASE52965.1|1976388_1978836_+|tail	phage tail tape measure protein	tail	A0A1W6JT50	Escherichia_phage	22.7	2.2e-27
ASE52966.1|1978838_1979306_+|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	35.2	1.1e-15
ASE52967.1|1979289_1979505_+|tail	phage tail protein	tail	A0A193GYC8	Enterobacter_phage	54.3	1.6e-14
AVK73148.1|1979495_1980569_+|tail	phage tail protein	tail	D5LGY1	Escherichia_phage	51.9	2.5e-95
ASE52968.1|1980599_1980980_-	tautomerase family protein	NA	NA	NA	NA	NA
ASE52969.1|1981379_1982552_+	DUF4102 domain-containing protein	NA	NA	NA	NA	NA
ASE52970.1|1982628_1983063_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
ASE52971.1|1983098_1983353_+	DNA-binding protein	NA	NA	NA	NA	NA
ASE52972.1|1983453_1983813_+	hypothetical protein	NA	NA	NA	NA	NA
ASE52973.1|1983958_1984222_+	hypothetical protein	NA	NA	NA	NA	NA
ASE52974.1|1984211_1984703_+	hypothetical protein	NA	NA	NA	NA	NA
ASE52975.1|1984952_1985171_+	hypothetical protein	NA	NA	NA	NA	NA
ASE52976.1|1985355_1986786_+|capsid	phage major capsid protein	capsid	Q6DMU0	Streptococcus_phage	26.1	5.5e-10
ASE52977.1|1986978_1990659_+|tail	phage tail protein	tail	D4FUM0	Pseudomonas_phage	32.0	6.8e-44
ASE52978.1|1990723_1990912_-	hypothetical protein	NA	NA	NA	NA	NA
ASE52979.1|1991282_1991636_-	pilus assembly protein PilZ	NA	NA	NA	NA	NA
ASE52980.1|1991632_1992589_-	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
ASE52981.1|1992585_1993251_-	dTMP kinase	NA	W8D0J5	Erwinia_phage	34.9	5.5e-21
ASE52982.1|1993247_1994309_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
ASE52983.1|1994506_1995871_-	aminodeoxychorismate synthase, component I	NA	NA	NA	NA	NA
1994385:1994415	attR	CCGTGCCGACCAACGGTCGGCACCCACCGGA	NA	NA	NA	NA
ASE52984.1|1996085_1997348_-	beta-ketoacyl-[acyl-carrier-protein] synthase II	NA	NA	NA	NA	NA
ASE52985.1|1997491_1997731_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	4.6e-10
ASE52986.1|1997883_1998627_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.3	6.2e-13
ASE52987.1|1998709_1999654_-	[acyl-carrier-protein] S-malonyltransferase	NA	NA	NA	NA	NA
ASE52988.1|1999910_2000693_-	serine/threonine protein phosphatase	NA	NA	NA	NA	NA
ASE52989.1|2000771_2001749_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
ASE52990.1|2001840_2002035_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
ASE52991.1|2002142_2002652_-	hypothetical protein	NA	NA	NA	NA	NA
ASE52992.1|2002765_2003335_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
ASE52993.1|2003582_2005424_-	hypothetical protein	NA	NA	NA	NA	NA
ASE52994.1|2005466_2006420_+	ATPase	NA	NA	NA	NA	NA
ASE52995.1|2006422_2007367_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
ASE52996.1|2007359_2009309_+	DUF3488 domain-containing protein	NA	NA	NA	NA	NA
ASE52997.1|2009305_2009833_+	hypothetical protein	NA	NA	NA	NA	NA
ASE52998.1|2009910_2010270_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
ASE52999.1|2010337_2010937_-	recombination protein RecR	NA	NA	NA	NA	NA
ASE53000.1|2011048_2011369_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
ASE55338.1|2011375_2013427_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	41.4	2.1e-47
ASE53001.1|2014006_2014381_-	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
ASE55339.1|2014756_2015200_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVK73149.1|2015256_2026149_-	transporter	NA	NA	NA	NA	NA
ASE53002.1|2026507_2026825_-	quaternary ammonium compound-resistance protein SugE	NA	NA	NA	NA	NA
ASE53003.1|2027300_2027690_-	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
ASE53004.1|2027686_2028454_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
ASE53005.1|2028453_2029203_-	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
ASE53006.1|2029223_2030270_+	lipopolysaccharide heptosyltransferase family protein	NA	NA	NA	NA	NA
ASE53007.1|2030348_2030753_-	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	35.3	1.3e-17
ASE53008.1|2031043_2034058_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
ASE55340.1|2034675_2035917_+	DUF4102 domain-containing protein	NA	A0A077KET4	Ralstonia_phage	38.1	2.3e-57
ASE53009.1|2036069_2037214_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 4
CP022053	Stenotrophomonas maltophilia strain FDAARGOS_325 chromosome, complete genome	4851512	2460567	2471699	4851512		Enterobacteria_phage(42.86%)	12	NA	NA
ASE53325.1|2460567_2461971_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	28.9	4.2e-47
ASE53326.1|2462107_2462707_-	hypothetical protein	NA	NA	NA	NA	NA
ASE53327.1|2462703_2463102_-	GtrA family protein	NA	NA	NA	NA	NA
ASE53328.1|2463085_2464024_-	dolichol-phosphate mannosyltransferase	NA	NA	NA	NA	NA
ASE53329.1|2464034_2465003_-	SDR family NAD-dependent epimerase/dehydratase	NA	A0A2K9KZK0	Tupanvirus	48.7	9.9e-88
ASE53330.1|2465124_2466030_-	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	36.5	6.3e-28
ASE53331.1|2466026_2466584_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	51.1	1.2e-45
ASE53332.1|2466580_2467468_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	57.7	1.6e-95
ASE53333.1|2467482_2468538_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	46.2	1.9e-79
ASE53334.1|2468800_2469547_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
ASE53335.1|2469546_2470488_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
ASE55367.1|2470532_2471699_-	UDP-glucose 6-dehydrogenase	NA	M1HIV9	Acanthocystis_turfacea_Chlorella_virus	52.8	9.1e-112
>prophage 5
CP022053	Stenotrophomonas maltophilia strain FDAARGOS_325 chromosome, complete genome	4851512	4018579	4047502	4851512	integrase,tail	Pseudomonas_phage(61.9%)	31	4017352:4017367	4050970:4050985
4017352:4017367	attL	GATCGCGCAGCGCGAC	NA	NA	NA	NA
ASE54578.1|4018579_4020433_-|integrase	integrase	integrase	A4JWN2	Burkholderia_virus	45.1	5.7e-124
ASE54579.1|4020383_4021304_-	hypothetical protein	NA	Q5ZR03	Pseudomonas_phage	30.9	4.8e-23
ASE54580.2|4021318_4021612_-	hypothetical protein	NA	NA	NA	NA	NA
ASE54581.1|4021608_4021821_-	hypothetical protein	NA	NA	NA	NA	NA
ASE54582.1|4021838_4022048_-	hypothetical protein	NA	NA	NA	NA	NA
ASE54583.1|4022110_4022545_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
ASE54584.2|4023274_4023745_+	lysozyme	NA	A0A1L7DS69	Ralstonia_virus	43.7	8.4e-24
ASE54585.1|4024247_4024565_+	hypothetical protein	NA	Q5ZQY8	Pseudomonas_phage	39.4	1.0e-09
ASE55445.2|4024624_4024885_+	hypothetical protein	NA	A0A2H4JGU5	uncultured_Caudovirales_phage	60.5	1.8e-23
ASE54586.1|4024889_4025447_+	DUF3486 domain-containing protein	NA	A4JWJ3	Burkholderia_virus	38.7	6.9e-25
ASE54587.1|4025447_4027184_+	hypothetical protein	NA	A0A219VH72	Ochrobactrum_phage	43.5	2.0e-102
ASE54588.1|4027180_4028707_+	DUF935 domain-containing protein	NA	Q5ZQY4	Pseudomonas_phage	58.3	6.4e-166
ASE54589.1|4028710_4029988_+	hypothetical protein	NA	J9STS2	Pseudomonas_phage	61.4	1.4e-84
ASE54590.1|4029987_4030557_+	phage virion morphogenesis protein	NA	J9SU29	Pseudomonas_phage	37.4	3.4e-19
ASE54591.1|4030773_4031979_+	peptidase	NA	J9SGT4	Pseudomonas_phage	51.3	5.1e-73
ASE54592.1|4032030_4032384_+	DUF2190 domain-containing protein	NA	NA	NA	NA	NA
ASE54593.1|4032440_4033397_+	hypothetical protein	NA	G8GWE7	Rhodobacter_phage	46.0	2.4e-70
ASE54594.1|4033560_4034046_+	hypothetical protein	NA	NA	NA	NA	NA
ASE54595.1|4034055_4034589_+	DUF1320 domain-containing protein	NA	Q5ZQX5	Pseudomonas_phage	43.4	2.8e-31
ASE55446.1|4034612_4035062_+	hypothetical protein	NA	A0A0S4L2X9	Pseudomonas_phage	44.7	4.1e-28
ASE54596.1|4035058_4035271_+	hypothetical protein	NA	NA	NA	NA	NA
ASE54597.1|4035274_4036030_+	hypothetical protein	NA	NA	NA	NA	NA
ASE54598.1|4036029_4036539_+	hypothetical protein	NA	NA	NA	NA	NA
ASE54599.1|4036723_4040191_+|tail	phage tail tape-measure protein	tail	A0A0A7NV08	Shigella_phage	26.8	5.0e-41
ASE54600.1|4040193_4041168_+	hypothetical protein	NA	A0A0S0N918	Pseudomonas_phage	26.9	1.5e-19
ASE54601.1|4041175_4042153_+	hypothetical protein	NA	A0A0U2KZ01	Pseudomonas_phage	25.3	2.1e-08
ASE54602.1|4042152_4043853_+	hypothetical protein	NA	J9SU43	Pseudomonas_phage	42.4	2.7e-112
ASE54603.1|4043849_4044632_+	DUF2163 domain-containing protein	NA	D2K0A8	Staphylococcus_phage	33.2	1.9e-36
ASE55447.1|4044662_4044872_+	hypothetical protein	NA	A0A0S0MV97	Pseudomonas_phage	58.8	1.1e-15
ASE54604.1|4045032_4045245_+	hypothetical protein	NA	NA	NA	NA	NA
ASE54605.1|4045237_4047502_+	hypothetical protein	NA	J9RWA5	Pseudomonas_phage	39.2	7.9e-136
4050970:4050985	attR	GATCGCGCAGCGCGAC	NA	NA	NA	NA
>prophage 6
CP022053	Stenotrophomonas maltophilia strain FDAARGOS_325 chromosome, complete genome	4851512	4233382	4243504	4851512	integrase	Xylella_phage(25.0%)	16	4228533:4228547	4241234:4241248
4228533:4228547	attL	AGCAGGCCGAGCAGG	NA	NA	NA	NA
ASE54744.1|4233382_4234084_+	radical SAM protein	NA	J9PV61	Bacillus_phage	42.9	1.4e-38
ASE54745.1|4234162_4234828_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2I7S903	Vibrio_phage	35.9	5.3e-24
ASE54746.1|4234960_4235917_-	hypothetical protein	NA	NA	NA	NA	NA
ASE54747.1|4236231_4237260_-|integrase	integrase	integrase	C8CLF4	Xylella_phage	62.0	2.3e-111
ASE54748.1|4237259_4237475_-	DUF4224 domain-containing protein	NA	C8CLF5	Xylella_phage	61.5	3.3e-12
ASE54749.1|4237486_4237669_-	hypothetical protein	NA	NA	NA	NA	NA
ASE54750.1|4237665_4238418_-	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	40.9	7.8e-40
ASE54751.1|4238414_4238663_-	hypothetical protein	NA	NA	NA	NA	NA
ASE54752.1|4238659_4238875_-	hypothetical protein	NA	NA	NA	NA	NA
ASE54753.1|4239324_4239585_-	hypothetical protein	NA	NA	NA	NA	NA
ASE54754.1|4239577_4239760_-	hypothetical protein	NA	NA	NA	NA	NA
ASE54755.1|4239818_4240424_-	hypothetical protein	NA	I6WLM5	Burkholderia_virus	42.1	2.9e-37
ASE54756.1|4240420_4240642_-	hypothetical protein	NA	NA	NA	NA	NA
ASE54757.1|4240638_4240854_-	hypothetical protein	NA	NA	NA	NA	NA
ASE54758.1|4240853_4242557_-	hypothetical protein	NA	A0A2H4J6F0	uncultured_Caudovirales_phage	43.9	5.6e-86
4241234:4241248	attR	CCTGCTCGGCCTGCT	NA	NA	NA	NA
ASE54759.1|4242553_4243504_-	phage recombination protein Bet	NA	U6C6J0	Ralstonia_phage	49.4	1.6e-61
>prophage 7
CP022053	Stenotrophomonas maltophilia strain FDAARGOS_325 chromosome, complete genome	4851512	4255051	4280666	4851512	terminase	Xanthomonas_citri_phage(55.56%)	24	NA	NA
ASE54779.1|4255051_4255516_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	41.8	1.8e-23
ASE54780.1|4255531_4255777_+	hypothetical protein	NA	E5EYD6	Acinetobacter_phage	60.5	2.3e-17
ASE54781.1|4255989_4256226_+	hypothetical protein	NA	NA	NA	NA	NA
ASE54782.1|4256248_4256497_+	hypothetical protein	NA	NA	NA	NA	NA
ASE54783.1|4256496_4256952_+|terminase	terminase small subunit protein	terminase	L7TIB4	Pseudomonas_virus	48.8	1.1e-25
ASE54784.1|4256923_4258423_+|terminase	terminase	terminase	G9L6B8	Escherichia_phage	52.8	3.9e-139
ASE54785.1|4258433_4258637_+	hypothetical protein	NA	NA	NA	NA	NA
ASE54786.1|4258641_4258905_+	hypothetical protein	NA	NA	NA	NA	NA
ASE54787.1|4258904_4260617_+	hypothetical protein	NA	K7ZJS4	Xanthomonas_citri_phage	55.8	8.5e-175
ASE54788.1|4260628_4260973_+	hypothetical protein	NA	NA	NA	NA	NA
ASE54789.1|4260962_4261652_+	hypothetical protein	NA	K7ZRM5	Xanthomonas_citri_phage	52.0	2.0e-34
ASE54790.1|4261721_4262723_+	hypothetical protein	NA	A0A2I7QL96	Vibrio_phage	58.0	3.3e-110
ASE54791.1|4262793_4263228_+	hypothetical protein	NA	A0A2I7RHV3	Vibrio_phage	46.5	4.5e-24
ASE54792.1|4263224_4263548_+	hypothetical protein	NA	NA	NA	NA	NA
ASE54793.1|4263597_4263930_+	hypothetical protein	NA	K7ZMJ6	Xanthomonas_citri_phage	68.4	7.7e-32
ASE54794.1|4263933_4264575_+	hypothetical protein	NA	K7ZJS5	Xanthomonas_citri_phage	44.9	5.3e-45
ASE54795.1|4264577_4265750_+	hypothetical protein	NA	K7ZRM6	Xanthomonas_citri_phage	56.0	1.1e-136
ASE54796.1|4265749_4267396_+	hypothetical protein	NA	K7ZLE6	Xanthomonas_citri_phage	56.2	5.7e-184
ASE54797.1|4267392_4267866_+	hypothetical protein	NA	K7ZPX6	Xanthomonas_citri_phage	53.9	9.9e-41
ASE54798.1|4267867_4268434_+	hypothetical protein	NA	K7ZMJ9	Xanthomonas_citri_phage	57.0	7.0e-25
ASE54799.1|4268435_4270676_+	hypothetical protein	NA	K7ZJS6	Xanthomonas_citri_phage	44.6	2.9e-146
ASE54800.1|4270672_4277275_+	hypothetical protein	NA	K7ZRM7	Xanthomonas_citri_phage	28.0	2.3e-167
ASE54801.1|4277332_4278871_+	hypothetical protein	NA	A0A2P1JUZ3	Xanthomonas_phage	47.5	1.1e-77
ASE54802.1|4278872_4280666_+	hypothetical protein	NA	A0A2P1JUX7	Xanthomonas_phage	42.8	9.6e-52
