The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP022050	Escherichia coli O157 strain FDAARGOS_293 chromosome, complete genome	5548751	60289	119344	5548751	tail,tRNA,integrase,transposase	Enterobacteria_phage(60.0%)	64	60133:60148	119423:119438
60133:60148	attL	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
ASE45733.1|60289_61261_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
ASE45734.1|61425_63855_-	Trimethylamine-N-oxide reductase 2	NA	NA	NA	NA	NA
ASE45735.1|63879_64980_-	cytochrome c-type protein TorY	NA	NA	NA	NA	NA
ASE45736.1|65367_66114_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
ASE45737.1|66127_66694_-	VOC family protein	NA	NA	NA	NA	NA
ASE45738.1|66909_68643_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
ASE45739.1|68819_69308_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
ASE45740.1|69427_69820_-	flagellar protein FlhE	NA	NA	NA	NA	NA
ASE45741.1|69819_71898_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
AVJ53123.1|71890_73039_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
ASE45742.1|73240_73885_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
ASE45743.1|73895_74285_-	two-component system response regulator	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
ASE45744.1|74299_75349_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
ASE45745.1|75351_76212_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
ASE45746.1|76230_77832_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	5.4e-14
ASE45747.1|77877_79539_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	5.8e-11
ASE45748.1|79681_80185_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
ASE45749.1|80205_82170_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
ASE45750.1|82174_83101_-	motility protein B	NA	NA	NA	NA	NA
ASE45751.1|83097_83985_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
ASE45752.1|84111_84690_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
ASE45753.1|84692_85043_-	flagellar transcriptional activator FlhD	NA	NA	NA	NA	NA
ASE45754.1|85822_86251_+	universal stress protein UspC	NA	NA	NA	NA	NA
ASE45755.1|86257_87682_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
ASE45756.1|87656_88457_-	trehalose-phosphatase	NA	NA	NA	NA	NA
ASE45757.2|88623_89610_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
ASE45758.1|89624_91139_-	arabinose import ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
ASE45759.1|91208_92198_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
ASE45760.1|92994_93498_+	non-heme ferritin	NA	NA	NA	NA	NA
ASE45761.1|93577_93829_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
AVJ53124.1|93940_94087_+	hypothetical protein	NA	NA	NA	NA	NA
ASE45763.1|94291_94615_+	hypothetical protein	NA	NA	NA	NA	NA
ASE45764.1|94785_95283_+	non-heme ferritin	NA	NA	NA	NA	NA
ASE45765.1|95319_95559_-	DUF2492 domain-containing protein	NA	NA	NA	NA	NA
ASE45766.1|95750_96962_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
ASE45767.1|97023_97689_-	YecA family protein	NA	NA	NA	NA	NA
ASE45768.1|98045_99047_-|integrase	integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
ASE45769.1|99052_99400_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
ASE45770.1|99429_100080_-	hypothetical protein	NA	NA	NA	NA	NA
ASE45771.1|100095_100500_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
ASE45772.1|100575_100782_+	hypothetical protein	NA	NA	NA	NA	NA
ASE45773.1|100798_101002_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
ASE45774.1|101023_101374_+	DUF4761 domain-containing protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
ASE45775.1|101384_101663_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
ASE45776.1|101674_101917_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
ASE45777.1|102119_102536_+	hypothetical protein	NA	NA	NA	NA	NA
ASE45778.1|102559_102763_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
ASE45779.1|102759_103026_+	MarR family transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
AVJ53125.1|103022_103322_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
ASE45780.1|103644_103875_+	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	94.7	5.9e-31
ASE45781.1|103947_104313_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
ASE50884.1|104457_107142_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
ASE45782.1|107218_108178_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
ASE45783.1|108182_108497_+	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
ASE45784.1|109588_110119_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
ASE50885.1|110162_110639_-	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	8.5e-08
ASE45785.1|110891_111386_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.2e-86
ASE45786.1|114182_114419_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	3.9e-22
ASE45787.1|114346_114712_-|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
ASE45788.1|114766_115279_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
ASE45789.1|115278_116463_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
ASE45790.1|116620_116944_+|tail	phage tail protein	tail	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
ASE45791.1|117048_118261_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
ASE50886.1|118264_119344_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.4	3.1e-37
119423:119438	attR	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
>prophage 2
CP022050	Escherichia coli O157 strain FDAARGOS_293 chromosome, complete genome	5548751	143220	225193	5548751	transposase,portal,integrase,head,holin,tail,capsid,lysis,terminase	Enterobacteria_phage(32.65%)	96	143720:143734	222817:222831
ASE45817.1|143220_143499_+|integrase	integrase	integrase	S4TSP2	Salmonella_phage	48.9	7.2e-07
ASE45818.1|143418_143733_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
143720:143734	attL	TGTATCGCTGACATT	NA	NA	NA	NA
ASE45819.1|143947_145606_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
ASE45820.1|145598_146594_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
ASE45821.1|146586_147273_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
ASE45822.1|147334_148708_+	flagellum-specific ATP synthase FliL	NA	NA	NA	NA	NA
ASE45823.1|148726_149170_+	flagellar protein FliJ	NA	NA	NA	NA	NA
ASE45824.1|149166_150294_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
ASE45825.1|150398_150863_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
ASE45826.1|150867_151872_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
ASE45827.1|151868_152282_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
ASE45828.1|152284_152650_+	flagellar protein FliO	NA	NA	NA	NA	NA
ASE45829.1|152649_153387_+	flagellar biosynthetic protein FliP	NA	NA	NA	NA	NA
ASE45830.1|153396_153666_+	flagellar biosynthetic protein FliQ	NA	NA	NA	NA	NA
ASE45831.1|153673_154459_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
ASE45832.1|154748_155372_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
ASE45833.1|155415_155658_-	DsrB protein	NA	NA	NA	NA	NA
ASE45835.1|155766_155994_+	DUF2525 domain-containing protein	NA	NA	NA	NA	NA
ASE45836.1|156291_157107_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
ASE45837.1|157103_158798_-	cellulose synthesis regulatory protein	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
ASE45838.1|158718_158907_-	hypothetical protein	NA	NA	NA	NA	NA
ASE45839.1|158968_159151_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
ASE45840.1|159229_160147_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
ASE45841.1|160319_161240_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
ASE45842.1|161228_161699_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	2.0e-33
ASE45843.1|161679_163098_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
ASE45844.1|163164_163860_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	3.6e-07
ASE45846.1|166097_166448_+	hypothetical protein	NA	NA	NA	NA	NA
ASE45847.1|166608_167460_+	Molecular chaperone Hsp31 and glyoxalase 3	NA	NA	NA	NA	NA
ASE45848.1|167567_168926_-	two-component sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.0	8.7e-05
ASE50889.1|168925_169597_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
ASE45849.1|169729_170143_+	5-hydroxyisourate hydrolase	NA	NA	NA	NA	NA
ASE45850.1|170250_171255_+	mononuclear molybdenum enzyme YedY	NA	NA	NA	NA	NA
ASE45851.1|171255_171891_+	sulfoxide reductase heme-binding subunit YedZ	NA	NA	NA	NA	NA
ASE45852.1|172147_172798_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
ASE45853.1|173140_173671_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	99.1	5.5e-56
ASE45854.1|173694_173937_+	hypothetical protein	NA	NA	NA	NA	NA
ASE45855.1|174240_174600_+	hypothetical protein	NA	NA	NA	NA	NA
ASE45856.1|174807_175461_+	secretion protein EspJ	NA	NA	NA	NA	NA
ASE45857.1|175785_176799_+	Secreted effector protein EspF(U)	NA	NA	NA	NA	NA
ASE45858.1|176924_177194_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
ASE45859.1|177195_178509_-|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	99.5	1.3e-77
ASE45860.1|178572_179172_-	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
ASE45861.1|179239_182719_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.7	0.0e+00
ASE45862.1|182959_183637_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	100.0	4.0e-120
ASE45863.1|183534_184278_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	1.1e-150
ASE45864.1|184288_184987_-|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	99.6	3.3e-133
ASE45865.1|184986_185316_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
ASE45866.1|185312_187892_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.1	0.0e+00
ASE45867.1|187872_188286_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
ASE45868.1|188312_188744_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
ASE45869.1|188757_189498_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
ASE45870.1|189479_189746_-|capsid	minor capsid protein E	capsid	NA	NA	NA	NA
ASE45871.1|189803_190151_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
ASE45872.1|190187_191693_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
ASE45873.1|191682_193275_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
ASE45874.1|193271_193478_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
ASE45875.1|195362_195872_-|terminase	terminase	terminase	NA	NA	NA	NA
ASE45876.1|196266_196491_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
ASE45877.1|196572_196887_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
ASE45878.1|197128_197269_-	hypothetical protein	NA	NA	NA	NA	NA
ASE45879.1|197351_197819_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	88.3	7.2e-68
ASE45880.1|197970_198186_-	hypothetical protein	NA	NA	NA	NA	NA
ASE45881.1|198308_198842_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
ASE45882.1|198892_199237_-	DUF1327 domain-containing protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
ASE50890.1|199241_199457_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
ASE45883.1|199767_200980_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
ASE45884.1|201062_202913_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
AVJ53126.1|203233_203500_-	hypothetical protein	NA	NA	NA	NA	NA
ASE45886.1|203390_203819_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
ASE45887.1|204299_204422_-	antiterminator	NA	NA	NA	NA	NA
ASE45888.1|204452_205142_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
ASE45889.1|205138_205498_-	hypothetical protein	NA	V5URS4	Shigella_phage	64.9	1.5e-36
ASE45890.1|205510_206560_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
ASE45891.1|206561_206840_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
ASE45892.1|207007_207220_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
ASE45893.1|207406_207511_-	hypothetical protein	NA	NA	NA	NA	NA
ASE45894.1|207620_208184_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
ASE45895.1|208310_208622_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
ASE45896.1|208618_208807_-	hypothetical protein	NA	A0A291AXE7	Shigella_phage	45.3	1.7e-07
ASE45897.1|208803_209160_-	eae-like protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
ASE45898.1|209156_209381_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
ASE45899.1|209402_210101_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
ASE45900.1|210135_210798_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	7.8e-84
ASE45901.1|211484_211685_+	hypothetical protein	NA	NA	NA	NA	NA
ASE45902.1|211695_212121_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
ASE45903.1|212117_212345_-	cell division protein	NA	NA	NA	NA	NA
ASE45904.1|212439_213087_+	XRE family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.9e-06
ASE45905.1|213361_213514_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
ASE45907.1|213994_214183_+	cell division inhibitor	NA	NA	NA	NA	NA
ASE45908.1|214179_214368_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
ASE45909.1|214463_216935_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
ASE45910.1|216993_217197_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
ASE45911.1|217196_218219_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
ASE50891.1|218454_219252_+	protein MtfA	NA	NA	NA	NA	NA
ASE45912.1|223980_225193_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	6.5e-169
222817:222831	attR	AATGTCAGCGATACA	NA	NA	NA	NA
>prophage 3
CP022050	Escherichia coli O157 strain FDAARGOS_293 chromosome, complete genome	5548751	243917	318326	5548751	transposase,head,holin,tail,capsid,lysis,terminase	Stx2-converting_phage(49.38%)	98	NA	NA
ASE45928.1|243917_245456_+|transposase	IS66 family transposase ISEc8	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
ASE45929.1|246614_246797_+	hypothetical protein	NA	NA	NA	NA	NA
ASE45930.1|246724_246952_-	hypothetical protein	NA	NA	NA	NA	NA
ASE45931.1|246903_249051_+	TonB-dependent receptor	NA	NA	NA	NA	NA
ASE45932.1|249422_250635_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.3	1.8e-163
ASE45933.1|250619_251501_+	vimentin yjdA	NA	NA	NA	NA	NA
ASE45934.1|251497_252403_+	chemotaxis protein	NA	NA	NA	NA	NA
ASE45935.1|252399_253470_+	phospholipase	NA	NA	NA	NA	NA
ASE45936.1|253605_254289_+	hypothetical protein	NA	NA	NA	NA	NA
ASE45937.1|254304_254715_+	hypothetical protein	NA	NA	NA	NA	NA
ASE45938.1|254935_255757_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
ASE45939.1|255838_256318_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
ASE45940.2|256362_256809_+	hypothetical protein	NA	NA	NA	NA	NA
ASE45941.1|256871_257093_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
ASE45942.1|257166_257535_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
ASE50893.1|257996_258188_+	hypothetical protein	NA	NA	NA	NA	NA
ASE50894.2|258802_258985_+	ethanolamine utilization protein	NA	NA	NA	NA	NA
ASE45944.1|259085_259415_-	hypothetical protein	NA	NA	NA	NA	NA
ASE45945.1|259586_260645_-	FUSC family protein	NA	NA	NA	NA	NA
ASE45946.1|260843_261317_-	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
ASE45947.1|261435_262602_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
ASE45948.1|262945_263077_-	umuD domain protein	NA	O64339	Escherichia_phage	59.5	1.5e-07
ASE45949.1|263016_263211_-	hypothetical protein	NA	NA	NA	NA	NA
ASE45950.1|263602_263941_+	hypothetical protein	NA	B6ETE2	Enterobacteria_phage	98.9	3.2e-49
ASE50895.1|264204_264576_+	DUF1076 domain-containing protein	NA	A0A0P0ZBX1	Stx2-converting_phage	100.0	5.7e-68
ASE45951.1|264800_265676_-	secretion protein EspS	NA	A0A0P0ZCT1	Stx2-converting_phage	99.7	5.5e-162
ASE45952.1|265816_266086_-|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	97.8	2.4e-44
ASE45953.1|266087_267401_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.4	4.1e-76
ASE45954.1|267464_268064_-	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
ASE45955.1|268131_271611_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.6	0.0e+00
ASE45956.1|271851_272529_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	100.0	4.0e-120
ASE45957.1|272426_273170_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
ASE45958.1|273180_273879_-|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	99.1	3.1e-131
ASE45959.1|273878_274220_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
ASE45960.1|274212_277455_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	90.7	0.0e+00
ASE45961.1|277506_277788_-|tail	phage tail protein	tail	A0A0P0ZDE6	Stx2-converting_phage	100.0	1.3e-45
ASE45962.1|277811_278186_-|tail	phage tail protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	2.3e-64
ASE45963.1|278191_278908_-|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
ASE45964.1|278966_279311_-	DUF3168 domain-containing protein	NA	A0A0N7KZG1	Stx2-converting_phage	100.0	1.9e-57
ASE45965.1|279307_279754_-	hypothetical protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
ASE45966.1|279750_280101_-|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZDP7	Stx2-converting_phage	100.0	2.7e-59
ASE45967.1|280111_280438_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
ASE45968.1|283126_283348_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
ASE45969.1|283392_285330_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.8	0.0e+00
AVJ53127.1|285393_287055_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
ASE45970.1|287051_287615_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
AVJ53128.1|287730_287910_-	hypothetical protein	NA	H6WZK7	Escherichia_phage	87.5	1.6e-20
ASE45971.1|287906_288272_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
ASE45972.1|288313_288541_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
ASE45973.1|288792_288927_+	hypothetical protein	NA	NA	NA	NA	NA
ASE45974.1|289003_289261_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
ASE45975.1|289257_289755_-	DNA-binding protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
ASE45976.1|289957_290395_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
ASE45977.1|290391_290889_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
ASE45978.1|290888_291104_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
ASE45979.1|291180_291453_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
ASE45980.1|291493_291673_-	DUF1378 domain-containing protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
ASE45981.1|291809_293747_-	DUF1737 domain-containing protein	NA	A0A0P0ZBP4	Stx2-converting_phage	98.9	0.0e+00
ASE45982.1|293990_294314_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
ASE45983.1|294610_294880_-	Shiga toxin Stx2 subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
ASE45984.1|294891_295851_-	Shiga toxin Stx2 subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
ASE45985.1|296500_296989_-	antiterminator	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
ASE45986.1|296979_297651_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
ASE45987.1|297647_298253_-	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
ASE45988.1|298252_298975_-	DNA-binding protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
ASE45989.1|299049_299730_-	phage antirepressor Ant	NA	Q8HA19	Enterobacteria_phage	100.0	1.1e-128
ASE45990.1|299885_300080_+	hypothetical protein	NA	A0A0N7KZV5	Escherichia_phage	95.3	1.2e-29
ASE45991.1|299985_300744_-	hypothetical protein	NA	B6ETC2	Enterobacteria_phage	100.0	2.0e-115
ASE45993.1|301018_301201_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
ASE45994.1|301197_301725_-	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
ASE45995.1|301721_302168_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
ASE50896.1|302124_302550_-	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	1.4e-78
ASE45996.1|302719_302998_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
ASE45997.1|303068_304445_-	replicative DNA helicase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
ASE45998.1|304441_305263_-	replication of DNA	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
ASE45999.1|305443_305740_-	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
ASE46000.1|305881_306097_-	XRE family transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
ASE46001.2|306172_306868_+	helix-turn-helix domain-containing protein	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
ASE46002.1|307369_307891_+	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
ASE46003.1|308001_308163_-	hypothetical protein	NA	A0A0P0ZCZ3	Stx2-converting_phage	100.0	2.7e-22
ASE46004.1|308459_308642_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
ASE46005.1|308619_308892_+	antitermination protein N	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
ASE46006.1|308950_309202_+	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
ASE46007.1|309384_309753_+	hypothetical protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
ASE46008.1|309832_310102_+	host cell division inhibitory peptide Kil	NA	M1FN78	Enterobacteria_phage	100.0	1.7e-42
ASE46009.1|310056_310473_+	Host-nuclease inhibitor protein gam	NA	A0A0P0ZBR6	Stx2-converting_phage	100.0	2.7e-74
ASE46010.1|310478_311264_+	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
ASE46011.1|311260_311662_+	exonuclease	NA	A0A0N6WET1	Escherichia_phage	99.2	6.4e-65
ASE46012.1|311667_312880_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
ASE46014.1|313251_313434_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
ASE46015.1|313406_313598_+	hypothetical protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
ASE46016.2|313608_313890_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
ASE46017.1|313988_314210_+	conjugal transfer protein TraR	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
ASE46018.1|314206_315154_+	hypothetical protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
ASE46019.1|316015_316366_+	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
ASE46020.1|316553_316898_+	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
ASE46021.1|316975_317167_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
ASE46022.1|317147_318326_-	DUF4102 domain-containing protein	NA	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
>prophage 4
CP022050	Escherichia coli O157 strain FDAARGOS_293 chromosome, complete genome	5548751	433276	506155	5548751	transposase,portal,integrase,head,holin,tail,capsid,lysis,tRNA,protease,terminase	Enterobacteria_phage(50.0%)	81	490261:490276	512940:512955
ASE46124.1|433276_435310_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
AVJ53130.1|435450_436179_+	WGR domain-containing protein	NA	NA	NA	NA	NA
ASE46125.1|436368_439260_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
ASE46126.1|439272_440553_+	WGR domain-containing protein	NA	NA	NA	NA	NA
ASE46127.1|440518_442258_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
ASE46128.1|442267_445897_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
ASE46129.1|445958_446276_+	hypothetical protein	NA	NA	NA	NA	NA
ASE46130.1|447516_448605_+	MoxR family ATPase	NA	NA	NA	NA	NA
ASE46131.1|448615_450145_+	hypothetical protein	NA	NA	NA	NA	NA
ASE46132.1|450163_450895_+	hypothetical protein	NA	NA	NA	NA	NA
ASE46133.1|450887_452024_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
ASE46134.1|452020_454024_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
ASE46135.1|454148_454610_+	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
ASE46136.1|454651_455122_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
ASE46137.1|455168_455888_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AVJ53131.1|455884_457570_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
ASE46138.1|458084_458333_+	DNA damage-inducible protein DinI	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
ASE46139.1|458700_458970_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
ASE46140.1|458971_460285_-|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	99.5	1.3e-77
ASE46141.1|460349_460949_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
AVJ53132.1|461016_464490_-|tail	phage tail protein	tail	A0A0P0ZBW1	Stx2-converting_phage	90.0	0.0e+00
ASE46142.1|464735_465416_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	100.0	1.5e-119
ASE46143.1|465313_466057_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.4	1.0e-148
ASE46144.1|466067_466766_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	2.0e-130
ASE46145.1|466765_467095_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
ASE46146.1|469650_470064_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
ASE46147.1|470090_470522_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
ASE46148.1|470535_471276_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
ASE46149.1|471257_471524_-|capsid	minor capsid protein E	capsid	NA	NA	NA	NA
ASE46150.1|471581_471929_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
ASE46151.1|471965_473471_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
ASE46152.1|473460_475053_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
ASE46153.1|475049_475256_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
ASE46154.1|475239_477168_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
ASE46155.1|477139_477382_-	DNA packaging protein	NA	NA	NA	NA	NA
ASE46156.1|477431_478970_-|transposase	IS66 family transposase ISEc8	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
ASE46157.1|479019_479367_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
ASE46158.1|479363_479744_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
ASE46159.1|479819_480095_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
ASE46160.1|480676_480838_-	hypothetical protein	NA	NA	NA	NA	NA
ASE46161.1|480836_481052_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	95.8	1.9e-31
ASE46162.1|481014_481359_-	hypothetical protein	NA	NA	NA	NA	NA
ASE46163.1|481307_481544_-	hypothetical protein	NA	NA	NA	NA	NA
ASE46164.1|481512_481707_+	hypothetical protein	NA	NA	NA	NA	NA
ASE46165.1|481739_482273_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
ASE46166.1|482493_482607_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
ASE46167.1|482608_483076_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	93.5	2.2e-72
ASE46168.1|483158_483299_+	hypothetical protein	NA	NA	NA	NA	NA
ASE46169.1|483541_483856_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
ASE46170.1|484131_485982_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
AVJ53133.1|486108_486303_+	hypothetical protein	NA	Q8VNP0	Enterobacteria_phage	98.3	7.9e-29
ASE46171.2|486749_487148_-	envelope protein	NA	NA	NA	NA	NA
AVJ53134.1|487557_487797_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
ASE46172.1|488083_488902_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AVJ53135.1|489053_489425_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
ASE46173.1|489414_489786_-	hypothetical protein	NA	V5URS4	Shigella_phage	63.7	1.3e-35
ASE46174.1|489798_490848_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
490261:490276	attL	GCGGATTTTTTCCGCC	NA	NA	NA	NA
ASE46175.1|490849_491128_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
ASE46176.1|491295_491508_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
ASE46177.1|492055_492829_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
ASE46178.1|493180_493594_-	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
ASE46179.1|493609_494380_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
ASE46180.1|494401_495148_-	replication protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
ASE46181.1|495154_496246_-	DNA-binding protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
ASE46182.1|496324_496780_+	hypothetical protein	NA	NA	NA	NA	NA
ASE46183.1|496986_497412_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
ASE46184.1|497395_497668_-	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
ASE46185.1|497776_498178_+	XRE family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
ASE46186.1|498205_498397_+	antitoxin	NA	NA	NA	NA	NA
ASE46187.1|498396_498684_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
ASE46188.1|498685_498904_+	hypothetical protein	NA	NA	NA	NA	NA
ASE46189.1|498961_499117_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
ASE46190.1|499118_499247_+	hypothetical protein	NA	NA	NA	NA	NA
ASE46191.1|499258_499648_+	hypothetical protein	NA	NA	NA	NA	NA
ASE46192.1|499834_500020_-	hypothetical protein	NA	NA	NA	NA	NA
ASE50901.1|500021_500327_-	hypothetical protein	NA	NA	NA	NA	NA
ASE46193.1|500593_500782_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
ASE46194.1|500778_500970_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
ASE46195.1|501736_502950_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.6	7.1e-168
ASE46196.1|504915_505158_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
ASE46197.1|505135_506155_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
512940:512955	attR	GGCGGAAAAAATCCGC	NA	NA	NA	NA
>prophage 5
CP022050	Escherichia coli O157 strain FDAARGOS_293 chromosome, complete genome	5548751	739081	776239	5548751	integrase,holin,tail,lysis,terminase	Enterobacteria_phage(48.72%)	48	737737:737751	776313:776327
737737:737751	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
ASE46398.1|739081_739963_-	T3SS effector protein NleH	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
ASE50909.1|740132_740294_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
ASE46399.1|740790_741783_-	peptidase M85	NA	NA	NA	NA	NA
ASE46400.1|741843_742824_-	type III secretion system effector NleB	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
ASE46401.1|743000_743270_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
ASE46402.1|743271_744588_-|tail	phage tail protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
ASE46403.1|744647_745247_-	outer membrane protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
ASE46404.1|745317_748731_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
ASE46405.1|748791_749439_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.4	4.4e-108
ASE46406.1|749336_750080_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
ASE46407.1|750085_750784_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
ASE46408.1|750793_751123_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
ASE46409.1|751122_754188_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
ASE46410.1|754159_754489_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
ASE50910.1|754497_754884_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
ASE46411.1|754944_755688_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	97.6	1.4e-129
ASE46412.2|755698_756100_-|tail	phage tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
ASE46413.1|756096_756675_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
ASE46414.1|756686_756962_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
ASE46415.1|756954_757323_-	DUF2190 domain-containing protein	NA	A0A291AWX2	Escherichia_phage	100.0	9.7e-52
ASE46416.2|760835_761048_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
ASE46417.1|761044_763147_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
AVJ53138.1|763146_763638_-	DUF1441 domain-containing protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
ASE46418.1|763627_763906_-	hypothetical protein	NA	NA	NA	NA	NA
ASE46419.1|764035_764170_+	hypothetical protein	NA	NA	NA	NA	NA
ASE46420.1|764312_764465_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
ASE46421.1|764452_764920_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
ASE46422.1|764916_765414_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
ASE50911.1|765413_765629_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
ASE46423.1|766494_767211_-	hypothetical protein	NA	NA	NA	NA	NA
ASE46424.1|767421_768111_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
ASE46425.1|768125_768248_-	YlcG family protein	NA	NA	NA	NA	NA
ASE46426.1|768585_769545_+	DUF2219 domain-containing protein	NA	NA	NA	NA	NA
ASE46427.1|769756_770422_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
ASE46428.1|770418_771039_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
ASE46429.1|771031_771202_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
ASE50912.1|771198_771381_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
ASE46431.1|772078_772759_+	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
ASE46432.1|772755_772938_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
ASE46433.1|772910_773102_+	hypothetical protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
ASE46434.2|773112_773394_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
ASE46435.1|773492_773714_+	conjugal transfer protein TraR	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
ASE46436.1|773924_774455_-	hypothetical protein	NA	NA	NA	NA	NA
ASE46437.1|774345_774576_-	hypothetical protein	NA	NA	NA	NA	NA
ASE50913.1|774651_774837_-	hypothetical protein	NA	NA	NA	NA	NA
ASE46438.1|774769_774937_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
ASE46439.1|774976_775195_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
AVJ53233.1|775357_776239_+|integrase	integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	7.2e-162
776313:776327	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 6
CP022050	Escherichia coli O157 strain FDAARGOS_293 chromosome, complete genome	5548751	1320699	1372088	5548751	protease,transposase,integrase	Enterobacteria_phage(36.84%)	59	1357817:1357863	1368186:1368232
ASE46897.1|1320699_1322238_-|transposase	IS66 family transposase ISEc8	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
ASE46898.1|1322287_1322635_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
ASE46899.1|1322631_1323012_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
ASE46900.1|1323275_1323539_+	50S ribosomal protein L31 type B	NA	NA	NA	NA	NA
ASE46901.1|1323538_1323679_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
ASE46902.1|1323748_1323940_-	hypothetical protein	NA	NA	NA	NA	NA
ASE50932.1|1324001_1324184_-	hypothetical protein	NA	NA	NA	NA	NA
ASE46903.1|1324086_1324311_+	hypothetical protein	NA	NA	NA	NA	NA
ASE46904.1|1324716_1325307_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
ASE46905.1|1325381_1325969_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
ASE46906.1|1326026_1326695_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
ASE46907.1|1326720_1329246_+	usher protein EcpC	NA	NA	NA	NA	NA
ASE46908.1|1329235_1330879_+	fimbria adhesin EcpD	NA	NA	NA	NA	NA
ASE46909.1|1330847_1331558_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
ASE46910.1|1331870_1332200_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
ASE50933.1|1332194_1332374_-	hypothetical protein	NA	NA	NA	NA	NA
ASE46911.1|1332447_1333062_-	hypothetical protein	NA	NA	NA	NA	NA
ASE50934.1|1333180_1333300_+	transporter	NA	NA	NA	NA	NA
ASE46912.1|1333479_1334169_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
ASE46913.1|1334165_1335122_+	xanthine dehydrogenase	NA	NA	NA	NA	NA
ASE46914.1|1335118_1337317_+	xanthine dehydrogenase	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
ASE46915.1|1337326_1338283_+	XdhC family protein	NA	NA	NA	NA	NA
ASE46916.1|1338461_1339655_-	MFS transporter	NA	NA	NA	NA	NA
ASE46917.1|1339730_1340867_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
ASE46918.1|1341052_1341937_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
ASE46919.1|1342639_1342918_-	hypothetical protein	NA	NA	NA	NA	NA
ASE46920.1|1343084_1343807_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
ASE46921.1|1343905_1344805_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
ASE46922.1|1345480_1346437_+	hypothetical protein	NA	NA	NA	NA	NA
ASE46923.1|1346569_1348903_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	72.4	0.0e+00
ASE46924.1|1348916_1349240_-|protease	Clp protease ClpB	protease	NA	NA	NA	NA
ASE46925.1|1349239_1349461_-	hypothetical protein	NA	NA	NA	NA	NA
ASE46926.1|1349457_1350015_-	Ash-like/host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
ASE46927.1|1350011_1350272_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
ASE46928.1|1350632_1350803_-	hypothetical protein	NA	NA	NA	NA	NA
ASE46929.1|1351205_1351958_+	septation initiation protein	NA	NA	NA	NA	NA
ASE46930.1|1351954_1352506_+	phage polarity suppression protein	NA	NA	NA	NA	NA
ASE46931.1|1352511_1352784_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ53147.1|1352931_1353135_+	hypothetical protein	NA	NA	NA	NA	NA
ASE46932.1|1353193_1353760_-	hypothetical protein	NA	NA	NA	NA	NA
ASE46933.1|1353759_1354350_-	hypothetical protein	NA	NA	NA	NA	NA
ASE46934.1|1354380_1355013_-	AAA family ATPase	NA	NA	NA	NA	NA
ASE46935.1|1355005_1355464_-	hypothetical protein	NA	NA	NA	NA	NA
ASE46936.1|1355463_1356081_-	hypothetical protein	NA	NA	NA	NA	NA
ASE46937.1|1356053_1356470_-	hypothetical protein	NA	NA	NA	NA	NA
ASE46938.1|1356473_1357655_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
1357817:1357863	attL	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
ASE46939.1|1357928_1358081_-	hypothetical protein	NA	NA	NA	NA	NA
ASE46940.1|1358617_1359361_-	transcriptional regulator	NA	NA	NA	NA	NA
ASE46941.1|1360184_1360958_+	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
ASE46942.1|1361458_1362672_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.6	7.1e-168
ASE46943.1|1363564_1363858_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
ASE46944.1|1363976_1364177_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
ASE46945.1|1364277_1364991_+	LexA family transcriptional repressor	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
ASE46946.1|1365512_1366726_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
ASE46947.1|1367061_1367307_+	antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
ASE46948.1|1367197_1368172_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.3	7.2e-179
ASE46949.1|1368376_1369630_-	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
1368186:1368232	attR	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
ASE46950.1|1369641_1370745_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
ASE46951.1|1371032_1372088_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 7
CP022050	Escherichia coli O157 strain FDAARGOS_293 chromosome, complete genome	5548751	1390874	1416161	5548751	transposase,plate	uncultured_Caudovirales_phage(75.0%)	22	NA	NA
ASE46973.1|1390874_1392047_-|transposase	ISAs1 family transposase ISEc26	transposase	NA	NA	NA	NA
ASE46974.1|1392227_1392491_-	dCTP deaminase	NA	NA	NA	NA	NA
ASE46976.1|1392692_1394453_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
ASE46977.1|1394455_1395592_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
ASE50936.1|1395699_1395990_-	hypothetical protein	NA	NA	NA	NA	NA
ASE46978.1|1396133_1396316_-	hypothetical protein	NA	NA	NA	NA	NA
ASE46979.1|1396337_1396973_-	sel1 repeat family protein	NA	NA	NA	NA	NA
ASE46980.1|1396975_1398508_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	7.2e-24
ASE46981.1|1398665_1399382_-	hypothetical protein	NA	NA	NA	NA	NA
ASE46982.2|1399521_1403754_-	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
ASE46983.1|1403829_1405971_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.1e-25
ASE46984.1|1406010_1406148_-	hypothetical protein	NA	NA	NA	NA	NA
ASE46985.1|1406180_1406699_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
ASE46986.1|1407395_1407896_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
ASE46987.1|1407930_1408155_+	hypothetical protein	NA	NA	NA	NA	NA
ASE46988.1|1408205_1409597_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
ASE46989.1|1409687_1410101_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
ASE46990.1|1410104_1411955_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
ASE46991.1|1411918_1413001_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AVJ53149.1|1413025_1414306_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
ASE46992.1|1414302_1414827_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
ASE46993.1|1414829_1416161_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 8
CP022050	Escherichia coli O157 strain FDAARGOS_293 chromosome, complete genome	5548751	2050146	2064811	5548751	tail,tRNA,integrase	Enterobacteria_phage(37.5%)	19	2045987:2046002	2063516:2063531
2045987:2046002	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
ASE47537.1|2050146_2051562_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
ASE47538.1|2051644_2052628_+	quinone oxidoreductase	NA	NA	NA	NA	NA
ASE47539.1|2052793_2053036_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
ASE47540.1|2053169_2054207_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
ASE47541.1|2054295_2055393_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
ASE47542.1|2055454_2055703_+	damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
ASE47543.1|2055863_2056505_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
ASE47544.1|2056586_2057216_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
ASE47545.1|2057288_2057861_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
ASE47546.1|2057972_2058242_-|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
ASE47547.1|2058243_2059557_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
ASE47548.1|2059621_2060221_-	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
ASE47549.1|2061542_2062079_+	HD family hydrolase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
ASE47550.1|2062069_2062420_+	Eae protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
ASE47551.1|2062416_2062701_+	methyltransferase	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
ASE47552.1|2062710_2062890_+	methyltransferase	NA	H9C170	Pectobacterium_phage	76.3	1.2e-20
ASE47553.1|2063036_2063234_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
ASE47555.1|2063578_2063860_+	pyocin activator protein PrtN	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
2063516:2063531	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
ASE47556.1|2064277_2064811_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
>prophage 9
CP022050	Escherichia coli O157 strain FDAARGOS_293 chromosome, complete genome	5548751	2252689	2306856	5548751	transposase,head,tail,tRNA,protease,plate	Shigella_phage(55.0%)	75	NA	NA
ASE47712.1|2252689_2253427_-	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
ASE47713.1|2253380_2253581_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
ASE50965.1|2253848_2254160_+	hypothetical protein	NA	NA	NA	NA	NA
ASE47714.1|2254198_2254444_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
ASE47715.1|2254479_2254662_-	DUF1378 domain-containing protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
ASE47716.1|2254808_2256848_-	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
ASE47717.1|2256947_2257508_-	DNA-invertase	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
ASE47718.1|2257521_2257707_-	hypothetical protein	NA	NA	NA	NA	NA
ASE50966.1|2257729_2257933_+|tail	phage tail protein	tail	NA	NA	NA	NA
ASE47719.1|2258012_2258534_+|tail	phage tail protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
ASE47720.1|2258568_2259480_-|tail	phage tail protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
ASE47721.1|2259479_2260040_-	DUF2313 domain-containing protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
ASE47722.1|2260030_2261116_-	hypothetical protein	NA	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
ASE47723.1|2261112_2261550_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
ASE47724.1|2261542_2262157_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
ASE47725.1|2262146_2263271_-|tail	phage tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
ASE47726.1|2263254_2264625_-	multidrug DMT transporter permease	NA	C9DGQ2	Escherichia_phage	33.1	1.0e-53
ASE47727.1|2264590_2266666_-|tail	tail tape measure protein	tail	A0A0C4UQU8	Shigella_phage	37.7	3.7e-71
ASE47729.1|2266792_2267269_-	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
ASE47730.1|2267283_2267649_-|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
ASE47731.1|2267657_2269160_-|tail	phage tail protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
ASE47732.1|2269156_2269402_-	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
ASE47733.1|2269402_2269963_-	DUF1834 domain-containing protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
ASE47734.1|2269959_2270379_-	DUF1320 domain-containing protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
ASE47735.1|2270375_2270792_-	hypothetical protein	NA	NA	NA	NA	NA
ASE47736.1|2270835_2271783_-|head	head protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
ASE47737.1|2271782_2272907_-|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.9	2.9e-78
ASE47738.1|2273083_2273557_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	54.6	2.7e-38
ASE47739.1|2273678_2275010_-|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	58.8	3.9e-151
AVJ53167.1|2274993_2276583_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.7	1.4e-168
ASE47740.1|2276582_2278247_-	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	8.1e-231
ASE47741.1|2278246_2278828_-	DUF3486 domain-containing protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
ASE47742.1|2278830_2279121_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	4.7e-25
ASE47743.1|2279117_2279426_-	DUF2730 domain-containing protein	NA	NA	NA	NA	NA
ASE47744.1|2279406_2279634_-	conjugal transfer protein TraR	NA	NA	NA	NA	NA
ASE50967.1|2279643_2280090_-	lysozyme	NA	B6SD19	Bacteriophage	48.0	1.2e-11
ASE47745.1|2280308_2280809_-	endolysin	NA	B6SD29	Bacteriophage	42.6	3.0e-27
ASE47746.1|2280880_2281306_-	transcriptional regulator	NA	NA	NA	NA	NA
ASE47747.1|2281375_2281885_-	DUF1018 domain-containing protein	NA	A0A0C4UQU3	Shigella_phage	41.9	1.1e-26
ASE47748.1|2281881_2282178_-	hypothetical protein	NA	NA	NA	NA	NA
ASE47749.1|2282167_2282365_-	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
ASE50968.1|2282357_2282690_-	hypothetical protein	NA	NA	NA	NA	NA
ASE47750.2|2282705_2283056_-	hypothetical protein	NA	NA	NA	NA	NA
ASE47751.1|2283070_2283382_-	hypothetical protein	NA	NA	NA	NA	NA
ASE47752.1|2283378_2283930_-	AsnC family protein	NA	NA	NA	NA	NA
ASE47753.1|2283933_2284449_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	55.4	1.2e-47
ASE47754.1|2284448_2284982_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	66.7	5.9e-66
ASE47755.1|2284985_2285528_-	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	2.9e-28
ASE47756.1|2285625_2286156_-	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
ASE47757.1|2286167_2286461_-	hypothetical protein	NA	NA	NA	NA	NA
ASE47758.1|2286465_2286738_-	hypothetical protein	NA	NA	NA	NA	NA
ASE47759.1|2286734_2287016_-	host nuclease inhibitor protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
ASE47760.1|2287017_2287272_-	hypothetical protein	NA	NA	NA	NA	NA
ASE47761.1|2287284_2287506_-	hypothetical protein	NA	NA	NA	NA	NA
ASE47762.1|2287508_2288441_-	transcriptional regulator	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
ASE47763.1|2288512_2290603_-|transposase	transposase	transposase	A0A2D1GNK9	Pseudomonas_phage	47.4	4.0e-166
ASE47764.1|2290604_2290853_-	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
ASE47765.1|2291020_2291605_+	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	39.8	4.2e-17
ASE47766.1|2291950_2293699_+	transcriptional regulator	NA	NA	NA	NA	NA
ASE47767.1|2293748_2294804_-	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
ASE47768.1|2294956_2295790_-	sulfurtransferase FdhD	NA	NA	NA	NA	NA
ASE47769.1|2295725_2295980_-	hypothetical protein	NA	NA	NA	NA	NA
ASE47770.1|2295983_2296571_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
ASE47771.1|2296619_2299034_+	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
ASE47772.1|2299046_2299949_+	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
ASE47773.1|2299945_2300581_+	formate dehydrogenase cytochrome b556(fdo) subunit	NA	NA	NA	NA	NA
ASE47774.1|2300577_2301507_+	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
ASE47775.1|2301836_2302055_-	hypothetical protein	NA	NA	NA	NA	NA
ASE50969.1|2302295_2302508_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
ASE47776.1|2302816_2303035_+	hypothetical protein	NA	NA	NA	NA	NA
ASE47777.1|2303056_2303158_-	hypothetical protein	NA	NA	NA	NA	NA
ASE47778.1|2303207_2304122_-|transposase	transposase	transposase	NA	NA	NA	NA
ASE47779.1|2304128_2305022_-	hypothetical protein	NA	NA	NA	NA	NA
ASE47780.1|2305432_2306422_-	acetyltransferase	NA	NA	NA	NA	NA
ASE47781.1|2306418_2306856_-|tRNA	D-aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
>prophage 10
CP022050	Escherichia coli O157 strain FDAARGOS_293 chromosome, complete genome	5548751	2598214	2610710	5548751	integrase	Enterobacteria_phage(90.0%)	14	2593804:2593817	2601129:2601142
2593804:2593817	attL	GCACAGTCCGTCAC	NA	NA	NA	NA
ASE48049.1|2598214_2599396_-|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	68.9	1.4e-160
ASE48050.1|2599736_2599883_-|integrase	attP region and P4int integrase	integrase	NA	NA	NA	NA
ASE48051.1|2600097_2602431_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.8	0.0e+00
2601129:2601142	attR	GTGACGGACTGTGC	NA	NA	NA	NA
ASE48052.1|2602445_2602766_-	hypothetical protein	NA	NA	NA	NA	NA
ASE48053.1|2602901_2603357_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	97.3	1.4e-63
ASE48054.1|2603349_2603637_-	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
ASE48055.1|2603629_2604220_-	Ash-like/host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	99.3	1.3e-69
ASE48056.1|2604216_2604483_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
ASE48057.1|2605034_2605769_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.8	1.0e-129
ASE48058.1|2605765_2606266_+	transactivation protein	NA	NA	NA	NA	NA
ASE48059.1|2606339_2606912_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	5.0e-95
ASE48060.1|2607239_2607665_-	hypothetical protein	NA	NA	NA	NA	NA
ASE48061.1|2607661_2609521_-	helicase	NA	A0A097BY72	Enterococcus_phage	22.4	1.8e-13
ASE48062.1|2609540_2610710_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	88.1	1.7e-198
>prophage 11
CP022050	Escherichia coli O157 strain FDAARGOS_293 chromosome, complete genome	5548751	3690861	3697913	5548751	transposase,tail	Enterobacteria_phage(50.0%)	9	NA	NA
ASE49068.1|3690861_3692075_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
ASE49069.1|3692292_3692562_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
ASE49070.1|3692722_3693145_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
ASE49071.1|3693274_3694333_-	type III effector	NA	NA	NA	NA	NA
ASE49072.1|3694411_3695062_-	DUF1076 domain-containing protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
ASE49073.1|3695244_3695835_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
ASE51026.1|3695821_3695941_-	ferredoxin	NA	NA	NA	NA	NA
ASE49074.1|3696336_3696585_-	DNA damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
ASE49075.1|3697430_3697913_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 12
CP022050	Escherichia coli O157 strain FDAARGOS_293 chromosome, complete genome	5548751	3975527	3980914	5548751	integrase	Enterobacteria_phage(50.0%)	6	3964476:3964492	3983110:3983126
3964476:3964492	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
ASE51035.1|3975527_3976058_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	5.7e-69
ASE49325.1|3976057_3976525_+	DUF2824 domain-containing protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
ASE49326.1|3976511_3977192_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
ASE49327.1|3977201_3978338_+	acyltransferase	NA	Q716G3	Shigella_phage	72.4	9.0e-80
ASE49328.1|3978512_3979670_-|integrase	integrase	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
ASE49329.1|3979981_3980914_-	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
3983110:3983126	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 13
CP022050	Escherichia coli O157 strain FDAARGOS_293 chromosome, complete genome	5548751	4225718	4283166	5548751	portal,integrase,holin,tail,lysis,terminase	Enterobacteria_phage(38.71%)	74	4217120:4217135	4275756:4275771
4217120:4217135	attL	GCCAATCATGCCGCCA	NA	NA	NA	NA
ASE49551.1|4225718_4226645_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
ASE49552.1|4226649_4227381_+	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
ASE49553.1|4227361_4227469_-	hypothetical protein	NA	NA	NA	NA	NA
ASE49554.1|4227528_4228230_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
ASE49555.1|4228250_4229537_-|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
ASE49556.1|4229570_4229825_-	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
ASE49557.1|4229843_4229978_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
ASE49558.1|4229981_4230224_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
ASE49559.1|4230311_4230875_-	DUF551 domain-containing protein	NA	G9L6B4	Escherichia_phage	75.0	8.4e-71
ASE51042.1|4230871_4231159_-	hypothetical protein	NA	G9L6B3	Escherichia_phage	97.9	1.4e-53
ASE49560.1|4231388_4231937_-	hypothetical protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	95.1	8.5e-60
ASE51043.1|4231933_4232143_-	hypothetical protein	NA	A0A0F6TK62	Escherichia_coli_O157_typing_phage	100.0	8.8e-34
ASE49561.1|4232154_4232766_-	hypothetical protein	NA	A0A0P0ZFU9	Escherichia_phage	74.7	5.7e-57
ASE49562.1|4232756_4233293_-	HD family hydrolase	NA	A5LH62	Enterobacteria_phage	98.3	9.0e-99
ASE49563.1|4233420_4234245_-	DUF2303 domain-containing protein	NA	K7PJQ6	Enterobacteria_phage	99.6	7.8e-150
ASE49564.1|4234310_4234673_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
ASE49566.1|4235662_4236748_-	ParA family protein	NA	H2BD62	Pseudomonas_phage	39.0	1.2e-60
ASE51044.1|4236982_4237687_-	helix-turn-helix domain-containing protein	NA	G8C7U1	Escherichia_phage	58.7	1.3e-68
ASE49567.1|4237793_4238057_+	hypothetical protein	NA	H6WRX5	Salmonella_phage	51.7	1.1e-09
ASE49568.1|4238085_4238670_+	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	61.4	6.5e-58
ASE49569.1|4238845_4239025_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	70.4	2.7e-15
ASE49570.1|4239014_4239956_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.7	3.9e-153
ASE49571.1|4239952_4240447_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
ASE49572.1|4240446_4241100_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	4.3e-127
ASE49573.1|4241096_4241423_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	100.0	9.2e-54
ASE49574.1|4241419_4241809_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
ASE49575.1|4241828_4242626_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	100.0	5.2e-151
ASE49576.2|4242633_4243623_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
ASE49577.1|4243640_4244075_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	98.6	4.0e-81
ASE49578.1|4244063_4244309_-	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	100.0	5.0e-36
ASE49579.1|4244581_4245529_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
ASE49580.2|4245538_4245808_+	Shiga toxin Stx1 subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
ASE49581.1|4245958_4246186_+	hypothetical protein	NA	Q5MBW5	Stx1-converting_phage	100.0	2.6e-39
ASE49582.1|4246307_4248254_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.5	0.0e+00
ASE49583.1|4248390_4248570_+	DUF1378 domain-containing protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
ASE49584.1|4248610_4248856_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
ASE49585.1|4248933_4249149_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
ASE49586.1|4249153_4249687_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
ASE49587.1|4249957_4250527_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
ASE49588.1|4250680_4251148_+|lysis	lysis protein	lysis	Q9EYC9	Enterobacteria_phage	100.0	1.2e-78
ASE49589.1|4251297_4251546_-	hypothetical protein	NA	NA	NA	NA	NA
ASE49590.1|4251602_4252079_+	DUF1441 domain-containing protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
ASE49591.1|4252075_4253083_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	1.8e-201
ASE49592.1|4253244_4254483_+	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	35.1	3.9e-60
ASE49593.1|4254475_4254700_+	hypothetical protein	NA	NA	NA	NA	NA
ASE49594.1|4254759_4255338_+	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	64.2	2.4e-57
ASE51045.1|4255482_4256595_+	icd-like protein	NA	NA	NA	NA	NA
ASE49595.1|4256587_4256908_+	hypothetical protein	NA	NA	NA	NA	NA
ASE49596.1|4256914_4257214_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
ASE49597.1|4257210_4259028_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	47.9	3.7e-128
ASE49598.1|4259315_4259561_+	hypothetical protein	NA	NA	NA	NA	NA
ASE49599.1|4259557_4259968_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
ASE49600.1|4260427_4260622_+	hypothetical protein	NA	NA	NA	NA	NA
ASE49601.1|4260618_4262508_+	peptidase	NA	Q8VNN5	Enterobacteria_phage	51.7	5.5e-183
ASE49602.1|4262765_4263050_+	hypothetical protein	NA	NA	NA	NA	NA
ASE49603.1|4264518_4264755_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.7	1.7e-33
ASE49604.1|4264754_4266257_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
ASE49605.1|4268312_4268639_+	DUF2190 domain-containing protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
ASE49606.1|4268631_4268913_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
ASE49607.1|4268915_4269539_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
ASE49608.1|4269551_4269950_+|tail	phage tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
ASE49609.1|4269957_4270710_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
ASE49610.1|4270723_4271146_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
ASE49611.1|4271172_4271481_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
ASE49612.1|4274165_4274495_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
ASE49613.1|4274494_4275193_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	2.9e-129
ASE49614.1|4275203_4275947_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
4275756:4275771	attR	GCCAATCATGCCGCCA	NA	NA	NA	NA
ASE49615.1|4275844_4276525_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	100.0	2.5e-114
ASE49616.1|4276478_4276685_+	hypothetical protein	NA	NA	NA	NA	NA
ASE49617.1|4276715_4277243_-	superoxide dismutase	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
ASE49618.1|4277376_4280850_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.4	0.0e+00
ASE49619.1|4280917_4281517_+	outer membrane protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
ASE51046.1|4281581_4282895_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	2.0e-78
ASE49620.1|4282896_4283166_+|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
>prophage 14
CP022050	Escherichia coli O157 strain FDAARGOS_293 chromosome, complete genome	5548751	4554398	4624031	5548751	integrase,head,holin,tail,capsid,lysis,tRNA,terminase	Enterobacteria_phage(25.86%)	96	4555814:4555828	4608889:4608903
ASE49876.1|4554398_4555517_-|integrase	integrase	integrase	Q77Z04	Phage_21	43.9	1.0e-83
ASE49877.1|4555485_4555755_-	excisionase	NA	NA	NA	NA	NA
4555814:4555828	attL	ACATTAAAAATCAGC	NA	NA	NA	NA
ASE49879.1|4556296_4556854_+	hypothetical protein	NA	NA	NA	NA	NA
ASE51068.1|4556968_4557121_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
ASE49880.1|4557436_4557913_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
ASE49881.1|4558037_4558361_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
ASE49882.1|4558344_4558770_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
ASE49883.1|4558780_4558981_-	hypothetical protein	NA	NA	NA	NA	NA
ASE49884.1|4559289_4559493_-	hypothetical protein	NA	NA	NA	NA	NA
ASE49885.1|4559667_4560330_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.8e-81
ASE49886.1|4560363_4561080_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
ASE49887.1|4561076_4561394_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	70.6	1.1e-32
ASE49888.1|4561390_4561693_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
ASE49889.1|4561682_4562000_+	DUF4752 domain-containing protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
ASE49890.1|4561953_4562271_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
ASE49891.1|4562257_4562695_+	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
ASE49892.1|4562696_4562888_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
ASE49893.1|4562890_4563478_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
ASE49894.1|4563593_4563698_+	hypothetical protein	NA	NA	NA	NA	NA
ASE49895.1|4563686_4563842_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	83.8	1.9e-09
ASE49896.1|4563886_4564099_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
ASE49897.1|4564266_4564545_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
ASE49898.1|4564546_4565596_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
ASE49899.1|4565608_4565983_+	hypothetical protein	NA	V5URS4	Shigella_phage	62.7	2.1e-33
ASE49900.1|4565979_4566801_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
AVJ53200.1|4567291_4567558_+	hypothetical protein	NA	NA	NA	NA	NA
ASE49902.1|4567702_4567831_+	hypothetical protein	NA	NA	NA	NA	NA
ASE49903.1|4567879_4569817_+	DUF1737 domain-containing protein	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
ASE49904.1|4569964_4570147_+	DUF1378 domain-containing protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
AVJ53201.1|4570184_4570454_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
ASE49905.1|4570529_4570745_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
ASE49906.1|4570749_4571094_+	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	8.5e-58
ASE49907.1|4571144_4571678_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
ASE49908.1|4571948_4572518_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	99.5	2.0e-104
ASE49909.1|4572671_4573139_+|lysis	lysis protein	lysis	A0A0H4IT10	Shigella_phage	95.5	1.6e-75
ASE49910.1|4573162_4573387_+	hypothetical protein	NA	NA	NA	NA	NA
ASE51069.1|4573383_4573602_+	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	73.3	6.4e-11
ASE49911.1|4573743_4573884_+	hypothetical protein	NA	NA	NA	NA	NA
ASE49912.1|4574013_4574199_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
ASE49913.1|4574240_4574606_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
ASE49914.1|4574894_4575458_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
ASE49915.1|4575454_4577116_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
ASE49916.1|4577179_4579117_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
ASE51070.1|4579161_4579383_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
ASE49917.1|4581909_4582236_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
ASE49918.1|4582245_4582596_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
ASE49919.1|4582592_4583039_+	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
ASE49920.1|4583035_4583380_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
ASE49921.1|4583445_4584162_+|tail	phage tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
ASE49922.1|4584176_4584551_+|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
ASE49923.1|4584574_4584856_+|tail	phage tail protein	tail	A0A0P0ZDE6	Stx2-converting_phage	100.0	1.3e-45
ASE49924.1|4584907_4588150_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	90.8	0.0e+00
ASE49925.1|4588142_4588484_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
ASE49926.1|4588483_4589182_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
ASE49927.1|4589198_4589453_-	hypothetical protein	NA	NA	NA	NA	NA
ASE49928.1|4589562_4589673_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
ASE49929.1|4589975_4590854_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
ASE49930.1|4590907_4591645_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
ASE49931.1|4591542_4591827_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	85.7	1.4e-29
AVJ53202.1|4591948_4594297_+	type III secretion system effector HECT-type E3 ubiquitin transferase	NA	NA	NA	NA	NA
AVJ53203.1|4594887_4598289_+	DUF4765 domain-containing protein	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
ASE49932.1|4598665_4598857_-	hypothetical protein	NA	NA	NA	NA	NA
ASE49934.1|4600392_4600518_+	NleB	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
ASE49935.1|4600597_4600873_-	secretion protein EspO	NA	NA	NA	NA	NA
ASE49936.1|4600933_4602295_-	type III secretion protein GogB	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
ASE49937.1|4602415_4602628_-	hypothetical protein	NA	NA	NA	NA	NA
ASE49938.1|4602658_4603522_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
ASE49939.1|4603505_4604642_-	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
ASE49940.2|4604620_4604836_-	hypothetical protein	NA	NA	NA	NA	NA
ASE49941.1|4604891_4606118_+	peptidase T	NA	NA	NA	NA	NA
ASE49942.1|4606166_4607288_-	50S ribosomal protein L16 arginine hydroxylase	NA	NA	NA	NA	NA
ASE49943.1|4607536_4608766_+|integrase	integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
ASE49944.1|4609130_4609319_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
4608889:4608903	attR	GCTGATTTTTAATGT	NA	NA	NA	NA
ASE51071.1|4610123_4610321_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
ASE49945.1|4610313_4610526_+	hypothetical protein	NA	NA	NA	NA	NA
ASE49946.1|4610515_4610980_+	hypothetical protein	NA	NA	NA	NA	NA
ASE49947.1|4610972_4611206_+	hypothetical protein	NA	NA	NA	NA	NA
ASE49948.1|4611211_4611511_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
ASE49949.1|4611507_4612908_+	DNA primase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	5.6e-116
ASE49950.1|4613108_4613360_+	hypothetical protein	NA	NA	NA	NA	NA
ASE49951.1|4613356_4613767_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
ASE49952.1|4613777_4614050_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
ASE49953.1|4614006_4614135_+	trigger factor	NA	NA	NA	NA	NA
ASE49954.1|4614176_4614401_+	hypothetical protein	NA	NA	NA	NA	NA
ASE49955.1|4614652_4614859_+	hypothetical protein	NA	NA	NA	NA	NA
ASE49956.1|4614858_4615914_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
ASE49957.1|4615926_4616262_+|head	head decoration protein	head	NA	NA	NA	NA
ASE49958.1|4616274_4616688_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
ASE49959.1|4616893_4617436_+|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
ASE49960.1|4617415_4617640_-	hypothetical protein	NA	NA	NA	NA	NA
ASE49961.1|4617691_4617973_+	hypothetical protein	NA	NA	NA	NA	NA
ASE49962.1|4618573_4620034_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
ASE49963.1|4620033_4620705_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
ASE49964.1|4620873_4622244_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
ASE51072.1|4622247_4622889_-	lysogenization protein HflD	NA	NA	NA	NA	NA
ASE49965.1|4622924_4624031_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 15
CP022050	Escherichia coli O157 strain FDAARGOS_293 chromosome, complete genome	5548751	4628203	4671962	5548751	transposase,portal,head,holin,tail,capsid,lysis,protease,terminase	Enterobacteria_phage(55.56%)	55	NA	NA
ASE49970.1|4628203_4629028_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	69.3	3.8e-96
ASE49971.1|4629721_4630024_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
ASE49972.1|4630091_4630424_+	multidrug SMR transporter	NA	NA	NA	NA	NA
ASE49973.1|4630668_4632195_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
ASE49974.1|4632314_4632506_+	hypothetical protein	NA	NA	NA	NA	NA
ASE49975.1|4632696_4633095_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	62.0	2.8e-44
ASE49976.1|4633100_4634313_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
ASE49977.1|4634279_4634465_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	1.4e-06
ASE49978.1|4634464_4634635_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
ASE49979.1|4634627_4634918_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
ASE49980.1|4634914_4635277_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
ASE49981.1|4635273_4635414_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
ASE49982.1|4635410_4636100_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
ASE49983.1|4636409_4636727_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	86.1	3.3e-40
ASE49984.1|4636713_4637190_+	lysozyme	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
ASE49985.1|4637186_4637648_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	97.4	2.7e-75
ASE49986.1|4637679_4637973_-	lipoprotein bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
ASE49987.1|4638264_4638675_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
ASE49988.1|4638960_4639167_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
ASE49989.1|4639331_4639526_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
AVJ53204.1|4639673_4639775_+	hypothetical protein	NA	NA	NA	NA	NA
ASE49990.1|4639914_4640460_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
ASE49991.1|4640434_4642360_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
ASE49992.1|4642356_4642563_+|tail	phage tail protein	tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
ASE49993.1|4642559_4644161_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
ASE49994.1|4644141_4645461_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
ASE49995.1|4645470_4645803_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
ASE49996.1|4645858_4646884_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
ASE49997.1|4646925_4647324_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
ASE49998.1|4647335_4647689_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.9e-61
ASE49999.1|4647700_4648279_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
ASE50000.1|4648275_4648671_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
ASE51073.1|4648678_4649419_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
ASE50001.1|4649434_4649857_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
ASE50002.1|4649838_4650273_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
ASE50003.1|4650265_4652815_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
ASE50004.1|4652811_4653141_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
ASE50005.1|4653140_4653839_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
ASE50006.1|4653844_4654588_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
ASE50007.1|4654485_4655157_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.6	3.1e-104
ASE50008.1|4655217_4658616_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
ASE50009.1|4658682_4659282_+	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	99.0	8.8e-111
ASE51074.1|4659346_4662262_+	hypothetical protein	NA	A0A0P0ZE15	Stx2-converting_phage	98.3	1.5e-57
ASE50010.1|4662261_4662843_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
ASE50011.1|4662962_4663853_-	Mn-containing catalase	NA	NA	NA	NA	NA
ASE50012.1|4663871_4664378_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
ASE50013.1|4664414_4664915_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
ASE50014.1|4664993_4665176_-	stress-induced acidophilic repeat motif-containing protein	NA	NA	NA	NA	NA
ASE51075.2|4665673_4666300_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
ASE50015.1|4666398_4666647_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
ASE50016.1|4666722_4667103_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
ASE50017.1|4667099_4667447_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
ASE50018.1|4667496_4669035_+|transposase	IS66 family transposase ISEc8	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
AVJ53205.1|4669337_4670822_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
ASE50019.1|4671008_4671962_-|protease	protease 7	protease	NA	NA	NA	NA
>prophage 16
CP022050	Escherichia coli O157 strain FDAARGOS_293 chromosome, complete genome	5548751	4767346	4889423	5548751	transposase,portal,integrase,head,holin,tail,capsid,lysis,protease,terminase	Enterobacteria_phage(29.79%)	134	4784558:4784617	4845532:4845594
ASE50106.1|4767346_4768477_-|integrase	integrase	integrase	O21940	Phage_21	51.4	3.4e-103
ASE50107.1|4768454_4768703_-	excisionase	NA	NA	NA	NA	NA
ASE50108.1|4768767_4771239_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
ASE50109.1|4771331_4771523_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
ASE50110.1|4771519_4771708_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
ASE50111.1|4772266_4772500_+	hypothetical protein	NA	NA	NA	NA	NA
ASE50112.1|4772477_4772885_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
ASE50113.1|4772907_4773126_-	hypothetical protein	NA	NA	NA	NA	NA
ASE51083.1|4773198_4773498_-	hypothetical protein	NA	NA	NA	NA	NA
ASE50114.1|4773761_4774169_-	transcriptional regulator	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
ASE50115.1|4774245_4774473_+	transcriptional regulator	NA	NA	NA	NA	NA
ASE50116.1|4774456_4775008_+	hypothetical protein	NA	NA	NA	NA	NA
ASE50117.1|4775808_4776474_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.9e-85
AVJ53209.1|4776561_4777242_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	83.0	5.2e-99
ASE50118.1|4778101_4778860_+	accessory colonization factor AcfC	NA	NA	NA	NA	NA
ASE50119.1|4779138_4779351_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
ASE50120.1|4779571_4779829_+	hypothetical protein	NA	NA	NA	NA	NA
ASE50121.1|4779898_4780177_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
ASE50122.1|4780178_4781225_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
ASE50123.1|4781237_4781597_+	endonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
ASE50124.1|4782241_4782562_+	lipoprotein	NA	S5MQK8	Escherichia_phage	97.4	2.5e-35
ASE50125.1|4782712_4783771_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
ASE50126.1|4784262_4784448_+	hypothetical protein	NA	Q5MBW5	Stx1-converting_phage	94.6	4.6e-26
4784558:4784617	attL	GGGAGGAATAATGACATTTAAACATTATGATGTTGTCAGGGCGGCGTCGCCGTCAGACCT	NA	NA	NA	NA
ASE50127.1|4784567_4786421_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
ASE50128.1|4786570_4786786_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
ASE50129.1|4786790_4787135_+	DUF1327 domain-containing protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
ASE50130.1|4787185_4787719_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	2.3e-102
ASE50132.2|4788311_4789525_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
ASE50134.1|4790025_4790493_+|lysis	lysis protein	lysis	Q9EYC9	Enterobacteria_phage	100.0	1.2e-78
ASE50135.1|4790855_4791083_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
ASE50136.1|4791124_4791490_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
ASE50137.1|4791778_4792342_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
ASE50138.1|4792338_4794000_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
ASE50139.1|4794063_4796001_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
ASE51084.1|4796045_4796267_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
ASE50140.1|4798792_4799119_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
ASE50141.1|4799474_4799921_+	hypothetical protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
ASE50142.1|4799917_4800262_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
ASE50143.1|4800320_4801037_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
ASE50144.1|4801042_4801417_+|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	6.6e-64
ASE50145.1|4801440_4801722_+|tail	phage tail protein	tail	A0A0P0ZDE6	Stx2-converting_phage	98.9	1.8e-45
ASE50146.1|4801772_4805015_+|tail	phage tail tape measure protein	tail	B6ETF7	Enterobacteria_phage	99.9	0.0e+00
ASE50147.1|4805007_4805349_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
ASE50148.1|4805348_4806047_+|tail	phage minor tail protein L	tail	A0A0P0ZD89	Stx2-converting_phage	97.8	7.6e-130
ASE50149.1|4806057_4806801_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
ASE50150.1|4806698_4807379_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.8	1.7e-110
ASE50153.1|4811261_4811861_+	outer membrane protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
ASE50154.1|4812012_4813326_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
ASE50155.1|4813327_4813597_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
ASE50156.2|4813741_4814284_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	67.2	1.1e-62
ASE50157.1|4814623_4815949_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
ASE50158.1|4816216_4816405_+	hypothetical protein	NA	NA	NA	NA	NA
ASE50159.1|4817775_4818687_+	T3SS effector protein NleH	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
ASE50160.1|4818752_4819322_+	effector protein NleF	NA	NA	NA	NA	NA
ASE50161.1|4820287_4821826_-|transposase	IS66 family transposase ISEc8	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
ASE50162.1|4821875_4822223_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
ASE50163.1|4822219_4822600_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
ASE50164.1|4822939_4823218_-	secretion protein EspO	NA	NA	NA	NA	NA
ASE50165.1|4823606_4823792_+	hypothetical protein	NA	NA	NA	NA	NA
ASE50166.1|4823928_4824576_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
ASE50167.1|4824759_4825350_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
ASE51085.1|4827078_4827507_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	42.1	1.4e-22
ASE51086.1|4828100_4828319_-	hypothetical protein	NA	NA	NA	NA	NA
ASE50169.1|4828806_4829937_-|integrase	integrase	integrase	O21940	Phage_21	51.1	1.7e-102
ASE50170.1|4829914_4830163_-	excisionase	NA	NA	NA	NA	NA
ASE50171.1|4830227_4832672_-	exonuclease	NA	V5UQJ3	Shigella_phage	58.3	8.4e-176
ASE50172.1|4832764_4832953_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
ASE50173.1|4832949_4833138_-	cell division inhibitor	NA	NA	NA	NA	NA
ASE51087.1|4833046_4833238_+	hypothetical protein	NA	NA	NA	NA	NA
ASE50174.1|4833950_4834121_-	hypothetical protein	NA	NA	NA	NA	NA
ASE50175.1|4834080_4834236_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
ASE50176.1|4834425_4834833_-	transcriptional regulator	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
ASE50177.1|4834910_4835138_+	transcriptional regulator	NA	NA	NA	NA	NA
ASE50178.1|4835121_4835673_+	hypothetical protein	NA	NA	NA	NA	NA
ASE50179.1|4836473_4837139_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	97.4	3.5e-84
ASE50180.1|4837173_4837932_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	68.8	1.9e-81
ASE50181.1|4837991_4838177_+	hypothetical protein	NA	NA	NA	NA	NA
ASE50183.1|4838524_4839073_+	hypothetical protein	NA	A0A2R2Z302	Escherichia_phage	75.4	1.4e-41
ASE50184.1|4839069_4839243_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	80.6	3.1e-08
ASE50185.1|4839287_4839500_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
ASE50186.1|4839602_4839920_-	transcriptional regulator	NA	NA	NA	NA	NA
ASE50187.1|4839912_4840284_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
ASE50188.1|4840507_4840735_+	hypothetical protein	NA	NA	NA	NA	NA
ASE50189.1|4840788_4841058_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	52.5	2.7e-11
ASE50190.1|4841059_4842109_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	3.4e-110
ASE50191.1|4842121_4842496_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	4.2e-34
ASE50192.1|4842492_4843314_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
ASE50193.1|4843540_4843738_+	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
ASE50194.1|4843888_4844947_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.6	2.6e-206
ASE50195.1|4845541_4847488_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.5	0.0e+00
4845532:4845594	attR	GGGAGGAATAATGACATTTAAACATTATGATGTTGTCAGGGCGGCGTCGCCGTCAGACCTTGC	NA	NA	NA	NA
ASE50196.1|4847625_4847805_+	DUF1378 domain-containing protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
ASE50197.1|4847845_4848091_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
ASE50198.1|4848168_4848384_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
ASE51088.1|4848387_4848945_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	80.9	1.5e-48
ASE50199.1|4848981_4849515_+	lysozyme	NA	G9L6J6	Escherichia_phage	96.6	2.1e-100
ASE50200.1|4849813_4850281_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	100.0	7.7e-78
ASE50201.1|4850693_4851170_+	DUF1441 domain-containing protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
ASE50202.1|4851166_4853290_+|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
ASE50203.1|4853262_4853499_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	100.0	4.5e-34
ASE50204.1|4853498_4855001_+|portal	phage portal protein	portal	S5MW34	Escherichia_phage	99.8	3.1e-290
ASE51089.1|4855014_4856970_+	peptidase S14	NA	S5M7Q8	Escherichia_phage	99.8	0.0e+00
ASE50205.1|4857057_4857384_+	DUF2190 domain-containing protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
ASE50206.1|4857376_4857658_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
ASE50207.1|4857660_4858284_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	99.5	2.5e-100
ASE50208.1|4858296_4858695_+|tail	phage tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
ASE50209.1|4858702_4859455_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
ASE50210.1|4859468_4859891_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
ASE50211.1|4859917_4860226_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
ASE50212.1|4860269_4862915_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.8	0.0e+00
ASE50213.1|4862911_4863241_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
ASE50214.1|4863240_4863939_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	1.1e-131
ASE50215.1|4863949_4864693_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.0	3.0e-145
ASE50216.1|4864590_4865271_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	94.2	2.5e-109
ASE50217.1|4865519_4868996_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	95.3	0.0e+00
ASE50218.1|4869063_4869663_+	Ail/Lom family protein	NA	Q687E7	Enterobacteria_phage	99.0	2.3e-111
ASE51090.1|4869727_4871041_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.3	3.9e-79
ASE50219.1|4871042_4871312_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	2.4e-44
ASE50220.1|4872444_4873035_+	protein kinase	NA	NA	NA	NA	NA
ASE51091.1|4874072_4874579_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
ASE50222.1|4874624_4875125_-	YciE/YciF family protein	NA	NA	NA	NA	NA
ASE50223.1|4875210_4875390_-	hypothetical protein	NA	NA	NA	NA	NA
ASE50224.1|4875770_4876577_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
ASE50225.1|4876576_4877770_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
ASE51092.1|4877781_4879140_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	4.3e-36
ASE50226.1|4879143_4880739_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
ASE50227.1|4880738_4882301_-	anthranilate synthase component I	NA	NA	NA	NA	NA
ASE51093.1|4882392_4882437_-	trp operon leader peptide	NA	NA	NA	NA	NA
ASE50228.1|4882574_4883456_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
ASE50229.1|4883452_4884073_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
ASE50230.1|4884100_4885684_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
ASE50231.1|4885896_4886769_+	23S rRNA pseudouridylate synthase B	NA	NA	NA	NA	NA
ASE50232.1|4886808_4887399_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
ASE50233.1|4887395_4888154_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
ASE50234.1|4888373_4889423_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 17
CP022050	Escherichia coli O157 strain FDAARGOS_293 chromosome, complete genome	5548751	4966214	5026837	5548751	transposase,portal,integrase,head,holin,tail,capsid,lysis,tRNA,terminase	Escherichia_phage(38.71%)	81	4967502:4967561	5014584:5015843
AVJ53212.1|4966214_4966730_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.1	2.4e-24
4967502:4967561	attL	TGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATC	NA	NA	NA	NA
ASE50308.1|4967543_4968757_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
ASE50309.2|4968762_4969326_-|integrase	site-specific integrase	integrase	Q859D2	Escherichia_coli_phage	63.0	3.9e-60
ASE50310.1|4969322_4970567_-	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
ASE50311.1|4970659_4970848_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
ASE50312.1|4970844_4971033_-	cell division inhibitor	NA	NA	NA	NA	NA
ASE50313.1|4971288_4971549_+	hypothetical protein	NA	NA	NA	NA	NA
ASE50314.1|4971597_4971807_+	hypothetical protein	NA	NA	NA	NA	NA
ASE51095.1|4971807_4972446_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
ASE51096.1|4972457_4972610_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
ASE51097.1|4972902_4973427_-	LexA family transcriptional repressor	NA	A0A1W6JP50	Morganella_phage	32.9	1.3e-12
ASE50315.1|4973632_4973875_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
ASE50316.1|4973858_4974284_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
ASE50317.1|4974294_4974495_-	hypothetical protein	NA	NA	NA	NA	NA
ASE50318.1|4975187_4975850_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.4e-79
ASE50319.1|4975883_4976600_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
ASE51098.1|4976632_4976914_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
ASE50320.1|4976910_4977138_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
ASE50321.1|4977130_4977442_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
ASE50322.1|4977569_4977788_+	sugar acetyltransferase inhibitor	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
ASE50323.1|4977789_4978347_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
ASE50324.1|4978580_4978793_+	Hok/Gef family protein	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
ASE50325.1|4978912_4979257_+	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
ASE50326.1|4979378_4979651_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
ASE50327.1|4979652_4980702_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
ASE50328.1|4980714_4981020_+	hypothetical protein	NA	V5URS4	Shigella_phage	66.3	7.1e-32
ASE50329.1|4981082_4981637_+	antiterminator	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
ASE50330.1|4981861_4982059_+	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
ASE50331.2|4982194_4982908_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
ASE50332.1|4983358_4983790_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
AVJ53213.1|4983680_4983947_+	hypothetical protein	NA	NA	NA	NA	NA
ASE50334.1|4984267_4986118_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.7	0.0e+00
ASE50335.1|4986396_4986558_-	hypothetical protein	NA	NA	NA	NA	NA
ASE50336.1|4986556_4986772_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
ASE50337.1|4986776_4987121_+	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	8.5e-58
ASE50338.1|4987171_4987705_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
ASE50339.1|4987976_4988546_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
ASE51099.1|4988694_4989162_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	83.8	3.7e-64
ASE50340.1|4989244_4989385_+	hypothetical protein	NA	NA	NA	NA	NA
ASE50341.1|4989625_4989940_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
ASE50342.1|4990021_4990246_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
ASE50343.1|4990261_4990519_-	hypothetical protein	NA	A0A0K2FJC5	Escherichia_phage	91.4	1.3e-10
ASE50344.1|4990632_4991178_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
ASE50345.1|4991152_4993078_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
ASE50346.1|4993074_4993281_+|tail	phage tail protein	tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
ASE50347.1|4993277_4994879_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
ASE50348.1|4994859_4996179_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
ASE50349.1|4996188_4996521_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
ASE50350.1|4996576_4997602_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
ASE50351.1|4997643_4998039_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	93.9	2.4e-56
ASE50352.1|4998050_4998404_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	93.2	6.6e-58
ASE50353.1|4998418_4998952_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
ASE50354.1|4998948_4999344_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
ASE50355.1|4999351_5000104_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
ASE50356.1|5000117_5000540_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
ASE50357.1|5000566_5000980_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
ASE50358.1|5000960_5003573_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.0	0.0e+00
ASE50359.1|5003569_5003899_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
ASE50360.1|5003898_5004597_+|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	99.6	3.3e-133
ASE50361.1|5004607_5005351_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
ASE50362.1|5005248_5005926_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	100.0	4.0e-120
ASE50363.1|5006166_5009646_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.6	0.0e+00
ASE50364.1|5009713_5010313_+	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
ASE51100.1|5010377_5011592_+|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	95.5	3.9e-81
ASE50365.1|5011593_5011863_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
ASE50366.1|5011976_5012552_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
ASE50367.1|5012624_5013254_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
ASE50368.1|5013335_5013977_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
ASE50369.1|5014007_5014142_+|capsid	capsid protein	capsid	NA	NA	NA	NA
ASE50370.2|5014138_5014453_-	DinI family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
ASE50371.1|5014625_5015839_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
ASE50372.1|5016591_5016786_-	hypothetical protein	NA	NA	NA	NA	NA
5014584:5015843	attR	TGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATCGTTTCCGATGGAAGCATAATAAGCTTTTTCTGCTTCTGCCGGAGGAGTATGGCCCAGCCTTCCCAGCAATCGTCGATTGTTATACCAGTCCACCCACGTTAGTGTGGCCAGTTCCACTTCTGCACGGTTTTTCCAGCTCTTACGGTGTATTACCTCCGCTTTGTAAAGACCATTGATGCTCTCAGCCATCGCGTTGTCATACGAGTCGCCTGTACTCCCTGTTGATGCCAGTAATCCGGCTTCTTTTAGTCGCTCCGTATAGGCCAGTGACACATACTGAGAGCCTTTATCGCTGTGATGGATGGTGCCAGACGGACGACGGGCCCACAACGCCTGCTCCAGCGCATCCAGCACGAATGTCGTTTCCATAGACGATGAGACCCGCCACCCCACGATGTATCCGGCAAACACATCAATGATAAACGCCACATAGACGAAGCCCTGCCATGTGCTGACGTAAGTAAAATCAGCCACCCACAGCTGGTCAGGTCGTTCTGCCACGAACTGACGGTTTACGCGGTCGCCTGCGGCAACGGCTTTCCGGCTGATGGTCGTACGGACCTTTTTACCCCGGAGAACACCGGCAAGTCCCATAACCGCCATGAGACGTGCCACTGTACATCTGGCCACCCTGATTCCTTCCCGTAACAACTGACGCCAGACTTTACGCACACCGTACACCTGATGATTTTCATCGTATACGCGCTGTATCTCTCTCTTCAGCCAGTCGTCGTGCTGCGCACGGGCACTGCGTTTATCCGGATGATGTCGCTGTTGCTGACAATGGTAATACGTTGACGGGGCAATATGCAGTTCGCTGCATACCGGTCCGACCCCGTACTGCTCACGCAGCTTATCCAGCAGTGGCATCATTTTTTCCAGAGGCGGTCGAACTCCGCCTTCGCAAAATAAGCGGAAGCCTGGCGAAGGATATCGTTACTGCGGCGCAGTTCACGATTTTCACGTTCCAGCTCTTTCAGACGCTGACGTTCAGCGCTGGTGAGCCCACCATCACCGCCCCCGGTATCCCGCTCATGCTGGCGAACCCAGACACGCAGAGTCTCCGGCGTACAGCCAATCTTTGGGGCAATGGAACAAATTGCCGCCCACTGTGAGTCATATTCATCCTGACTTTCCAGAACCATACGAATCGCCCGCTGACGGACTTCGGGGGAAAAACGAGTATTTTTAGTCATCCTG	NA	NA	NA	NA
ASE50373.1|5016698_5018144_-	amidohydrolase	NA	NA	NA	NA	NA
ASE50374.1|5018143_5019454_-	amidohydrolase	NA	NA	NA	NA	NA
ASE50375.1|5019629_5020538_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
ASE50376.1|5020867_5021431_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
ASE50377.1|5021451_5022684_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
ASE50378.1|5022938_5023922_+	zinc transporter ZntB	NA	NA	NA	NA	NA
ASE50379.1|5024196_5024367_+	hypothetical protein	NA	NA	NA	NA	NA
ASE50380.1|5024399_5025773_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
ASE50381.1|5025901_5026837_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
>prophage 18
CP022050	Escherichia coli O157 strain FDAARGOS_293 chromosome, complete genome	5548751	5214655	5302086	5548751	transposase,portal,head,holin,tail,capsid,lysis,terminase	Enterobacteria_phage(29.59%)	115	NA	NA
ASE50539.1|5214655_5214925_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	97.8	7.1e-44
ASE50540.1|5214926_5216240_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	4.8e-77
AVJ53216.1|5216304_5216904_-	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	1.3e-109
ASE50541.1|5216970_5220450_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	95.9	0.0e+00
ASE50542.1|5220696_5221377_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	98.2	1.2e-111
ASE50543.1|5221274_5222018_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	1.2e-146
ASE50544.1|5222028_5222727_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	99.1	1.8e-131
ASE50545.1|5222726_5223056_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
AVJ53217.1|5223052_5225665_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	94.2	0.0e+00
ASE50546.1|5225645_5226059_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
ASE50547.1|5226085_5226508_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
ASE50548.1|5226521_5227274_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
ASE50549.1|5227281_5227677_-|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
ASE50550.1|5227673_5228252_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
ASE50551.1|5228263_5228617_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
ASE50552.1|5228628_5229024_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
ASE50553.1|5229065_5230091_-|capsid	minor capsid protein E	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
ASE50554.1|5230146_5230479_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
ASE50555.1|5230488_5231808_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	1.5e-232
ASE50556.1|5231788_5233390_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.6e-308
ASE50557.1|5233386_5233593_-|tail	phage tail protein	tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
ASE50558.1|5233589_5235515_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
ASE50559.1|5235489_5236035_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
ASE50560.1|5236476_5236944_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	99.4	6.5e-77
ASE50561.1|5237242_5237776_-	lysozyme	NA	G9L6J6	Escherichia_phage	94.9	6.9e-99
ASE50562.1|5238287_5239079_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
ASE50563.1|5239082_5239298_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
ASE50564.1|5239447_5241301_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
AVJ53218.1|5241715_5241982_-	hypothetical protein	NA	NA	NA	NA	NA
ASE50565.1|5242472_5243294_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.5	2.4e-82
ASE50566.1|5243290_5243665_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	6.4e-35
ASE50567.1|5243677_5244727_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	1.0e-109
ASE50568.1|5244728_5244998_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	3.0e-10
ASE50569.1|5245051_5245279_-	hypothetical protein	NA	NA	NA	NA	NA
ASE50570.1|5245502_5245874_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
ASE50571.1|5245866_5246184_+	transcriptional regulator	NA	NA	NA	NA	NA
ASE50572.1|5246286_5246499_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
ASE50573.1|5246543_5246699_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	94.6	2.4e-12
ASE50574.1|5246687_5246792_-	hypothetical protein	NA	NA	NA	NA	NA
ASE50575.1|5246907_5247621_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	86.1	1.2e-34
ASE50576.1|5247821_5248034_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
ASE50577.1|5248082_5248439_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	95.8	4.3e-57
ASE50578.1|5248416_5249136_-	hypothetical protein	NA	A0A077SLK5	Escherichia_phage	64.8	3.4e-69
ASE50579.1|5249301_5249484_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
ASE50580.1|5249517_5249730_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	100.0	6.6e-37
ASE50581.1|5249780_5250137_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.6e-59
ASE50582.1|5250486_5250783_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	5.8e-47
ASE50583.1|5250779_5251187_-	DUF977 domain-containing protein	NA	A0A088CBK9	Shigella_phage	62.6	2.3e-38
ASE50584.1|5251187_5251958_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	69.2	9.7e-86
ASE50585.1|5251992_5252658_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	97.4	3.5e-84
ASE50586.1|5253458_5254010_-	hypothetical protein	NA	NA	NA	NA	NA
ASE50587.2|5253993_5254221_-	transcriptional regulator	NA	NA	NA	NA	NA
ASE50588.1|5254247_5254706_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	8.2e-24
ASE50589.1|5254898_5255051_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
ASE51108.1|5255062_5255701_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
ASE50590.1|5255701_5255911_-	hypothetical protein	NA	NA	NA	NA	NA
ASE50591.1|5255959_5256220_-	hypothetical protein	NA	NA	NA	NA	NA
ASE50592.1|5256475_5256664_+	cell division inhibitor	NA	NA	NA	NA	NA
ASE50593.1|5256660_5256849_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
ASE50594.1|5256941_5259404_+	exonuclease	NA	V5UQJ3	Shigella_phage	47.7	2.3e-125
ASE50595.1|5259476_5259728_+	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.9e-15
ASE50596.1|5259747_5261043_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.3	2.5e-155
ASE50597.2|5261148_5261463_+	DinI family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
ASE50598.1|5262425_5262806_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
ASE50599.1|5262802_5263150_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
ASE50600.1|5263199_5264738_+|transposase	IS66 family transposase ISEc8	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
ASE51109.1|5265320_5265692_-	DUF1076 domain-containing protein	NA	A0A0P0ZBX1	Stx2-converting_phage	99.2	1.7e-67
ASE50601.1|5265955_5266303_-	hypothetical protein	NA	B6ETE2	Enterobacteria_phage	96.8	6.1e-48
ASE51110.1|5266681_5267191_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.7	3.3e-50
ASE50602.1|5267370_5267640_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
ASE50603.1|5267641_5268955_-|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	100.0	8.8e-79
ASE50604.1|5269019_5269619_-	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
AVJ53219.1|5269686_5269926_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.2	4.8e-36
AVJ53220.1|5269904_5273165_-|tail	phage tail protein	tail	A0A0P0ZBW1	Stx2-converting_phage	92.2	0.0e+00
ASE50605.1|5273352_5273790_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	6.5e-63
ASE50606.1|5273789_5274131_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
ASE50607.1|5274123_5277204_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	94.1	0.0e+00
ASE50608.1|5277256_5277538_-|tail	phage tail protein	tail	A0A0P0ZDE6	Stx2-converting_phage	100.0	1.3e-45
ASE50609.1|5277561_5277936_-|tail	phage tail protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
ASE50610.1|5277941_5278658_-|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
ASE50611.1|5278716_5279061_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
ASE50612.1|5279057_5279504_-	hypothetical protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
ASE50613.1|5279500_5279851_-|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
ASE50614.1|5279860_5280187_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
AVJ53221.1|5280266_5282444_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	86.1	0.0e+00
ASE50615.1|5282389_5282611_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
ASE50616.1|5282655_5284593_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
ASE50617.1|5284656_5286318_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
ASE50618.1|5286314_5286878_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
ASE50619.1|5287166_5287532_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
ASE50620.1|5287573_5287801_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
ASE50621.1|5288163_5288631_-|lysis	lysis protein	lysis	Q9EYC9	Enterobacteria_phage	100.0	1.2e-78
ASE50622.1|5288784_5289354_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
ASE50623.1|5289624_5290158_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
ASE50624.1|5290208_5290553_-	DUF1327 domain-containing protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
ASE50625.1|5290557_5290773_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
ASE50626.1|5290771_5290918_+	hypothetical protein	NA	NA	NA	NA	NA
ASE50627.1|5291212_5293063_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
ASE50628.1|5293111_5293240_-	hypothetical protein	NA	NA	NA	NA	NA
AVJ53222.1|5293384_5293651_-	hypothetical protein	NA	NA	NA	NA	NA
ASE50630.1|5293541_5293970_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
ASE50631.1|5294453_5294576_-	antiterminator	NA	NA	NA	NA	NA
ASE50632.1|5294606_5295296_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
ASE50633.1|5295292_5295652_-	hypothetical protein	NA	V5URS4	Shigella_phage	67.5	5.9e-38
ASE50634.1|5295664_5296714_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
ASE50635.1|5296715_5296994_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
ASE50636.1|5297161_5297374_-	type I toxin-antitoxin system hok family toxin	NA	A0A0U2QV81	Escherichia_phage	67.1	4.0e-18
ASE50637.1|5297418_5297574_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	83.8	1.9e-09
ASE50638.1|5297562_5297667_-	hypothetical protein	NA	NA	NA	NA	NA
ASE50639.1|5297782_5298367_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
ASE50640.1|5298423_5298819_-	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
ASE50641.1|5299629_5300370_-	replication protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
ASE51111.1|5300376_5301339_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
ASE50642.1|5301361_5301787_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
ASE50643.1|5301783_5302086_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
>prophage 1
CP022051	Escherichia coli O157 strain FDAARGOS_293 plasmid unnamed1, complete sequence	42641	0	16165	42641	transposase	Stx2-converting_phage(50.0%)	22	NA	NA
AVJ53247.1|665_2975_-	conjugal transfer protein	NA	NA	NA	NA	NA
AVJ53248.1|2977_3298_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
ASE51123.1|3355_3649_-	conjugal transfer protein	NA	NA	NA	NA	NA
ASE51124.1|3641_4253_-	conjugal transfer protein	NA	NA	NA	NA	NA
AVJ53249.1|4585_5581_+	conjugal transfer protein TraA	NA	NA	NA	NA	NA
ASE51125.1|5582_6224_+	conjugal transfer protein TrbJ	NA	NA	NA	NA	NA
ASE51126.1|6236_6470_+	hypothetical protein	NA	NA	NA	NA	NA
ASE51162.1|6510_6654_-	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
ASE51127.1|6996_7335_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
ASE51128.1|7728_8109_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
ASE51129.1|8105_8453_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
ASE51130.1|8502_10041_+|transposase	IS66 family transposase ISEc8	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
AVJ53250.1|10224_11229_-	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	26.7	3.3e-17
ASE51131.2|11373_11706_-	hypothetical protein	NA	NA	NA	NA	NA
ASE51133.1|12908_13232_+	hypothetical protein	NA	A0A0K1LL53	Rhodobacter_phage	44.1	3.9e-12
ASE51134.1|13272_13497_+	hypothetical protein	NA	NA	NA	NA	NA
AVJ53251.1|13592_13817_+	hypothetical protein	NA	NA	NA	NA	NA
ASE51135.1|13867_14134_+	hypothetical protein	NA	NA	NA	NA	NA
ASE51163.1|14123_14366_+	hypothetical protein	NA	NA	NA	NA	NA
ASE51136.1|14805_15084_+	cobalamin biosynthesis protein CbiX	NA	NA	NA	NA	NA
ASE51138.1|15520_15703_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
ASE51139.1|15727_16165_+	CopG family transcriptional regulator	NA	A0A0R6PJ17	Moraxella_phage	33.6	6.2e-13
>prophage 2
CP022051	Escherichia coli O157 strain FDAARGOS_293 plasmid unnamed1, complete sequence	42641	22005	25938	42641	transposase	Escherichia_phage(33.33%)	5	NA	NA
ASE51144.1|22005_23218_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
ASE51145.1|23341_23644_-	hypothetical protein	NA	NA	NA	NA	NA
ASE51146.1|23687_24317_-	hypothetical protein	NA	NA	NA	NA	NA
ASE51147.1|24348_25011_-	peptidyl-arginine deiminase	NA	A4JWV7	Burkholderia_virus	26.2	9.4e-05
ASE51148.1|25122_25938_-	resolvase	NA	I3WFA4	Macacine_betaherpesvirus	56.5	7.2e-23
>prophage 3
CP022051	Escherichia coli O157 strain FDAARGOS_293 plasmid unnamed1, complete sequence	42641	29447	29894	42641		Escherichia_phage(100.0%)	1	NA	NA
ASE51149.1|29447_29894_-	hypothetical protein	NA	A0A222YWI5	Escherichia_phage	55.3	1.4e-28
>prophage 1
CP022052	Escherichia coli O157 strain FDAARGOS_293 plasmid unnamed2, complete sequence	95288	3262	23719	95288	protease,transposase	Stx2-converting_phage(37.5%)	14	NA	NA
ASE51165.1|3262_5959_-|protease	metalloprotease StcE	protease	NA	NA	NA	NA
AVJ53259.1|6021_6237_+	hypothetical protein	NA	NA	NA	NA	NA
ASE51166.1|6395_7934_-|transposase	IS66 family transposase ISEc8	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
ASE51167.1|7983_8331_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
ASE51168.1|8327_8708_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
ASE51169.1|9274_10488_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.6	7.1e-168
AVJ53260.1|10595_11594_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
ASE51170.1|11667_13389_-	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
ASE51171.1|13478_14585_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
ASE51172.1|14584_15406_-	carbohydrate transporter	NA	NA	NA	NA	NA
ASE51173.1|17584_21487_-|protease	serine protease EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
ASE51174.1|21606_21702_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	96.2	7.0e-07
ASE51175.1|21667_22881_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
ASE51176.1|22906_23719_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.6	5.5e-148
>prophage 2
CP022052	Escherichia coli O157 strain FDAARGOS_293 plasmid unnamed2, complete sequence	95288	63411	75712	95288	transposase,integrase	Macacine_betaherpesvirus(50.0%)	17	63673:63687	84514:84528
ASE51216.1|63411_64095_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
63673:63687	attL	ATTGCCTGAATATTT	NA	NA	NA	NA
ASE51217.1|64171_64477_-	hypothetical protein	NA	NA	NA	NA	NA
ASE51256.1|64480_65383_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
ASE51218.1|65420_65693_-	hypothetical protein	NA	NA	NA	NA	NA
ASE51219.1|66077_67049_-	protein SopB	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
ASE51220.1|67048_68215_-	protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
ASE51221.1|68802_69141_-	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	100.0	1.6e-40
ASE51222.1|69102_70315_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
ASE51223.1|70281_70362_+	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.5e-07
ASE51224.1|71038_71845_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
ASE51225.1|71845_72151_-	toxin CcdB	NA	NA	NA	NA	NA
ASE51226.1|72152_72371_-	antitoxin CcdA	NA	NA	NA	NA	NA
ASE51227.1|72829_73513_+	hypothetical protein	NA	NA	NA	NA	NA
ASE51228.1|73509_74130_+	hypothetical protein	NA	NA	NA	NA	NA
ASE51229.1|74126_74327_+	hypothetical protein	NA	NA	NA	NA	NA
ASE51230.1|74233_74422_-	hypothetical protein	NA	NA	NA	NA	NA
ASE51231.1|74734_75712_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
84514:84528	attR	ATTGCCTGAATATTT	NA	NA	NA	NA
