The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028561	Acinetobacter sp. WCHA45 chromosome, complete genome	2876784	1036662	1048059	2876784		Tetraselmis_virus(14.29%)	12	NA	NA
AVZ85395.1|1036662_1037640_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	33.1	9.5e-38
AVZ85396.1|1037643_1038183_+	3-deoxy-D-manno-octulosonate 8-phosphate phosphatase	NA	NA	NA	NA	NA
AVZ85397.1|1038222_1038771_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AVZ85398.1|1038754_1039303_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
AVZ85399.1|1039302_1040049_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.6e-21
AVZ85400.1|1040570_1041173_+	DUF1949 domain-containing protein	NA	A0A1X9I5T8	Streptococcus_phage	37.6	9.4e-20
AVZ85401.1|1041162_1041780_+	acyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	49.2	5.3e-10
AVZ85402.1|1041894_1042737_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	33.6	6.5e-35
AVZ85403.1|1043124_1043793_-	O-methyltransferase	NA	S5YRC3	Mycobacterium_phage	37.7	3.3e-26
AVZ85404.1|1043931_1044645_-	peptidase M15	NA	NA	NA	NA	NA
AVZ85405.1|1044781_1045111_-	ferredoxin family protein	NA	NA	NA	NA	NA
AVZ85406.1|1045386_1048059_-	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	23.1	3.5e-34
>prophage 2
CP028561	Acinetobacter sp. WCHA45 chromosome, complete genome	2876784	2726773	2736914	2876784		Vibrio_phage(66.67%)	7	NA	NA
AVZ86823.1|2726773_2727814_-	type I-F CRISPR-associated protein Csy3	NA	A0A2D0YYX4	Vibrio_phage	38.6	5.4e-47
AVZ86824.1|2727816_2728923_-	type I-F CRISPR-associated protein Csy2	NA	A0A2I7RCX5	Vibrio_phage	25.7	2.4e-05
AVZ86825.1|2728922_2730257_-	type I-F CRISPR-associated protein Csy1	NA	NA	NA	NA	NA
AVZ86826.1|2730663_2734149_-	type I-F CRISPR-associated helicase Cas3	NA	A0A2D0YEC8	Vibrio_phage	28.9	3.8e-81
AVZ86827.1|2734145_2735114_-	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	38.6	1.4e-52
AVZ86828.1|2735271_2736321_-	HNH endonuclease	NA	A0A2I2MUI7	uncultured_Caudovirales_phage	61.6	2.5e-76
AVZ86829.1|2736323_2736914_-	class I SAM-dependent methyltransferase	NA	A0A2H4J5G6	uncultured_Caudovirales_phage	82.5	2.8e-32
>prophage 1
CP028560	Acinetobacter sp. WCHA45 plasmid pNDM1_010045, complete sequence	190170	13456	144809	190170	transposase,integrase,protease	Escherichia_phage(15.38%)	110	105323:105382	151644:152925
AVZ84337.1|13456_16651_+|integrase	integrase	integrase	NA	NA	NA	NA
AVZ84338.1|17105_22262_+	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
AVZ84339.1|23902_24691_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ84340.1|24697_25600_-	WYL domain-containing protein	NA	NA	NA	NA	NA
AVZ84341.1|25689_26883_+	metallohydrolase	NA	NA	NA	NA	NA
AVZ84342.1|26879_29135_+	thiamine biosynthesis protein ThiF	NA	NA	NA	NA	NA
AVZ84343.1|29180_30251_+	competence protein ComEC	NA	NA	NA	NA	NA
AVZ84344.1|30259_30739_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ84345.1|30828_31209_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ84346.1|31473_31824_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVZ84347.1|31827_32361_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
AVZ84348.1|32732_32963_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ84349.1|32987_33233_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ84350.1|33240_33492_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ84351.1|33525_33762_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ84352.1|34237_35437_+	DUF4102 domain-containing protein	NA	E5AGD0	Erwinia_phage	29.5	3.4e-37
AVZ84353.1|35470_35692_+	antitoxin HicB	NA	NA	NA	NA	NA
AVZ84485.1|35944_36196_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ84354.1|36390_36612_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVZ84355.1|38172_39033_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
AVZ84356.1|39045_39588_+	tunicamycin resistance protein	NA	NA	NA	NA	NA
AVZ84357.1|40069_40261_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ84358.1|40266_40512_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ84359.1|40562_41699_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
AVZ84360.1|45247_45724_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ84486.1|46694_47537_-	carbapenem-hydrolyzing class D beta-lactamase OXA-58	NA	NA	NA	NA	NA
AVZ84361.1|48136_48556_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
AVZ84362.1|48635_48917_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	43.3	5.7e-12
AVZ84363.1|48917_49220_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	49.0	9.5e-21
AVZ84364.1|49270_50296_-|transposase	IS30-like element ISAba125 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.1	1.2e-51
AVZ84365.1|50588_50873_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ84366.1|50928_51123_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ84367.1|51083_52613_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AVZ84368.1|52801_54442_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	62.1	8.2e-175
AVZ84487.1|54497_54788_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.8	2.1e-17
AVZ84369.1|54981_55311_+	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
AVZ84370.1|55315_56347_+	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
AVZ84371.1|56357_56996_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
AVZ84372.1|57000_57366_-	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
AVZ84373.1|57369_58182_-	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
AVZ84374.1|58282_59308_-|transposase	IS30-like element ISAba125 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.1	1.2e-51
AVZ84375.1|59470_60001_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ84376.1|60089_60404_-	toxin-antitoxin system, antitoxin component	NA	NA	NA	NA	NA
AVZ84377.1|60390_60678_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ84378.1|60918_61689_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ84379.1|61747_62086_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ84380.1|62213_62918_-|transposase	IS6 family transposase IS1006	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
AVZ84381.1|63842_64094_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ84382.1|63987_64290_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AVZ84383.1|64376_65192_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AVZ84384.1|65707_66412_-|transposase	IS6 family transposase IS1008	transposase	A0A077SL39	Escherichia_phage	84.5	5.1e-118
AVZ84385.1|67494_67761_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ84386.1|67796_68501_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	84.9	1.8e-118
AVZ84387.1|69913_70225_-	toxin-antitoxin system, antitoxin component	NA	NA	NA	NA	NA
AVZ84388.1|70211_70499_-	BrnT family toxin	NA	NA	NA	NA	NA
AVZ84389.1|73184_74084_-	ParB/RepB/Spo0J family partition protein	NA	S5VTK0	Leptospira_phage	37.4	3.0e-14
AVZ84390.1|74102_74879_-	partitioning protein	NA	Q8JL10	Natrialba_phage	36.6	1.8e-18
AVZ84391.1|75792_76965_+	RepB family plasmid replication initiator protein	NA	A0A1V0E006	Clostridioides_phage	29.4	9.8e-05
AVZ84392.1|77396_78944_+	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	27.7	5.9e-50
AVZ84393.1|78940_80152_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AVZ84394.1|80205_81234_+	DUF2939 domain-containing protein	NA	NA	NA	NA	NA
AVZ84395.1|81271_84508_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	28.6	5.5e-66
AVZ84396.1|84556_84748_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ84397.1|86707_86965_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ84398.1|87314_87911_-	putative adenosine monophosphate-protein transferase Fic	NA	NA	NA	NA	NA
AVZ84399.1|87923_88091_-	DUF2559 domain-containing protein	NA	NA	NA	NA	NA
AVZ84488.1|88407_88830_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ84400.1|88836_91182_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ84401.1|91186_94387_+|integrase	integrase	integrase	NA	NA	NA	NA
AVZ84402.1|94714_94933_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ84403.1|94937_96233_-	Y-family DNA polymerase	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	51.5	5.3e-129
AVZ84404.1|96247_96874_-	LexA family transcriptional regulator	NA	A0A2H4J538	uncultured_Caudovirales_phage	41.6	4.1e-26
AVZ84405.1|96985_97627_-	DUF159 family protein	NA	A0A218MNF5	uncultured_virus	53.3	3.4e-52
AVZ84406.1|98652_99399_+|transposase	IS5-like element ISAba31 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	38.2	3.3e-14
AVZ84407.1|99717_101436_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
AVZ84408.1|101550_102996_-	coniferyl aldehyde dehydrogenase	NA	NA	NA	NA	NA
AVZ84409.1|103149_104169_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVZ84410.1|104270_104516_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ84411.1|104535_105282_-|transposase	IS5-like element ISAba31 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	38.2	2.5e-14
105323:105382	attL	AGAGGTGGTTCCACTTGTTTGAACAACTAAAAGCGTATTTATAAGTGATATTCCGCTCTA	NA	NA	NA	NA
AVZ84412.1|105383_106528_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	28.1	1.3e-14
AVZ84413.1|107003_108203_+|integrase	integrase	integrase	E5AGD0	Erwinia_phage	29.5	2.6e-37
AVZ84489.1|108727_108979_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ84414.1|109173_109395_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVZ84415.1|110104_111269_-|transposase	IS3-like element ISAba22 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	99.3	4.6e-164
AVZ84416.1|111410_112115_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	84.5	2.3e-118
AVZ84417.1|112196_113264_-	YeiH family protein	NA	NA	NA	NA	NA
AVZ84418.1|113401_114280_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ84419.1|114575_114815_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ84420.1|115947_116133_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ84421.1|116365_117145_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVZ84422.1|117447_118476_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AVZ84423.1|118538_119117_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ84424.1|119560_119908_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ84425.1|120175_121501_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AVZ84426.1|121435_121639_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ84427.1|121768_123049_-	cation transporter	NA	NA	NA	NA	NA
AVZ84428.1|123138_123531_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AVZ84429.1|123911_125066_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AVZ84430.1|125108_125411_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AVZ84431.1|125403_125760_-	addiction module toxin RelE	NA	NA	NA	NA	NA
AVZ84432.1|126515_128171_+	HNH endonuclease	NA	NA	NA	NA	NA
AVZ84433.1|128722_129955_+	ATP-binding protein	NA	NA	NA	NA	NA
AVZ84434.1|130226_130556_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
AVZ84435.1|130764_131631_+	WYL domain-containing protein	NA	NA	NA	NA	NA
AVZ84436.1|131641_132253_+	DUF1819 domain-containing protein	NA	NA	NA	NA	NA
AVZ84437.1|132269_132845_+	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
AVZ84438.1|132886_136567_+	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
AVZ84439.1|136613_140072_+	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	A0A2R2ZGH5	Clostridioides_phage	21.5	1.3e-07
AVZ84440.1|140115_142740_+	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
AVZ84441.1|142769_144809_+|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
151644:152925	attR	AGAGGTGGTTCCACTTGTTTGAACAACTAAAAGCGTATTTATAAGTGATATTCCGCTCTAGTTAAGCCACCTTGTTTTGTTGGGGTAGCTGATCATAGTAAAACTCATTTGGTGTCATTTTGTCTAGACTCGAATGAGGTCGTTTCAGATTATAAAACTCAAAATATGCACTCAATTGCTTTTTCGCATCTGTGACACTGCTATAAGCTTTGAGATACACCTCTTCATATTTAACGCTCCGCCATAATCGTTCAACCATCACATTATCTACCCATCGACCTTTACCATCCATACTGATTTGAATGCCATTTGATTTCAATACATCAATAAATGCATCACTGGTGAACTGACTGCCTTGGTCTGTATTCAATATTTCAGGTGATCCATATTTTTCAATCGCTTCATTTAAAGCCGAAATACAAAAATCCACCTCCATACTAATCGATACCCTATGCGCAAGTACCTTGCGGCTATGCCAATCAATCACAGCACATAAATAAACAAAGCCTTTTGCCATAGGGATATACGTTATATCAGTAGACCACACTTGATTACTGCGCTGAATAGCCAATCCTTTGAGCAGATATGGATATTTACGGTGAGCTTGATTAGCCTGGCTTAAATTTGGTTTGCAATATAACGCCTGAATACCCATTTTCTTCATTAAAGTACGTGTATGACGTCGTCCTATATGATGCCCTTGACGATTCAACAAATCACGCATCATACGACTGCCTGCAAAAGGATATTGCATATGTAATTCATCAATACATCGCATCAGCTTCAGATCTGATGAGCTAACAGGTTTTGGGCGATAATAATAACAACCACGAGAGACTTTCAGTAACTTAGCTTGTTTAGATACTGAAATCTGAAGTGAGTGATCGATTAACTTTTGTGGTTGAAGCGGCCCAGTTTCTTCAACACACCTTCTAAAAAATCAATTTCTAATGCCTGCTCACCGATTTTTGCATGTAACTTTTTAAGATCAATGGGAGGTTCTGATGGAGCTTTTGATTGATCGAAAGCTTGTGAGGAAGCTGAGATCAATTGATTTTTCCAGTCAATAATTTGGTTTTGATGAACATCAAACTCAGAACTCAATTCAGCAAGTGTTTTTTCTGCTTTGATCGCAGCAAGTGCTACCTTAGCCTTAAAGTCGTTTGAATGATTTCTTCTTGGTCTACGTGCCATAAAATACTCCATATATTGATGTTTATAACATCATTTGAGGAGCAGAGTATCACTTATAGGAGTTGTTCAAATTTCCGGATCCATCTCT	NA	NA	NA	NA
