The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032426	Escherichia coli strain SCEC020001 chromosome, complete genome	4908742	1199554	1212737	4908742		Escherichia_phage(50.0%)	12	NA	NA
AYC46217.1|1199554_1200316_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	2.0e-59
AYC46218.1|1200309_1200936_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
AYC46219.1|1201075_1202215_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
AYC46220.1|1202277_1203270_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
AYC46221.1|1203363_1204728_-	GntP family transporter	NA	NA	NA	NA	NA
AYC46222.1|1204816_1205593_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AYC46223.1|1205597_1206236_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AYC46224.1|1206232_1207495_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
AYC46225.1|1207491_1208400_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AYC46226.1|1208595_1209363_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
AYC46227.1|1209413_1210070_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
AYC46228.1|1210175_1212737_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 2
CP032426	Escherichia coli strain SCEC020001 chromosome, complete genome	4908742	1823942	1833384	4908742		Enterobacteria_phage(85.71%)	10	NA	NA
AYC46755.1|1823942_1824869_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
AYC46756.1|1824873_1825605_+	ABC transporter permease	NA	NA	NA	NA	NA
AYC46757.1|1825585_1825693_-	protein YohO	NA	NA	NA	NA	NA
AYC46758.1|1825752_1826484_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AYC46759.1|1826705_1828391_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AYC46760.1|1828387_1829107_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AYC46761.1|1829153_1829624_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AYC46762.1|1829664_1830126_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AYC46763.1|1830250_1832251_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
AYC46764.1|1832247_1833384_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 3
CP032426	Escherichia coli strain SCEC020001 chromosome, complete genome	4908742	1959545	1980056	4908742	integrase,holin,transposase,lysis,terminase	Enterobacteria_phage(45.0%)	24	1958007:1958020	1967628:1967641
1958007:1958020	attL	TACTGCTGCGCCAG	NA	NA	NA	NA
AYC46872.1|1959545_1959749_+	DUF4102 domain-containing protein	NA	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.9e-33
AYC46873.1|1959827_1960724_+|integrase	integrase	integrase	A0A0P0ZDN8	Stx2-converting_phage	99.7	1.9e-173
AYC46874.1|1960704_1960896_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
AYC46875.1|1961000_1961180_-	Eag protein	NA	K7PL40	Enterobacteria_phage	98.3	7.3e-29
AYC46876.1|1961770_1962394_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	99.0	2.0e-113
AYC46877.1|1962355_1962559_-	hypothetical protein	NA	NA	NA	NA	NA
AYC46878.1|1962827_1963151_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
AYC46879.1|1963134_1963611_+	lysozyme	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
AYC46880.1|1963607_1964045_+|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	95.9	1.4e-68
AYC46881.1|1964081_1964357_+	hypothetical protein	NA	K7P6G5	Enterobacteria_phage	100.0	2.7e-46
AYC46882.1|1964640_1965009_+	hypothetical protein	NA	K7PH35	Enterobacteria_phage	97.6	1.5e-60
AYC46883.1|1965112_1965355_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
AYC46884.1|1965357_1965798_+|terminase	terminase	terminase	C7U0V7	Enterobacteria_phage	99.3	1.7e-79
AYC46885.1|1967976_1968105_+	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
1967628:1967641	attR	CTGGCGCAGCAGTA	NA	NA	NA	NA
AYC46886.1|1968118_1969141_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
AYC46887.1|1969137_1969920_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
AYC46888.1|1972309_1973422_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
AYC49592.1|1973783_1974164_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
AYC46889.1|1974160_1974508_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AYC46890.1|1974557_1976096_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	97.3	3.1e-293
AYC46891.1|1976129_1976957_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	28.0	7.6e-12
AYC46892.1|1977185_1977890_-	hypothetical protein	NA	NA	NA	NA	NA
AYC46893.1|1978258_1979420_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
AYC46894.1|1979924_1980056_+	umuD domain protein	NA	O64339	Escherichia_phage	57.1	1.7e-06
>prophage 4
CP032426	Escherichia coli strain SCEC020001 chromosome, complete genome	4908742	2462656	2491259	4908742	integrase,tail	Enterobacteria_phage(26.32%)	31	2463721:2463735	2487499:2487513
AYC47345.1|2462656_2465083_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
2463721:2463735	attL	CGCCGTCGCGGATTG	NA	NA	NA	NA
AYC47346.1|2465281_2465587_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AYC49614.1|2465694_2466405_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
AYC47347.1|2466407_2466968_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AYC47348.1|2467002_2467344_-	DUF1283 family protein	NA	NA	NA	NA	NA
AYC47349.1|2467478_2467805_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AYC47350.1|2468010_2469225_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AYC47351.1|2469236_2470256_+	starvation-sensing protein RspB	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
AYC47352.1|2470313_2470424_+	transporter	NA	NA	NA	NA	NA
AYC47353.1|2470443_2471739_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.3	6.7e-156
AYC47354.1|2471758_2472010_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AYC47355.1|2472082_2474554_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.8	6.1e-57
AYC47356.1|2474647_2474839_-	DUF1482 family protein	NA	NA	NA	NA	NA
AYC47357.1|2474835_2475024_-	division inhibition protein DicB	NA	NA	NA	NA	NA
AYC47358.1|2475107_2475350_+	hypothetical protein	NA	NA	NA	NA	NA
AYC47359.1|2475276_2476296_+	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	1.0e-58
AYC47360.1|2476336_2476759_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	84.9	5.9e-61
AYC47361.1|2476888_2477833_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
AYC47362.1|2478380_2479730_-	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	98.0	5.7e-259
AYC47363.1|2480047_2480650_+|integrase	integrase	integrase	A0A1V0E036	Clostridioides_phage	31.2	3.7e-08
AYC47364.1|2481009_2481990_+	hypothetical protein	NA	NA	NA	NA	NA
AYC47365.1|2482359_2482503_+	hypothetical protein	NA	NA	NA	NA	NA
AYC47366.1|2482661_2482874_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	95.4	2.0e-25
AYC47367.1|2483089_2483341_+	hypothetical protein	NA	NA	NA	NA	NA
AYC47368.1|2483407_2483686_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
AYC47369.1|2483687_2484737_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	4.2e-108
AYC47370.1|2484749_2485124_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
AYC47371.1|2485120_2485942_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	2.7e-78
AYC47372.1|2486687_2488850_+	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	96.6	0.0e+00
2487499:2487513	attR	CGCCGTCGCGGATTG	NA	NA	NA	NA
AYC47373.1|2489681_2491079_+	chaperone of endosialidase	NA	K7PGT9	Enterobacteria_phage	85.2	1.4e-204
AYC47374.1|2491133_2491259_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	82.5	1.5e-12
>prophage 5
CP032426	Escherichia coli strain SCEC020001 chromosome, complete genome	4908742	2892505	2903283	4908742	integrase	Enterobacteria_phage(40.0%)	11	2890478:2890501	2901986:2902009
2890478:2890501	attL	AACGGGCGTGTTATACGCCCGTTG	NA	NA	NA	NA
AYC47726.1|2892505_2894461_-	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	28.6	7.5e-26
AYC47727.1|2896825_2897365_-	regulator	NA	M9NZI6	Enterobacteria_phage	65.6	7.5e-61
AYC47728.1|2897547_2897859_+	recombinase	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	2.4e-43
AYC47729.1|2897855_2898536_+	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	5.1e-131
AYC49630.1|2898532_2898691_+	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	88.5	6.4e-21
AYC47730.1|2898687_2899752_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	64.8	1.7e-133
AYC47731.1|2899905_2900124_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	94.4	3.2e-34
AYC47732.1|2900171_2900411_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
AYC47733.1|2900550_2900787_+	excisionase	NA	NA	NA	NA	NA
AYC47734.1|2900776_2901919_+|integrase	integrase	integrase	O21929	Phage_21	99.7	8.1e-206
AYC47735.1|2902032_2903283_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
2901986:2902009	attR	CAACGGGCGTATAACACGCCCGTT	NA	NA	NA	NA
>prophage 6
CP032426	Escherichia coli strain SCEC020001 chromosome, complete genome	4908742	3217659	3226430	4908742	integrase	Salmonella_phage(90.0%)	11	3217329:3217342	3226472:3226485
3217329:3217342	attL	AAAACAATAAGTTA	NA	NA	NA	NA
AYC49645.1|3217659_3217848_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	95.2	2.0e-24
AYC48021.1|3218006_3220400_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	93.7	0.0e+00
AYC48022.1|3220396_3221254_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.8	9.5e-159
AYC48023.1|3221250_3221478_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	7.8e-36
AYC48024.1|3221477_3221711_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
AYC48025.1|3221778_3222120_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYC48026.1|3222237_3222534_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
AYC48027.1|3222541_3223051_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
AYC48028.1|3223083_3223305_-	regulator	NA	NA	NA	NA	NA
AYC48029.1|3223450_3224329_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.4	1.7e-30
AYC48030.1|3225377_3226430_+|integrase	site-specific integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.4e-106
3226472:3226485	attR	TAACTTATTGTTTT	NA	NA	NA	NA
>prophage 7
CP032426	Escherichia coli strain SCEC020001 chromosome, complete genome	4908742	3264474	3316452	4908742	lysis,transposase,capsid,tail,terminase	Enterobacteria_phage(23.81%)	54	NA	NA
AYC48062.1|3264474_3265637_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
AYC48063.1|3265717_3266545_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
AYC48064.1|3266843_3267347_+	DNA starvation/stationary phase protection protein	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
AYC48065.1|3267750_3268497_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYC48066.1|3268635_3269295_+	glutamine ABC transporter permease	NA	NA	NA	NA	NA
AYC48067.1|3269291_3270014_+	glutamine transport ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	5.6e-35
AYC48068.1|3270274_3272500_+	moderate conductance mechanosensitive channel YbiO	NA	NA	NA	NA	NA
AYC48069.1|3272496_3273504_-	23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF	NA	NA	NA	NA	NA
AYC48070.1|3273554_3273959_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	2.6e-05
AYC48071.1|3274223_3276506_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
AYC48072.1|3276547_3277225_+	PKHD-type hydroxylase	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
AYC48073.1|3277298_3277565_+	DksA/TraR family C4-type zinc finger protein	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
AYC48074.1|3277829_3278090_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AYC48075.1|3278318_3279404_-	dehydrogenase	NA	NA	NA	NA	NA
AYC48076.1|3279544_3280507_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
AYC48077.1|3280534_3282685_-	ATP-dependent helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
AYC48078.1|3282804_3283287_+	NADAR family protein	NA	A0A0H3TLU0	Faustovirus	52.7	2.6e-36
AYC48079.1|3283518_3284883_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
AYC49648.1|3285111_3285783_+	transcriptional regulator	NA	NA	NA	NA	NA
AYC48080.1|3285782_3286781_+	secretion protein HlyD	NA	NA	NA	NA	NA
AYC48081.1|3286773_3288510_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
AYC48082.1|3288502_3289636_+	inner membrane transport permease YbhS	NA	NA	NA	NA	NA
AYC48083.1|3289646_3290753_+	inner membrane transport permease YbhR	NA	NA	NA	NA	NA
AYC48084.1|3290714_3291125_-	hypothetical protein	NA	NA	NA	NA	NA
AYC48085.1|3291257_3292019_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
AYC48086.1|3292015_3293257_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
AYC48087.1|3293256_3294213_+	UPF0104 family protein	NA	NA	NA	NA	NA
AYC48088.1|3295532_3295739_-	hypothetical protein	NA	NA	NA	NA	NA
AYC48089.1|3295943_3296648_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
AYC48090.1|3296784_3297237_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
AYC48091.1|3297238_3297484_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
AYC48092.1|3297476_3297962_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
AYC48093.1|3297964_3298477_-	molybdenum cofactor biosynthesis protein	NA	NA	NA	NA	NA
AYC48094.1|3298498_3299488_-	cyclic pyranopterin monophosphate synthase	NA	NA	NA	NA	NA
AYC48095.1|3299884_3300793_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
AYC48096.1|3300984_3303006_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AYC48097.1|3303584_3304262_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
AYC48098.1|3304254_3305010_-	malonyl-[acyl-carrier protein] O-methyltransferase BioC	NA	NA	NA	NA	NA
AYC48099.1|3304996_3306151_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
AYC48100.1|3306147_3307188_-	biotin synthase	NA	NA	NA	NA	NA
AYC48101.1|3307274_3308564_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	3.4e-19
AYC48102.1|3308622_3309099_+	kinase inhibitor	NA	NA	NA	NA	NA
AYC48103.1|3309844_3311176_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
AYC48104.1|3311249_3311426_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.5	9.4e-21
AYC49649.1|3311617_3312244_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AYC48105.1|3312188_3312326_-|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AYC48106.1|3313134_3313695_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.8	4.9e-87
AYC48107.1|3314083_3314317_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
AYC48108.1|3314373_3314784_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
AYC48109.1|3314829_3314994_+	hypothetical protein	NA	NA	NA	NA	NA
AYC48110.1|3315135_3315288_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
AYC48111.1|3315275_3315743_-|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	96.8	1.6e-75
AYC48112.1|3315739_3316237_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	97.0	1.6e-89
AYC48113.1|3316236_3316452_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
>prophage 8
CP032426	Escherichia coli strain SCEC020001 chromosome, complete genome	4908742	3319650	3337215	4908742	integrase,transposase	Enterobacteria_phage(44.0%)	35	3320945:3320957	3338354:3338366
AYC48117.1|3319650_3320175_+	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
AYC48118.1|3320330_3320708_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
AYC48119.1|3320793_3320934_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
AYC48120.1|3320930_3321293_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	97.4	1.5e-60
3320945:3320957	attL	TTTCGGTGATGGT	NA	NA	NA	NA
AYC48121.1|3321289_3321580_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	91.7	4.8e-46
AYC48122.1|3321572_3321743_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
AYC48123.1|3321742_3322198_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
AYC48124.1|3322194_3322296_-	hypothetical protein	NA	NA	NA	NA	NA
AYC48125.1|3322388_3322841_-	hypothetical protein	NA	NA	NA	NA	NA
AYC48126.1|3322837_3323398_-	UDP-N-acetylglucosamine acyltransferase	NA	NA	NA	NA	NA
AYC48127.1|3323654_3323846_+	hypothetical protein	NA	NA	NA	NA	NA
AYC48128.1|3323882_3324176_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
AYC48129.1|3324172_3324874_-	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.6	3.8e-129
AYC48130.1|3324870_3325890_-	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	63.4	1.7e-109
AYC48131.1|3325886_3326426_-	regulator	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
AYC48132.1|3326495_3326726_-	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
AYC48133.1|3326764_3327520_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
AYC48134.1|3327642_3328392_+	hypothetical protein	NA	NA	NA	NA	NA
AYC48135.1|3328388_3329216_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
AYC48136.1|3329724_3329931_+	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
AYC48137.1|3330006_3330303_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
AYC48138.1|3330567_3330690_+	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYC48139.1|3330703_3331726_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
AYC48140.1|3331722_3332505_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
AYC48141.1|3333050_3333731_+	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	3.0e-131
AYC49650.1|3333727_3333910_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	2.2e-28
AYC48142.1|3333882_3334074_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.8e-26
AYC48143.1|3334084_3334366_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
AYC48144.1|3334464_3334686_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	97.3	1.4e-34
AYC48145.1|3334896_3335427_-	hypothetical protein	NA	NA	NA	NA	NA
AYC48146.1|3335317_3335569_-	hypothetical protein	NA	NA	NA	NA	NA
AYC48147.1|3335623_3335809_-	hypothetical protein	NA	NA	NA	NA	NA
AYC48148.1|3335741_3335909_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
AYC48149.1|3335948_3336167_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
AYC48150.1|3336144_3337215_+|integrase	integrase	integrase	Q9MCR4	Enterobacteria_phage	99.4	4.3e-201
3338354:3338366	attR	TTTCGGTGATGGT	NA	NA	NA	NA
>prophage 9
CP032426	Escherichia coli strain SCEC020001 chromosome, complete genome	4908742	3784823	3868587	4908742	integrase,transposase,holin,protease,tail	Enterobacteria_phage(31.71%)	84	3822593:3822652	3854873:3854932
AYC48544.1|3784823_3786857_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
AYC48545.1|3786985_3787573_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
AYC48546.1|3787586_3789059_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AYC48547.1|3789072_3790743_+|holin	oxygen-dependent choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
AYC48548.1|3790955_3791624_+	hypothetical protein	NA	NA	NA	NA	NA
AYC48549.1|3791595_3791793_+	universal stress protein	NA	NA	NA	NA	NA
AYC48550.1|3791699_3791912_+	hypothetical protein	NA	NA	NA	NA	NA
AYC48551.1|3791866_3792562_-	lactate utilization protein C	NA	NA	NA	NA	NA
AYC48552.1|3792554_3793982_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
AYC49662.1|3794453_3795428_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
AYC48553.1|3796311_3797166_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYC48554.1|3797391_3798717_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
AYC48555.1|3798825_3799062_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AYC48556.1|3799073_3799667_+	DUF417 domain-containing protein	NA	NA	NA	NA	NA
AYC48557.1|3800224_3801109_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYC48558.1|3801248_3805505_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
AYC48559.1|3806619_3806721_+	hypothetical protein	NA	NA	NA	NA	NA
AYC48560.1|3807084_3807348_+	50S ribosomal protein L31 type B	NA	NA	NA	NA	NA
AYC48561.1|3807347_3807488_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
AYC48562.1|3807522_3807750_-	hypothetical protein	NA	NA	NA	NA	NA
AYC48563.1|3808524_3809115_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AYC48564.1|3809189_3809777_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
AYC48565.1|3809834_3810503_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
AYC48566.1|3810528_3813054_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AYC48567.1|3813043_3814687_+	hypothetical protein	NA	NA	NA	NA	NA
AYC48568.1|3814655_3815366_+	hypothetical protein	NA	NA	NA	NA	NA
AYC48569.1|3815678_3816008_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
AYC48570.1|3816255_3816870_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
AYC48571.1|3816916_3817096_-	hypothetical protein	NA	NA	NA	NA	NA
AYC48572.1|3817287_3817977_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
AYC48573.1|3817973_3818930_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
AYC48574.1|3818926_3821125_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	1.1e-38
AYC48575.1|3821134_3822091_+	XdhC family protein	NA	NA	NA	NA	NA
AYC48576.1|3822069_3822480_+	hypothetical protein	NA	NA	NA	NA	NA
3822593:3822652	attL	CTTATTGATTTAAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
AYC48577.1|3822717_3822870_-	hypothetical protein	NA	NA	NA	NA	NA
AYC48578.1|3823035_3827490_-	ATP-binding protein	NA	A0A2H4PQV1	Staphylococcus_phage	32.4	1.1e-43
AYC48579.1|3828027_3828612_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	97.9	1.5e-107
AYC48580.1|3828611_3831890_-|tail	phage tail protein	tail	X2KTY7	Enterobacteria_phage	58.8	6.5e-06
AYC48581.1|3831954_3832554_-	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
AYC48582.1|3832997_3835337_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	98.4	0.0e+00
AYC48583.1|3835397_3836045_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	2.5e-111
AYC48584.1|3835942_3836686_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	2.3e-148
AYC49663.1|3836691_3838842_-|tail	phage minor tail protein L	tail	A0A291AWY5	Escherichia_phage	98.7	0.0e+00
AYC48585.1|3838952_3839444_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
AYC48586.1|3840126_3840420_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
AYC48587.1|3840510_3840693_-	hypothetical protein	NA	K7PHU6	Enterobacteria_phage	98.3	7.2e-16
AYC48588.1|3840909_3841386_-	lysozyme	NA	K7PKV2	Enterobacteria_phage	94.3	1.1e-82
AYC48589.1|3841389_3841716_-|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	99.1	1.2e-56
AYC48590.1|3842170_3843166_+|protease	serine protease	protease	NA	NA	NA	NA
AYC48591.1|3843370_3843736_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	90.0	4.5e-57
AYC48592.1|3843750_3844740_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	5.6e-195
AYC48593.1|3844747_3845557_-	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	98.1	2.4e-151
AYC48594.1|3845576_3845966_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	96.9	1.9e-66
AYC48595.1|3845962_3846322_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	100.0	5.9e-54
AYC48596.1|3846288_3846783_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	96.9	1.1e-85
AYC48597.1|3846779_3847721_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.3	2.2e-140
AYC48598.1|3847710_3847890_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	66.7	1.7e-14
AYC49664.1|3848065_3848617_-	hypothetical protein	NA	S5FXP0	Shigella_phage	98.9	7.6e-101
AYC48599.1|3848654_3848855_-	cell division protein	NA	NA	NA	NA	NA
AYC48600.1|3848952_3849579_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
AYC48601.1|3849811_3850033_+	hypothetical protein	NA	NA	NA	NA	NA
AYC48602.1|3850004_3850439_-	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
AYC48603.1|3850357_3850561_-	hypothetical protein	NA	U5P0J5	Shigella_phage	94.0	3.4e-30
AYC48604.1|3850610_3850835_-	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	63.1	3.2e-13
AYC48605.1|3850907_3851270_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
AYC48606.1|3851335_3852160_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	2.3e-149
AYC48607.1|3852287_3852824_+	HD family hydrolase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
AYC48608.1|3852814_3853177_+	hypothetical protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
AYC48609.1|3853176_3853482_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
AYC48610.1|3853481_3853832_+	DNA-binding protein	NA	U5P4J3	Shigella_phage	99.1	1.1e-60
AYC49665.1|3853933_3854872_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	4.7e-183
AYC48611.1|3855076_3856330_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
3854873:3854932	attR	CTTATTGATTTAAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
AYC48612.1|3856341_3857445_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AYC48613.1|3857732_3858788_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
AYC48614.1|3858826_3859228_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
AYC48615.1|3859285_3860530_-	esterase	NA	NA	NA	NA	NA
AYC48616.1|3860621_3861080_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
AYC48617.1|3861340_3862798_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
AYC48618.1|3863154_3863421_-	hypothetical protein	NA	NA	NA	NA	NA
AYC48619.1|3863727_3864180_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYC48620.1|3864176_3865232_-	DNA polymerase IV	NA	NA	NA	NA	NA
AYC49666.1|3865302_3866091_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
AYC48621.1|3866032_3867772_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
AYC48622.1|3868089_3868587_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 10
CP032426	Escherichia coli strain SCEC020001 chromosome, complete genome	4908742	4151532	4165807	4908742	tail	Enterobacteria_phage(35.29%)	18	NA	NA
AYC48856.1|4151532_4151712_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	2.0e-10
AYC48857.1|4151820_4152426_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
AYC48858.1|4152818_4154405_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
AYC48859.1|4154624_4154873_+	damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	5.4e-38
AYC48860.1|4155218_4156451_+	hypothetical protein	NA	K7PHS1	Enterobacteria_phage	99.3	4.3e-237
AYC48861.1|4156579_4157164_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.5e-102
AYC48862.1|4157163_4160391_-|tail	phage tail protein	tail	X2KTY7	Enterobacteria_phage	79.4	3.9e-88
AYC48863.1|4160455_4161055_-	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	8.8e-111
AYC48864.1|4161089_4161290_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	3.1e-28
AYC48865.1|4161380_4162055_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	99.6	6.0e-132
AYC48866.1|4162124_4162355_+	hypothetical protein	NA	A0A291AWY6	Escherichia_phage	97.4	2.5e-13
AYC48867.1|4162456_4162651_-	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	100.0	1.0e-31
AYC48868.1|4162723_4163086_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.1e-60
AYC48869.1|4163151_4163976_+	DUF2303 family protein	NA	U5P439	Shigella_phage	98.9	7.3e-148
AYC48870.1|4164103_4164640_+	HD family hydrolase	NA	U5P0T3	Shigella_phage	98.9	1.6e-100
AYC48871.1|4164630_4164993_+	hypothetical protein	NA	U5P092	Shigella_phage	95.8	4.4e-65
AYC48872.1|4164992_4165613_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	91.3	2.2e-112
AYC48873.1|4165612_4165807_+	DNA-binding protein	NA	A5LH59	Enterobacteria_phage	96.9	1.3e-31
>prophage 11
CP032426	Escherichia coli strain SCEC020001 chromosome, complete genome	4908742	4260326	4266885	4908742	transposase	uncultured_Caudovirales_phage(16.67%)	7	NA	NA
AYC48962.1|4260326_4261283_+	iron-dicitrate ABC transporter permease FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
AYC48963.1|4261283_4262051_+	Fe(3+) dicitrate transport ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
AYC48964.1|4262608_4263022_-	hypothetical protein	NA	NA	NA	NA	NA
AYC48965.1|4263917_4265069_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
AYC48966.1|4264988_4265339_-|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	8.9e-39
AYC48967.1|4265439_4266012_+	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
AYC48968.1|4266060_4266885_-	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
>prophage 1
CP032425	Escherichia coli strain SCEC020001 plasmid pOXA1_020001, complete sequence	88392	10495	46350	88392	protease,transposase	Escherichia_phage(33.33%)	39	NA	NA
AYC45070.1|10495_11518_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
AYC45071.1|12597_12972_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	9.8e-60
AYC45072.1|12996_13701_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYC45145.1|14332_15163_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
AYC45146.1|15293_15848_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
AYC45073.1|15991_16696_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYC45147.1|18317_18560_+	relaxase	NA	NA	NA	NA	NA
AYC45074.1|18591_19269_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AYC45075.1|19347_20547_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AYC45076.1|20578_21463_-	EamA family transporter	NA	NA	NA	NA	NA
AYC45148.1|21600_21993_-	cysteine hydrolase	NA	NA	NA	NA	NA
AYC45077.1|22769_23375_-	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
AYC45078.1|23469_26367_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
AYC45079.1|26402_26507_-	hypothetical protein	NA	NA	NA	NA	NA
AYC45080.1|26503_26968_-	mRNA interferase PemK	NA	NA	NA	NA	NA
AYC45081.1|27187_27841_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYC45082.1|28030_28417_-	hypothetical protein	NA	NA	NA	NA	NA
AYC45083.1|28779_29637_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AYC45149.1|29629_29704_-	positive regulator of RepFIC repA1 expression	NA	NA	NA	NA	NA
AYC45084.1|29787_29898_+	replication protein RepA	NA	NA	NA	NA	NA
AYC45085.1|29938_30196_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
AYC45086.1|30600_31623_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AYC45087.1|32094_32448_+	hypothetical protein	NA	NA	NA	NA	NA
AYC45088.1|32860_33439_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
AYC45089.1|34277_34640_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	88.5	9.0e-34
AYC45090.1|34636_34987_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
AYC45091.1|35017_35239_+	hypothetical protein	NA	NA	NA	NA	NA
AYC45092.1|35595_36075_-	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
AYC45093.1|36155_37559_-	YfcC family protein	NA	NA	NA	NA	NA
AYC45094.1|37606_38611_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
AYC45095.1|38695_39607_-	carbamate kinase	NA	NA	NA	NA	NA
AYC45096.1|39617_40838_-	arginine deiminase	NA	NA	NA	NA	NA
AYC45150.1|42597_42672_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
AYC45097.1|42755_42872_+	replication protein RepA	NA	NA	NA	NA	NA
AYC45098.1|42907_43165_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
AYC45151.1|43448_43598_-	Hok/Gef family protein	NA	NA	NA	NA	NA
AYC45099.1|43653_43896_+	hypothetical protein	NA	NA	NA	NA	NA
AYC45100.1|43841_44075_-	hypothetical protein	NA	NA	NA	NA	NA
AYC45101.1|44778_46350_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
