The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032892	Escherichia coli strain SCEC020022 chromosome, complete genome	4894694	107175	122418	4894694		Salmonella_phage(37.5%)	12	NA	NA
AYL89342.1|107175_109932_-	hypothetical protein	NA	Q858F8	Salmonella_phage	88.9	0.0e+00
AYL89343.1|109931_111992_-	hypothetical protein	NA	Q858F9	Salmonella_phage	59.9	3.6e-204
AYL89344.1|111991_114523_-	hypothetical protein	NA	Q858G0	Salmonella_phage	78.4	0.0e+00
AYL89345.1|114619_114826_-	hypothetical protein	NA	NA	NA	NA	NA
AYL89346.1|115193_115610_-	hypothetical protein	NA	A0A077SLR9	Escherichia_phage	72.5	1.2e-21
AYL89347.1|115590_116088_-	proQ/FINO family protein	NA	Q2A0A1	Sodalis_phage	46.3	9.2e-13
AYL89348.1|116124_116547_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AYL89349.1|116757_118884_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	53.6	1.8e-174
AYL89350.1|118880_119183_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AYL89351.1|119185_119443_-	hypothetical protein	NA	NA	NA	NA	NA
AYL89352.1|120950_121727_-	GIY-YIG nuclease family protein	NA	A0A2I7RCQ2	Vibrio_phage	30.2	8.4e-05
AYL89353.1|121719_122418_-	hypothetical protein	NA	A0A0S2SYC0	Pseudomonas_phage	38.7	1.1e-11
>prophage 2
CP032892	Escherichia coli strain SCEC020022 chromosome, complete genome	4894694	1137916	1145056	4894694		Escherichia_phage(83.33%)	6	NA	NA
AYL90273.1|1137916_1138555_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AYL90274.1|1138551_1139814_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.7	5.7e-136
AYL90275.1|1139810_1140719_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
AYL90276.1|1140914_1141682_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
AYL90277.1|1141732_1142389_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
AYL90278.1|1142494_1145056_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	2.3e-30
>prophage 3
CP032892	Escherichia coli strain SCEC020022 chromosome, complete genome	4894694	1343101	1386955	4894694	terminase,holin,integrase,tail	Escherichia_phage(49.02%)	53	1346200:1346216	1385103:1385119
AYL90453.1|1343101_1344568_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
AYL90454.1|1344636_1346214_+	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
1346200:1346216	attL	ATTGAGTGGGAATGATT	NA	NA	NA	NA
AYL90455.1|1346406_1347663_+|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.0	1.3e-236
AYL90456.1|1347665_1348325_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	79.0	9.7e-103
AYL90457.1|1348321_1348972_-	adenine methylase	NA	G9L699	Escherichia_phage	99.1	2.5e-127
AYL93648.1|1348964_1349216_-	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	100.0	3.1e-41
AYL90458.1|1349373_1349622_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
AYL90459.1|1349671_1350613_-	recombinase RecT	NA	A0A0F6TJP0	Escherichia_coli_O157_typing_phage	100.0	2.6e-178
AYL90460.1|1350609_1351431_-	exodeoxyribonuclease VIII	NA	G9L6A3	Escherichia_phage	98.2	3.0e-162
AYL90461.1|1351427_1351727_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	99.0	7.6e-47
AYL90462.1|1352035_1352620_-	XRE family transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	99.5	2.7e-104
AYL90463.1|1352774_1353005_+	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
AYL90464.1|1353155_1353356_+	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	6.0e-32
AYL90465.1|1353371_1354205_+	primosomal protein	NA	Q286X4	Escherichia_phage	94.6	1.7e-115
AYL93649.1|1354201_1354987_+	replication protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	99.6	6.1e-152
AYL90466.1|1355104_1355449_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	95.6	3.4e-59
AYL90467.1|1355510_1355960_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	80.5	4.8e-29
AYL90468.1|1355956_1356568_+	ead/Ea22-like family protein	NA	A0A2D1GLY5	Escherichia_phage	66.2	5.0e-61
AYL90469.1|1356569_1356761_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	2.1e-26
AYL90470.1|1356763_1357528_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	51.2	6.5e-58
AYL90471.1|1357520_1357802_+	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	97.8	4.5e-49
AYL90472.1|1357794_1358133_+	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	94.6	2.5e-54
AYL90473.1|1358173_1358848_+|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	99.6	2.6e-119
AYL90474.1|1358844_1360320_+|terminase	terminase	terminase	A0A0F6TK57	Escherichia_coli_O157_typing_phage	99.2	4.9e-296
AYL90475.1|1360410_1360785_-	hypothetical protein	NA	Q716B1	Shigella_phage	74.6	1.4e-42
AYL90476.1|1361490_1361697_+	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
AYL90477.1|1361711_1363391_+|tail	phage tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	98.7	5.2e-302
AYL90478.1|1363387_1363684_+	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
AYL90479.1|1363686_1364382_+	peptidase	NA	G9L6C4	Escherichia_phage	99.1	1.8e-94
AYL90480.1|1364396_1365383_+	hypothetical protein	NA	G9L6C5	Escherichia_phage	100.0	1.5e-187
AYL90481.1|1365434_1365872_+	hypothetical protein	NA	A0A0F6R7N9	Escherichia_coli_O157_typing_phage	100.0	2.2e-74
AYL90482.1|1365882_1366218_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	100.0	7.7e-56
AYL90483.1|1366268_1366592_+	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	100.0	2.4e-54
AYL90484.1|1366591_1367197_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	99.5	1.8e-111
AYL90485.1|1367196_1369668_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	98.9	0.0e+00
AYL90486.1|1369667_1370132_+	hypothetical protein	NA	G9L6D1	Escherichia_phage	100.0	8.4e-85
AYL90487.1|1370131_1370677_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	99.4	2.2e-92
AYL90488.1|1370676_1373190_+	hypothetical protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	97.5	0.0e+00
AYL90489.1|1373186_1374989_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	97.8	0.0e+00
AYL90490.1|1374994_1377469_+	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	98.8	0.0e+00
AYL90491.1|1377664_1377961_+	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	100.0	2.5e-50
AYL90492.1|1377992_1378154_-	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
AYL90493.1|1378248_1378788_-	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
AYL90494.1|1378997_1379684_-	anti-repressor protein	NA	G9L6E2	Escherichia_phage	82.3	1.6e-103
AYL90495.1|1379997_1380255_-	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	98.8	1.7e-42
AYL90496.1|1383194_1383599_+	hypothetical protein	NA	T1SA79	Salmonella_phage	91.0	7.4e-61
AYL90497.1|1383585_1383894_+|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	93.1	1.3e-46
AYL90498.1|1383883_1384513_+	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	97.6	1.1e-114
AYL90499.1|1384509_1384992_+	DUF2514 domain-containing protein	NA	A0A0F6TK39	Escherichia_coli_O157_typing_phage	93.1	1.5e-73
AYL90500.1|1385209_1385749_-	hypothetical protein	NA	G9L6F0	Escherichia_phage	99.4	9.9e-45
1385103:1385119	attR	ATTGAGTGGGAATGATT	NA	NA	NA	NA
AYL90501.1|1385764_1386283_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	8.5e-62
AYL90502.1|1386593_1386785_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
AYL90503.1|1386802_1386955_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
>prophage 4
CP032892	Escherichia coli strain SCEC020022 chromosome, complete genome	4894694	1765117	1774559	4894694		Enterobacteria_phage(85.71%)	10	NA	NA
AYL90833.1|1765117_1766044_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
AYL90834.1|1766048_1766780_+	ABC transporter permease	NA	NA	NA	NA	NA
AYL90835.1|1766760_1766868_-	protein YohO	NA	NA	NA	NA	NA
AYL90836.1|1766927_1767659_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
AYL90837.1|1767880_1769566_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AYL90838.1|1769562_1770282_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AYL90839.1|1770328_1770799_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AYL90840.1|1770839_1771301_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AYL90841.1|1771425_1773426_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
AYL90842.1|1773422_1774559_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.6e-161
>prophage 5
CP032892	Escherichia coli strain SCEC020022 chromosome, complete genome	4894694	1865898	1873427	4894694		Enterobacteria_phage(28.57%)	8	NA	NA
AYL90915.1|1865898_1867293_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	3.7e-19
AYL90916.1|1867450_1868446_+	N-acetyl-alpha-D-glucosaminyl-diphospho-ditrans, octacis-undecaprenol 4-epimerase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
AYL90917.1|1868688_1869582_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
AYL90918.1|1869618_1869882_-	hypothetical protein	NA	NA	NA	NA	NA
AYL90919.1|1869953_1871039_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	1.0e-101
AYL90920.1|1871038_1871938_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	5.7e-29
AYL90921.1|1871995_1872874_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
AYL90922.1|1872878_1873427_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	56.1	8.5e-52
>prophage 6
CP032892	Escherichia coli strain SCEC020022 chromosome, complete genome	4894694	2357452	2435439	4894694	capsid,head,terminase,lysis,protease,portal,integrase,tail	Enterobacteria_phage(46.3%)	94	2401271:2401330	2413748:2413813
AYL91379.1|2357452_2358274_-|protease	serine protease	protease	NA	NA	NA	NA
AYL91380.1|2358373_2358457_-	hypothetical protein	NA	NA	NA	NA	NA
AYL91381.1|2358549_2358885_-	acid shock protein	NA	NA	NA	NA	NA
AYL91382.1|2359281_2360535_-	MFS transporter	NA	NA	NA	NA	NA
AYL91383.1|2360641_2361535_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYL91384.1|2361669_2362890_+	ROK family transcriptional regulator	NA	NA	NA	NA	NA
AYL91385.1|2363014_2363710_+	dethiobiotin synthase	NA	NA	NA	NA	NA
AYL91386.1|2363662_2364955_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
AYL91387.1|2365113_2365728_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
AYL91388.1|2365770_2366625_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AYL91389.1|2366626_2367244_-	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
AYL93681.1|2367254_2369678_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
AYL91390.1|2369738_2372165_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	2.9e-213
AYL91391.1|2372363_2372669_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AYL93682.1|2372776_2373487_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
AYL91392.1|2373489_2374050_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AYL91393.1|2374084_2374426_-	DUF1283 family protein	NA	NA	NA	NA	NA
AYL91394.1|2374560_2374887_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AYL91395.1|2375092_2376307_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AYL91396.1|2376318_2377338_+	starvation-sensing protein RspB	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
AYL91397.1|2377395_2377524_+	transporter	NA	NA	NA	NA	NA
AYL91398.1|2377525_2378821_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.6	2.3e-156
AYL91399.1|2378840_2379092_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AYL91400.1|2379164_2381636_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	1.5e-58
AYL91401.1|2381729_2381921_-	DUF1482 family protein	NA	NA	NA	NA	NA
AYL91402.1|2381917_2382106_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AYL93683.1|2382455_2382659_+	hypothetical protein	NA	NA	NA	NA	NA
AYL91403.1|2382645_2382861_-	hypothetical protein	NA	NA	NA	NA	NA
AYL91404.1|2382890_2383061_-	hypothetical protein	NA	NA	NA	NA	NA
AYL93684.1|2383020_2383176_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
AYL91405.1|2383441_2383861_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
AYL91406.1|2383961_2384243_+	Cro/Cl family transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
AYL91407.1|2384226_2384652_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AYL91408.1|2384723_2385794_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	64.6	4.7e-62
AYL91409.1|2385834_2386257_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
AYL91410.1|2386591_2388595_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.2	3.4e-21
AYL91411.1|2388658_2389936_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
AYL91412.1|2390066_2390948_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYL91413.1|2390944_2391637_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
AYL91414.1|2391648_2392848_-	MFS transporter	NA	NA	NA	NA	NA
AYL91415.1|2393209_2393353_+	hypothetical protein	NA	NA	NA	NA	NA
AYL91416.1|2393511_2393724_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	98.5	3.1e-26
AYL91417.1|2393891_2394170_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
AYL91418.1|2394171_2395221_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.1e-108
AYL91419.1|2395233_2395608_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
AYL91420.1|2395604_2396426_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	2.1e-78
AYL91421.1|2396964_2397291_+	hypothetical protein	NA	NA	NA	NA	NA
AYL91422.1|2397326_2397458_+	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
AYL91423.1|2397824_2398253_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
AYL93685.1|2398424_2398799_+	tolA family protein	NA	NA	NA	NA	NA
AYL91424.1|2399050_2399266_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	95.8	5.9e-33
AYL91425.1|2399265_2399763_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
AYL91426.1|2399759_2400221_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	98.0	2.7e-75
AYL91427.1|2400252_2400546_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
AYL91428.1|2400908_2401103_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	93.8	2.2e-26
2401271:2401330	attL	GCGGGTCCTTTCCGGCGATCCGACAGGTTACGGGGCGGCGACCTCGCGGGTTTTCGCTAT	NA	NA	NA	NA
AYL91429.1|2401491_2402037_+	DNA-packaging protein NU1	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
AYL91430.1|2402011_2403937_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
AYL91431.1|2403933_2404140_+|tail	phage tail protein	tail	A0A2R9YJL2	Escherichia_phage	98.5	4.9e-29
AYL91432.1|2404136_2405018_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.2	8.0e-161
AYL91433.1|2405166_2406408_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	42.9	9.1e-94
AYL91434.1|2406409_2406667_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AYL91435.1|2407394_2407574_-	hypothetical protein	NA	NA	NA	NA	NA
AYL91436.1|2407631_2407937_-	hypothetical protein	NA	NA	NA	NA	NA
AYL91437.1|2408136_2408334_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
AYL91438.1|2408326_2408647_+	hypothetical protein	NA	NA	NA	NA	NA
AYL91439.1|2408653_2408953_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AYL91440.1|2408949_2410767_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	50.7	1.5e-129
AYL91441.1|2411054_2411300_+	hypothetical protein	NA	NA	NA	NA	NA
AYL91442.1|2411296_2411719_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AYL91443.1|2411936_2412977_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	41.9	8.8e-66
AYL91444.1|2412986_2413328_+|head	head decoration protein	head	NA	NA	NA	NA
AYL91445.1|2413339_2413723_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AYL91446.1|2413924_2414467_+|terminase	terminase	terminase	O64316	Escherichia_phage	48.1	3.8e-36
2413748:2413813	attR	GCGGGTCCTTTCCGGCGATCCGACAGGTTACGGGGCGGCGACCTCGCGGGTTTTCGCTATTTATGA	NA	NA	NA	NA
AYL91447.1|2414478_2414763_+	hypothetical protein	NA	NA	NA	NA	NA
AYL91448.1|2414887_2415082_-	hypothetical protein	NA	NA	NA	NA	NA
AYL91449.1|2416554_2417874_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.5	3.4e-232
AYL91450.1|2417883_2418216_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
AYL91451.1|2418271_2419297_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.4e-188
AYL91452.1|2419338_2419734_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
AYL91453.1|2419745_2420099_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
AYL91454.1|2420110_2420689_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	3.5e-80
AYL91455.1|2420685_2421081_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
AYL93686.1|2421088_2421829_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.6	1.7e-132
AYL91456.1|2421844_2422267_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
AYL91457.1|2422248_2422683_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
AYL91458.1|2422675_2425237_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.7	0.0e+00
AYL91459.1|2425233_2425563_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
AYL91460.1|2425562_2426261_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.1e-131
AYL91461.1|2426266_2427010_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.3e-148
AYL91462.1|2426907_2427579_+|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	87.9	1.3e-99
AYL91463.1|2427639_2431053_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.8	0.0e+00
AYL91464.1|2431122_2431722_+	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	95.5	3.5e-107
AYL91465.1|2431786_2434858_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	81.4	1.6e-67
AYL91466.1|2434857_2435439_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	2.5e-102
>prophage 7
CP032892	Escherichia coli strain SCEC020022 chromosome, complete genome	4894694	2552235	2592809	4894694	transposase,protease	Staphylococcus_phage(18.18%)	36	NA	NA
AYL93691.1|2552235_2553210_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.8	1.2e-51
AYL91558.1|2553299_2554046_-	PAP2 family protein	NA	NA	NA	NA	NA
AYL91559.1|2554093_2555719_-	phosphoethanolamine--lipid A transferase MCR-1.1	NA	NA	NA	NA	NA
AYL93692.1|2555914_2556889_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
AYL91560.1|2557176_2557629_-	hypothetical protein	NA	NA	NA	NA	NA
AYL91561.1|2557658_2558567_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AYL91562.1|2558652_2559789_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AYL93693.1|2560375_2560585_-	hypothetical protein	NA	NA	NA	NA	NA
AYL91563.1|2560782_2564991_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.3	4.1e-21
AYL91564.1|2565058_2567167_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.3	9.6e-27
AYL91565.1|2567987_2568200_-	hypothetical protein	NA	NA	NA	NA	NA
AYL91566.1|2568275_2568893_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
AYL91567.1|2569159_2570659_+	L-asparagine permease	NA	NA	NA	NA	NA
AYL91568.1|2570773_2571835_-	YncE family protein	NA	NA	NA	NA	NA
AYL91569.1|2572076_2574179_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.6	8.1e-135
AYL91570.1|2574214_2574880_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYL91571.1|2575077_2576115_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
AYL91572.1|2576295_2576814_+	L-amino acid N-acyltransferase MnaT	NA	NA	NA	NA	NA
AYL91573.1|2576810_2577260_+	DMT family transporter	NA	NA	NA	NA	NA
AYL91574.1|2577260_2577494_-	DUF2526 domain-containing protein	NA	NA	NA	NA	NA
AYL93694.1|2577579_2577753_-	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
AYL91575.1|2577947_2578043_+	stress response membrane protein YncL	NA	NA	NA	NA	NA
AYL91576.1|2578444_2579254_-	antibiotic acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	41.0	7.7e-17
AYL91577.1|2579463_2580888_-	aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
AYL91578.1|2580909_2581704_-	ABC transporter permease	NA	NA	NA	NA	NA
AYL91579.1|2581693_2582635_-	ABC transporter permease	NA	NA	NA	NA	NA
AYL91580.1|2582635_2583649_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
AYL91581.1|2583666_2584812_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
AYL91582.1|2585056_2586463_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
AYL93695.1|2586541_2586958_-	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	58.5	1.6e-31
AYL91583.1|2587003_2587180_-	mRNA interferase HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
AYL91584.1|2587401_2587632_+	DUF2554 family protein	NA	NA	NA	NA	NA
AYL91585.1|2587723_2589685_-|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	28.9	7.1e-24
AYL91586.1|2589757_2590294_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYL91587.1|2590346_2591561_+	benzoate transporter BenE	NA	NA	NA	NA	NA
AYL91588.1|2591600_2592809_-|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	92.5	1.5e-205
>prophage 8
CP032892	Escherichia coli strain SCEC020022 chromosome, complete genome	4894694	3025377	3153440	4894694	capsid,plate,head,integrase,terminase,lysis,transposase,protease,portal,holin,tRNA,tail	Escherichia_phage(42.37%)	117	3037315:3037335	3140093:3140113
AYL91986.1|3025377_3027138_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYL93719.1|3027206_3027725_+	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
AYL91987.1|3027794_3027962_-	ribosome modulation factor	NA	NA	NA	NA	NA
AYL91988.1|3028217_3028781_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
AYL91989.1|3028777_3030418_-	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYL91990.1|3030422_3031676_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
AYL91991.1|3031805_3033713_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.4e-53
AYL91992.1|3033723_3035832_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
AYL91993.1|3036075_3037185_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYL91994.1|3037181_3037724_-	cell division protein ZapC	NA	NA	NA	NA	NA
3037315:3037335	attL	AGTGCGGCATTTTCGCCAGAT	NA	NA	NA	NA
AYL91995.1|3037897_3038908_-	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AYL91996.1|3039018_3039729_-	fimbrial chaperone	NA	NA	NA	NA	NA
AYL91997.1|3039721_3040237_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AYL91998.1|3040244_3040787_-	fimbrial protein	NA	NA	NA	NA	NA
AYL91999.1|3040798_3041869_-	fimbrial protein	NA	NA	NA	NA	NA
AYL92000.1|3041859_3044460_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AYL92001.1|3044484_3045186_-	molecular chaperone	NA	NA	NA	NA	NA
AYL92002.1|3045268_3045811_-	fimbrial protein	NA	NA	NA	NA	NA
AYL92003.1|3046166_3046742_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
AYL92004.1|3046734_3047694_+	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYL92005.1|3047690_3048836_+	alkanesulfonate monooxygenase, FMNH(2)-dependent	NA	NA	NA	NA	NA
AYL92006.1|3048846_3049638_+	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
AYL92007.1|3049634_3050402_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
AYL92008.1|3050608_3053221_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
AYL92009.1|3053486_3054689_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AYL92010.1|3054857_3056258_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
AYL92011.1|3058132_3059323_+	aspartate aminotransferase	NA	NA	NA	NA	NA
AYL92012.1|3059544_3060192_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AYL93720.1|3060218_3060767_-	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
AYL92013.1|3060947_3062795_-	L,D-transpeptidase	NA	NA	NA	NA	NA
AYL92014.1|3063055_3067516_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
AYL92015.1|3067515_3068220_-	condensin subunit E	NA	NA	NA	NA	NA
AYL92016.1|3068200_3069523_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
AYL92017.1|3069519_3070305_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
AYL92018.1|3070440_3071220_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
AYL92019.1|3071196_3072090_-	hypothetical protein	NA	NA	NA	NA	NA
AYL92020.1|3072243_3072990_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AYL92021.1|3072986_3073169_-	protein YcaR	NA	NA	NA	NA	NA
AYL92022.1|3073220_3074453_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYL92023.1|3074489_3075476_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AYL92024.1|3075472_3077221_-	lipid A export ATP-binding/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
AYL92025.1|3077257_3079522_-	ComEC family protein	NA	NA	NA	NA	NA
AYL92026.1|3079728_3080013_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
AYL92027.1|3080172_3081846_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
AYL92028.1|3081956_3082640_-	cytidylate kinase	NA	NA	NA	NA	NA
AYL92029.1|3082812_3083577_-|protease	metalloprotease	protease	NA	NA	NA	NA
AYL92030.1|3083745_3085029_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AYL92031.1|3085099_3086188_-	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
AYL92032.1|3086386_3087079_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AYL92033.1|3087208_3088969_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
AYL92034.1|3089374_3090232_+	formate transporter FocA	NA	NA	NA	NA	NA
AYL92035.1|3090286_3092569_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.0e-162
AYL92036.1|3092888_3093143_-	DNA-binding transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	6.1e-45
AYL92037.1|3093188_3094352_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	3.1e-205
AYL92038.1|3094351_3094831_-|tail	phage tail protein	tail	O64315	Escherichia_phage	100.0	5.1e-85
AYL92039.1|3094845_3097293_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.3	0.0e+00
AYL93721.1|3097285_3097405_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AYL92040.1|3097437_3097713_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
AYL92041.1|3097769_3098288_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	98.8	1.6e-92
AYL92042.1|3098300_3099491_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
AYL92043.1|3099550_3100144_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	98.0	1.2e-104
AYL92044.1|3100174_3100681_+	hypothetical protein	NA	NA	NA	NA	NA
AYL92045.1|3100683_3101094_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	42.5	5.4e-19
AYL92046.1|3101074_3101308_-	hypothetical protein	NA	NA	NA	NA	NA
AYL92047.1|3102569_3103181_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	4.9e-117
AYL92048.1|3103173_3104082_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	100.0	1.2e-162
AYL92049.1|3104086_3104434_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
AYL92050.1|3104430_3105066_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.5e-111
AYL92051.1|3105132_3105585_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
AYL92052.1|3105577_3106045_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	1.9e-81
AYL92053.1|3106007_3106181_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
AYL92054.1|3106152_3106578_-|lysis	LysB family phage lysis regulatory protein	lysis	Q7Y4E2	Escherichia_virus	94.3	1.4e-65
AYL92055.1|3106565_3106991_-	protein lysA	NA	A0A0F7LBP4	Escherichia_phage	94.3	1.8e-57
AYL92056.1|3107005_3107503_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
AYL92057.1|3107502_3107784_-|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
AYL92058.1|3107787_3107991_-|tail	phage tail protein	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
AYL92059.1|3107990_3108500_-|head	head completion/stabilization protein	head	A0A0F7L9Y3	Escherichia_phage	99.4	4.3e-90
AYL92060.1|3108599_3109343_-|terminase	terminase	terminase	Q858W5	Yersinia_virus	98.0	7.8e-125
AYL92061.1|3109346_3110420_-|capsid	phage major capsid protein, P2 family	capsid	Q94MH9	Enterobacteria_phage	98.6	1.3e-200
AYL92062.1|3110478_3111333_-|capsid	capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	100.0	1.3e-139
AYL92063.1|3111506_3113279_+	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	99.3	0.0e+00
AYL92064.1|3113278_3114313_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.1	1.2e-200
AYL92065.1|3114923_3116009_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AYL92066.1|3116023_3116512_-	phosphohistidine phosphatase	NA	NA	NA	NA	NA
AYL92067.1|3118778_3119525_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
AYL92068.1|3119539_3121081_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
AYL92069.1|3121482_3121758_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
AYL92070.1|3121754_3121979_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
AYL92071.1|3121978_3122281_-	hypothetical protein	NA	A0A0F7LDT6	Escherichia_phage	99.0	2.2e-46
AYL92072.1|3122280_3122505_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
AYL92073.1|3122568_3123069_-	replication protein B	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
AYL92074.1|3123065_3123263_-	hypothetical protein	NA	A0A0F7LDS9	Escherichia_phage	100.0	2.8e-29
AYL92075.1|3123246_3123603_-	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	100.0	1.1e-63
AYL92076.1|3123707_3124019_+	XRE family transcriptional regulator	NA	Q1JS25	Enterobacteria_phage	100.0	4.3e-53
AYL92077.1|3124112_3125108_+|integrase	site-specific integrase	integrase	A0A0F7LBR0	Escherichia_phage	99.7	7.1e-190
AYL92078.1|3125139_3125937_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
AYL92079.1|3126018_3126609_-	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
AYL92080.1|3126708_3127617_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYL92081.1|3127617_3129048_-	inner membrane transporter YcaM	NA	NA	NA	NA	NA
AYL92082.1|3129257_3130406_-	MFS transporter	NA	NA	NA	NA	NA
AYL92083.1|3130720_3131347_+	hydrolase	NA	NA	NA	NA	NA
AYL92084.1|3131382_3132246_-	dimethyl sulfoxide reductase	NA	NA	NA	NA	NA
AYL92085.1|3132247_3132865_-	dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
AYL92086.1|3132875_3135320_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.9	3.0e-221
AYL92087.1|3135558_3136851_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
AYL92088.1|3136941_3138285_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
AYL92089.1|3138295_3138907_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AYL92090.1|3139061_3143129_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
3140093:3140113	attR	AGTGCGGCATTTTCGCCAGAT	NA	NA	NA	NA
AYL92091.1|3143263_3143758_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AYL92092.1|3143857_3144070_-	hypothetical protein	NA	NA	NA	NA	NA
AYL92093.1|3144302_3145268_+	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
AYL92094.1|3145390_3147157_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
AYL92095.1|3147157_3148879_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
AYL92096.1|3148920_3149625_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AYL92097.1|3149909_3150128_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AYL92098.1|3150812_3153089_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
AYL92099.1|3153119_3153440_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 9
CP032892	Escherichia coli strain SCEC020022 chromosome, complete genome	4894694	3775212	3790053	4894694	integrase	Enterobacteria_phage(88.89%)	17	NA	NA
AYL92641.1|3775212_3777411_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
AYL92642.1|3777420_3778377_+	XdhC family protein	NA	NA	NA	NA	NA
AYL92643.1|3778355_3778766_+	transcriptional regulator	NA	NA	NA	NA	NA
AYL92644.1|3779016_3779169_-|integrase	attP region and P4int integrase	integrase	NA	NA	NA	NA
AYL92645.1|3779384_3781718_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.6	0.0e+00
AYL92646.1|3781732_3782053_-	hypothetical protein	NA	NA	NA	NA	NA
AYL92647.1|3782188_3782644_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
AYL92648.1|3782636_3782924_-	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
AYL92649.1|3782916_3783516_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	80.3	1.9e-49
AYL92650.1|3783512_3783779_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
AYL92651.1|3783791_3783983_-	hypothetical protein	NA	NA	NA	NA	NA
AYL92652.1|3784330_3785065_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	98.4	1.4e-129
AYL92653.1|3785061_3785562_+	transactivation protein	NA	NA	NA	NA	NA
AYL92654.1|3785635_3786208_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	6.5e-95
AYL92655.1|3786510_3787251_-	hypothetical protein	NA	NA	NA	NA	NA
AYL92656.1|3787247_3788876_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
AYL92657.1|3788868_3790053_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	61.4	3.2e-144
>prophage 10
CP032892	Escherichia coli strain SCEC020022 chromosome, complete genome	4894694	3800912	3858687	4894694	integrase,plate	Enterobacteria_phage(18.18%)	53	3790216:3790259	3816150:3816193
3790216:3790259	attL	GATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTAC	NA	NA	NA	NA
AYL92665.1|3800912_3802850_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AYL93741.1|3803041_3804376_+|integrase	integrase	integrase	NA	NA	NA	NA
AYL92666.1|3804456_3805134_-	hypothetical protein	NA	A0A1D7XFF4	Escherichia_phage	51.8	1.7e-46
AYL92667.1|3805181_3807023_-	hypothetical protein	NA	A0A140G5Z0	Enterobacteria_phage	27.5	4.2e-18
AYL92668.1|3807057_3807255_-	hypothetical protein	NA	NA	NA	NA	NA
AYL92669.1|3807410_3808442_-	hypothetical protein	NA	NA	NA	NA	NA
AYL92670.1|3808456_3808840_-	hypothetical protein	NA	NA	NA	NA	NA
AYL92671.1|3808844_3809042_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
AYL92672.1|3810023_3810326_-	transporter	NA	NA	NA	NA	NA
AYL92673.1|3810325_3810529_-	ABC transporter ATPase	NA	NA	NA	NA	NA
AYL92674.1|3810586_3810967_-	hypothetical protein	NA	NA	NA	NA	NA
AYL92675.1|3811101_3811671_-	transcriptional regulator	NA	NA	NA	NA	NA
AYL92676.1|3811914_3812115_-	hypothetical protein	NA	NA	NA	NA	NA
AYL92677.1|3813529_3813766_-	hypothetical protein	NA	NA	NA	NA	NA
AYL92678.1|3814221_3814773_-	hypothetical protein	NA	A0A1L5C2A2	Pseudoalteromonas_phage	60.0	1.2e-05
AYL92679.1|3815778_3816093_+	hypothetical protein	NA	NA	NA	NA	NA
AYL92680.1|3816341_3817595_-	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
3816150:3816193	attR	GATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTAC	NA	NA	NA	NA
AYL92681.1|3817606_3818710_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AYL92682.1|3818997_3820053_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.0e-118
AYL92683.1|3820091_3820493_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
AYL92684.1|3820550_3821795_-	esterase	NA	NA	NA	NA	NA
AYL92685.1|3821886_3822345_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
AYL92686.1|3822605_3824063_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
AYL92687.1|3824119_3824734_-	peptide chain release factor H	NA	NA	NA	NA	NA
AYL92688.1|3824730_3825897_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	32.0	5.5e-32
AYL92689.1|3826115_3826568_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYL92690.1|3826564_3827620_-	DNA polymerase IV	NA	NA	NA	NA	NA
AYL93742.1|3827690_3828461_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
AYL92691.1|3828420_3830160_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
AYL92692.1|3830264_3830543_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
AYL92693.1|3830535_3830892_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AYL92694.1|3830948_3831698_-	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
AYL92695.1|3831907_3832168_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
AYL92696.1|3832170_3832449_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
AYL92697.1|3832604_3833345_+	transpeptidase	NA	NA	NA	NA	NA
AYL92698.1|3833315_3834083_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
AYL92699.1|3834288_3834867_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
AYL92700.1|3835106_3837551_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AYL92701.1|3837593_3838067_-	inhibitor of vertebrate lysozyme	NA	NA	NA	NA	NA
AYL92702.1|3838220_3838991_+	amidohydrolase	NA	NA	NA	NA	NA
AYL92703.1|3841578_3842061_-	hypothetical protein	NA	NA	NA	NA	NA
AYL92704.1|3842044_3846280_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	1.5e-23
AYL92705.1|3846355_3848497_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	8.2e-26
AYL92706.1|3848706_3849225_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
AYL92707.1|3849921_3850422_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AYL92708.1|3850456_3850681_+	hypothetical protein	NA	NA	NA	NA	NA
AYL92709.1|3850731_3852207_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AYL92710.1|3852213_3852627_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AYL92711.1|3852630_3854481_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AYL92712.1|3854444_3855527_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AYL92713.1|3855551_3856832_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AYL92714.1|3856828_3857353_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AYL92715.1|3857355_3858687_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 1
CP032888	Escherichia coli strain SCEC020022 plasmid pCTXM14_020022, complete sequence	109553	9524	37795	109553	integrase,transposase	Escherichia_phage(37.5%)	32	5132:5145	26402:26415
5132:5145	attL	ACAATGAAGTCACT	NA	NA	NA	NA
AYL88915.1|9524_10229_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AYL88916.1|10538_11564_-|transposase	IS21-like element ISEc57 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	44.1	6.6e-74
AYL88917.1|11925_12231_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYL88918.1|12258_13473_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
AYL88919.1|13689_14574_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
AYL88920.1|14604_16098_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AYL89026.1|16308_16533_-	hypothetical protein	NA	NA	NA	NA	NA
AYL88921.1|16605_17310_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AYL88922.1|17455_18469_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYL89027.1|18760_19315_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
AYL88923.1|19411_19864_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
AYL88924.1|19996_20470_+	trimethoprim-resistant dihydrofolate reductase DfrA27	NA	G3MBI7	Bacillus_virus	29.1	1.4e-15
AYL89028.1|20650_21496_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA16	NA	NA	NA	NA	NA
AYL88925.1|21612_21960_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AYL88926.1|21953_22793_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AYL88927.1|23197_24739_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AYL88928.1|25065_25941_+	class A extended-spectrum beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
AYL88929.1|26560_27034_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
26402:26415	attR	ACAATGAAGTCACT	NA	NA	NA	NA
AYL88930.1|28002_28590_-	restriction endonuclease	NA	NA	NA	NA	NA
AYL88931.1|28582_28831_-	XRE family transcriptional regulator	NA	A0A248SLB9	Klebsiella_phage	53.0	1.6e-10
AYL88932.1|28827_29289_-	hypothetical protein	NA	NA	NA	NA	NA
AYL88933.1|29942_30647_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYL88934.1|30938_31214_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AYL88935.1|31207_31852_-	chromosome partitioning protein ParA	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
AYL88936.1|32080_33052_+	plasmid segregation protein parM	NA	A0A222YXF2	Escherichia_phage	42.9	7.4e-67
AYL88937.1|33020_33449_+	plasmid stability protein	NA	NA	NA	NA	NA
AYL88938.1|33453_34725_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	60.5	1.9e-142
AYL88939.1|34724_35162_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
AYL88940.1|35158_35407_-	protein ImpC	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
AYL89029.1|35517_35787_+	hypothetical protein	NA	NA	NA	NA	NA
AYL88941.1|35755_36727_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
AYL88942.1|37111_37795_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.1e-29
>prophage 2
CP032888	Escherichia coli strain SCEC020022 plasmid pCTXM14_020022, complete sequence	109553	41058	49488	109553		Pseudomonas_phage(16.67%)	9	NA	NA
AYL88948.1|41058_42726_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.3	1.7e-164
AYL88949.1|43439_43946_-	hypothetical protein	NA	NA	NA	NA	NA
AYL88950.1|43892_44420_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.5	3.5e-47
AYL88951.1|44450_44711_+	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	53.2	1.9e-06
AYL88952.1|44769_46728_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.4	7.3e-21
AYL88953.1|46779_47217_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
AYL88954.1|47213_47933_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AYL88955.1|47929_48388_+	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	56.6	9.0e-15
AYL88956.1|48987_49488_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	27.3	2.4e-05
>prophage 1
CP032890	Escherichia coli strain SCEC020022 plasmid pTetA_020022, complete sequence	91014	0	75600	91014	transposase,tail	Escherichia_phage(61.4%)	81	NA	NA
AYL89095.1|0_861_+	replication protein RepA	NA	Q71TL8	Escherichia_phage	100.0	4.7e-158
AYL89096.1|1260_2466_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	100.0	2.0e-226
AYL89097.1|2462_3428_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	100.0	3.3e-168
AYL89098.1|3692_5399_+	hypothetical protein	NA	Q71TM1	Escherichia_phage	99.5	0.0e+00
AYL89099.1|5458_6964_+	hypothetical protein	NA	Q1MVJ6	Enterobacteria_phage	93.4	2.0e-281
AYL89100.1|6973_7789_+	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	93.7	1.2e-107
AYL89101.1|7824_8406_+	hypothetical protein	NA	Q71TM4	Escherichia_phage	99.5	3.8e-103
AYL89102.1|9108_10632_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AYL89103.1|10925_11297_+	hypothetical protein	NA	NA	NA	NA	NA
AYL89104.1|12255_12510_+	hypothetical protein	NA	Q71TM5	Escherichia_phage	97.6	1.7e-39
AYL89105.1|13974_14130_-	type I toxin-antitoxin system Hok family toxin	NA	A0A1I9LJU7	Stx_converting_phage	92.2	1.0e-15
AYL89106.1|14464_14734_-	replication protein RepL	NA	A0A077SK41	Escherichia_phage	96.6	1.6e-43
AYL89107.1|15338_16139_-	DNA-binding protein	NA	Q1MVK4	Enterobacteria_phage	99.6	7.1e-148
AYL89108.1|16302_17337_-	phage antirepressor Ant	NA	A0A077SLI1	Escherichia_phage	96.8	2.3e-183
AYL89109.1|17333_17555_-	host cell division inhibitor Icd-like protein	NA	Q38414	Enterobacteria_phage	97.3	1.2e-36
AYL89110.1|17588_17759_-	transcriptional regulator	NA	NA	NA	NA	NA
AYL89111.1|18175_18688_+	hypothetical protein	NA	A0A077SK39	Escherichia_phage	82.9	1.6e-44
AYL89112.1|18699_19239_+	hypothetical protein	NA	A0A077SL46	Escherichia_phage	87.7	3.8e-36
AYL89113.1|19554_20814_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
AYL89114.1|20944_21511_+	hypothetical protein	NA	A0A077SK12	Escherichia_phage	98.9	1.5e-99
AYL89115.1|21521_22133_+|tail	phage tail protein	tail	Q71TN8	Escherichia_phage	99.5	2.9e-109
AYL89116.1|23554_23929_+	hypothetical protein	NA	NA	NA	NA	NA
AYL89117.1|24135_25491_-	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
AYL89118.1|25739_26228_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	77.8	8.6e-64
AYL89119.1|26396_28070_+	hypothetical protein	NA	Q1MVN7	Enterobacteria_phage	96.6	5.8e-269
AYL89120.1|28103_28544_+	peptide-binding protein	NA	A0A077SLF0	Escherichia_phage	99.3	1.9e-78
AYL89121.1|28540_28789_+	modulator protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
AYL89122.1|28847_29357_-	hypothetical protein	NA	NA	NA	NA	NA
AYL89123.1|29356_30394_-	hypothetical protein	NA	NA	NA	NA	NA
AYL89124.1|30487_31129_-	maturation control protein	NA	A0A1B0VAG4	Salmonella_phage	95.3	6.1e-110
AYL89125.1|31409_31964_+	hypothetical protein	NA	NA	NA	NA	NA
AYL89126.1|32010_32397_-	recombination enhancement function domain protein	NA	Q71TG3	Escherichia_phage	94.6	2.1e-57
AYL89127.1|32615_33392_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AYL89128.1|33407_34397_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYL89129.1|34405_34807_+	ester cyclase	NA	NA	NA	NA	NA
AYL89130.1|35602_35710_+	hypothetical protein	NA	A0A1B0V7H9	Salmonella_phage	73.5	1.5e-05
AYL89131.1|35902_36214_-	lysogeny establishment protein	NA	Q71TG4	Escherichia_phage	96.1	8.8e-46
AYL89132.1|36264_37296_-	recombinase	NA	Q71TG5	Escherichia_phage	99.1	4.2e-193
AYL89133.1|37303_37525_-	creatininase	NA	Q5XLQ6	Enterobacteria_phage	100.0	2.0e-36
AYL89134.1|37936_38029_+	peptidase	NA	Q38401	Escherichia_phage	100.0	2.3e-07
AYL89135.1|38161_39142_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	8.9e-185
AYL89186.1|39268_39364_+	peptidase	NA	Q38402	Escherichia_phage	100.0	2.8e-11
AYL89136.1|39329_39539_+	c1 repressor inactivator	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
AYL89137.1|39649_40501_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	100.0	1.2e-158
AYL89138.1|40533_41649_-	phage antirepressor Ant	NA	A0A077SLR9	Escherichia_phage	92.7	3.6e-190
AYL89139.1|42682_43726_-	DUF968 domain-containing protein	NA	A0A1B0VBU2	Salmonella_phage	98.0	1.8e-204
AYL89140.1|43753_43933_-	PdcA protein	NA	Q71TH5	Escherichia_phage	98.3	1.2e-23
AYL89141.1|43937_44318_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	98.4	1.6e-62
AYL89142.1|44317_44539_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
AYL89143.1|46975_47680_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYL89144.1|47713_48205_-	hypothetical protein	NA	NA	NA	NA	NA
AYL89145.1|48311_49049_+	resolvase	NA	NA	NA	NA	NA
AYL89146.1|49045_49270_+	hypothetical protein	NA	NA	NA	NA	NA
AYL89147.1|49480_50974_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AYL89148.1|51004_51889_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
AYL89149.1|52105_53320_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
AYL89150.1|53347_53653_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYL89151.1|53919_55119_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AYL89152.1|55197_55875_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AYL89153.1|55906_56149_-	relaxase	NA	NA	NA	NA	NA
AYL89154.1|56454_57291_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AYL89155.1|57290_58094_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AYL89156.1|58154_58970_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AYL89157.1|59299_59476_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
AYL89158.1|60465_61170_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYL89159.1|61555_61972_+	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
AYL89160.1|61976_62495_-	hypothetical protein	NA	NA	NA	NA	NA
AYL89161.1|62494_63283_-	winged helix family transcriptional regulator	NA	NA	NA	NA	NA
AYL89162.1|63782_64487_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYL89163.1|65200_66463_-	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	99.5	1.0e-233
AYL89164.1|66464_66683_-	hypothetical protein	NA	Q71TI9	Escherichia_phage	100.0	3.4e-36
AYL89165.1|66780_67467_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	98.2	3.0e-139
AYL89166.1|67463_68141_-	serine/threonine protein phosphatase	NA	Q71TJ1	Escherichia_phage	97.8	4.6e-132
AYL89167.1|68137_68764_-	norphogenetic protein	NA	Q1MVG8	Enterobacteria_phage	100.0	2.1e-123
AYL89168.1|68661_69324_-	norphogenetic protein	NA	Q71T83	Escherichia_phage	100.0	4.5e-124
AYL89169.1|69265_69421_-	norphogenetic protein	NA	Q1MVH0	Enterobacteria_phage	98.0	1.2e-19
AYL89170.1|69832_70801_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	1.7e-172
AYL89171.1|70951_71578_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.5	1.1e-79
AYL89172.1|71580_72408_+	dimethyl sulfoxide reductase	NA	A0A077SK59	Escherichia_phage	37.9	2.7e-17
AYL89173.1|72446_74870_+	dimethyl sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	45.5	1.2e-198
AYL89174.1|74952_75600_+	hypothetical protein	NA	A0A077SLS7	Escherichia_phage	34.6	3.1e-13
>prophage 1
CP032891	Escherichia coli strain SCEC020022 plasmid pVir_020022, complete sequence	67351	1262	40297	67351	protease,transposase,integrase	Escherichia_phage(25.0%)	41	NA	NA
AYL89188.1|1262_2003_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
AYL89189.1|2123_2312_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
AYL89190.1|2685_3594_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
AYL89191.1|3656_4766_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
AYL89192.1|4824_5109_+	hypothetical protein	NA	NA	NA	NA	NA
AYL89193.1|5198_6152_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
AYL89194.1|6255_6645_+|protease	outer membrane protease	protease	NA	NA	NA	NA
AYL89195.1|7011_7275_-	hypothetical protein	NA	NA	NA	NA	NA
AYL89196.1|7424_7607_-|transposase	transposase	transposase	NA	NA	NA	NA
AYL89197.1|8498_8870_-	hypothetical protein	NA	NA	NA	NA	NA
AYL89198.1|9163_10687_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AYL89199.1|13974_14679_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYL89200.1|15156_15651_-	hypothetical protein	NA	NA	NA	NA	NA
AYL89252.1|15631_15706_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
AYL89201.1|15784_15916_+	replication protein RepA	NA	NA	NA	NA	NA
AYL89202.1|15937_16195_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
AYL89253.1|16478_16628_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
AYL89203.1|16683_16893_+	hypothetical protein	NA	NA	NA	NA	NA
AYL89204.1|17094_18636_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
AYL89205.1|18650_19397_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	48.5	5.0e-55
AYL89206.1|19896_20109_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
AYL89207.1|20244_20805_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
AYL89208.1|20907_21768_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	1.6e-09
AYL89209.1|21826_22573_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	29.7	8.7e-07
AYL89210.1|22592_27863_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
AYL89211.1|27941_28172_+	antitoxin	NA	NA	NA	NA	NA
AYL89212.1|28171_28570_+	PIN domain-containing protein	NA	NA	NA	NA	NA
AYL89213.1|28578_30732_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
AYL89214.1|30842_31058_+	hypothetical protein	NA	NA	NA	NA	NA
AYL89254.1|30984_31719_-	complement resistance protein TraT	NA	NA	NA	NA	NA
AYL89215.1|31747_32245_-	entry exclusion protein	NA	NA	NA	NA	NA
AYL89216.1|32260_35083_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AYL89217.1|35079_36456_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
AYL89218.1|36452_36866_-	conjugal transfer protein TrbF	NA	NA	NA	NA	NA
AYL89219.1|36819_37161_-	conjugal transfer protein TrbJ	NA	NA	NA	NA	NA
AYL89220.1|37090_37636_-	protein TrbB	NA	NA	NA	NA	NA
AYL89221.1|37622_37907_-	protein TraQ	NA	NA	NA	NA	NA
AYL89222.1|37987_38302_+	toxin ArtA	NA	NA	NA	NA	NA
AYL89223.1|38303_38651_-	protein TrbA	NA	NA	NA	NA	NA
AYL89224.1|38666_39440_-	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
AYL89225.1|39592_40297_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
