The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028555	Klebsiella variicola strain WCHKP19 chromosome, complete genome	5507183	1676022	1690309	5507183		Enterobacteria_phage(18.18%)	13	NA	NA
AWA00463.1|1676022_1676970_+	hypothetical protein	NA	A0A1V0SAH6	Catovirus	35.1	2.7e-05
AWA00464.1|1676962_1677805_+	glycosyl transferase family 2	NA	A0A0N9QZR6	Chrysochromulina_ericina_virus	30.8	3.1e-13
AWA00465.1|1678032_1679439_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
AWA00466.1|1679663_1680728_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	4.4e-105
AWA00467.1|1680754_1681624_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	66.7	7.5e-111
AWA00468.1|1681655_1682546_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.2	3.7e-28
AWA00469.1|1682560_1683115_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	5.0e-52
AWA00470.1|1683295_1684462_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
AWA00471.1|1685144_1685339_-	hypothetical protein	NA	NA	NA	NA	NA
AWA00472.1|1685412_1686417_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.2	1.2e-30
AWA00473.1|1686930_1687215_+	hypothetical protein	NA	NA	NA	NA	NA
AWA00474.1|1687494_1688910_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	4.0e-53
AWA03964.1|1688932_1690309_+	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	25.9	1.1e-31
>prophage 2
CP028555	Klebsiella variicola strain WCHKP19 chromosome, complete genome	5507183	2634050	2644929	5507183		Escherichia_phage(87.5%)	9	NA	NA
AWA01332.1|2634050_2634671_-	aldolase	NA	A0A077SK32	Escherichia_phage	98.1	5.7e-113
AWA01333.1|2634663_2635929_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	97.6	1.5e-229
AWA01334.1|2635940_2636843_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	98.7	1.1e-157
AWA01335.1|2637103_2637865_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	99.2	2.1e-133
AWA01336.1|2637882_2638743_-	class A beta-lactamase LEN-17	NA	A0A077SL40	Escherichia_phage	90.9	1.8e-144
AWA01337.1|2639037_2639298_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	96.5	4.6e-40
AWA01338.1|2639384_2640473_+	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	98.6	2.8e-208
AWA01339.1|2640501_2641767_-	MFS transporter	NA	NA	NA	NA	NA
AWA01340.1|2641821_2644929_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.5	0.0e+00
>prophage 3
CP028555	Klebsiella variicola strain WCHKP19 chromosome, complete genome	5507183	2773173	2834805	5507183	protease,transposase,head,tail,plate	Vibrio_phage(56.1%)	69	NA	NA
AWA01467.1|2773173_2774097_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
AWA01468.1|2774650_2775770_+|transposase	IS3-like element ISKpn34 family transposase	transposase	S5WIU1	Leptospira_phage	43.3	1.1e-50
AWA01469.1|2776481_2778527_-	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	20.0	1.1e-16
AWA01470.1|2778657_2779407_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
AWA01471.1|2779498_2780185_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWA01472.1|2780235_2780667_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	40.0	3.6e-21
AWA01473.1|2780933_2782397_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.2	1.1e-42
AWA01474.1|2782683_2783967_-	MFS transporter	NA	NA	NA	NA	NA
AWA01475.1|2784081_2784408_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	53.9	4.2e-22
AWA01476.1|2784552_2784894_+	DUF1283 domain-containing protein	NA	NA	NA	NA	NA
AWA01477.1|2784972_2785533_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AWA01478.1|2785526_2786237_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
AWA01479.1|2786338_2786608_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AWA01480.1|2786758_2789194_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.3	5.6e-212
AWA01481.1|2789204_2789822_+	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	57.6	5.8e-73
AWA01482.1|2789823_2790681_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	37.3	3.4e-23
AWA01483.1|2791146_2791710_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AWA04019.1|2791891_2792116_+	transcriptional regulator	NA	M1PVU4	Vibrio_phage	57.1	1.5e-15
AWA01484.1|2792118_2794212_+|transposase	transposase	transposase	A0A2D1GNK9	Pseudomonas_phage	51.2	1.2e-183
AWA01485.1|2794248_2795196_+	DNA transposition protein	NA	A0A0C4UQR3	Shigella_phage	79.1	4.9e-140
AWA01486.1|2795200_2795440_+	hypothetical protein	NA	NA	NA	NA	NA
AWA01487.1|2795442_2795730_+	HTH domain-containing protein	NA	C9DGL7	Escherichia_phage	48.3	3.5e-17
AWA01488.1|2795745_2796363_+	DUF3164 domain-containing protein	NA	A0A2I7S9B0	Vibrio_phage	59.9	2.0e-65
AWA01489.1|2796443_2796938_+	hypothetical protein	NA	NA	NA	NA	NA
AWA01490.1|2796930_2797236_+	hypothetical protein	NA	NA	NA	NA	NA
AWA01491.1|2797197_2797452_-	hypothetical protein	NA	NA	NA	NA	NA
AWA01492.1|2797519_2798074_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	49.4	2.3e-41
AWA01493.1|2798070_2798463_+	transcriptional regulator	NA	A0A0C4UR27	Shigella_phage	63.3	3.8e-38
AWA01494.1|2798468_2798789_+	hypothetical protein	NA	NA	NA	NA	NA
AWA01495.1|2798891_2799476_+	peptidoglycan-binding protein	NA	A0A2I7S9B9	Vibrio_phage	45.5	6.7e-39
AWA01496.1|2799478_2799697_+	hypothetical protein	NA	A0A0C4UQR6	Shigella_phage	68.1	8.6e-24
AWA01497.1|2799689_2800097_+	hypothetical protein	NA	NA	NA	NA	NA
AWA01498.1|2800084_2800696_+	hypothetical protein	NA	M4MB79	Vibrio_phage	40.4	2.9e-24
AWA01499.1|2800692_2800923_+	conjugal transfer protein TraR	NA	NA	NA	NA	NA
AWA01500.1|2800903_2801206_+	DUF2730 domain-containing protein	NA	M1Q558	Vibrio_phage	41.5	5.6e-13
AWA01501.1|2801215_2801503_+	hypothetical protein	NA	A0A2I7S9D8	Vibrio_phage	64.5	8.4e-27
AWA01502.1|2801505_2801790_+	hypothetical protein	NA	NA	NA	NA	NA
AWA01503.1|2801779_2802355_+	DUF3486 domain-containing protein	NA	M4MCR3	Vibrio_phage	57.8	2.7e-48
AWA01504.1|2802351_2803941_+	hypothetical protein	NA	M4MHG0	Vibrio_phage	70.2	1.0e-198
AWA01505.1|2803940_2805512_+	DUF935 domain-containing protein	NA	A0A2I7S9K0	Vibrio_phage	56.2	1.6e-156
AWA01506.1|2805504_2806359_+	hypothetical protein	NA	M1PVV7	Vibrio_phage	58.0	5.5e-90
AWA01507.1|2806901_2807873_+	peptidase	NA	M1Q578	Vibrio_phage	47.6	5.9e-72
AWA01508.1|2807875_2808778_+|head	phage head protein	head	M4MB71	Vibrio_phage	62.0	1.7e-105
AWA01509.1|2808853_2809471_+	hypothetical protein	NA	NA	NA	NA	NA
AWA01510.1|2809470_2809911_+	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	47.9	1.9e-33
AWA01511.1|2809910_2810453_+	phage morphogenesis protein	NA	A0A2I7S9D7	Vibrio_phage	64.8	7.6e-61
AWA01512.1|2810449_2811061_+	hypothetical protein	NA	M1PJ94	Vibrio_phage	39.3	6.6e-37
AWA01513.1|2811063_2811294_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
AWA01514.1|2811295_2812777_+|tail	phage tail protein	tail	M1Q565	Vibrio_phage	60.2	5.8e-164
AWA01515.1|2812786_2813140_+|tail	phage tail protein	tail	NA	NA	NA	NA
AWA01516.1|2813143_2813527_+	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	46.2	5.1e-11
AWA01517.1|2813625_2815419_+|tail	phage tail protein	tail	M4MHE6	Vibrio_phage	30.1	3.0e-61
AWA01518.1|2815415_2816675_+	multidrug DMT transporter	NA	A0A2I7S9E8	Vibrio_phage	41.7	8.4e-87
AWA01519.1|2816667_2817759_+|tail	phage tail protein	tail	M4M9L5	Vibrio_phage	49.1	2.9e-91
AWA01520.1|2817749_2818289_+|plate	phage baseplate assembly protein V	plate	A0A2I7S9F6	Vibrio_phage	45.5	3.3e-32
AWA01521.1|2818285_2818738_+	hypothetical protein	NA	A0A2I7S9F0	Vibrio_phage	42.8	1.5e-25
AWA01522.1|2818724_2819801_+|plate	phage baseplate protein	plate	A0A2I7S9E5	Vibrio_phage	52.6	1.6e-102
AWA01523.1|2819785_2820370_+	DUF2313 domain-containing protein	NA	M4M9M8	Vibrio_phage	48.7	6.3e-45
AWA01524.1|2820372_2821185_+|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	55.3	1.4e-31
AWA01525.1|2821184_2822060_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	41.8	3.1e-24
AWA01526.1|2824009_2824309_+	hypothetical protein	NA	NA	NA	NA	NA
AWA01527.1|2824933_2826229_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
AWA01528.1|2826181_2826877_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
AWA04020.1|2827004_2828225_-	ROK family transcriptional regulator	NA	NA	NA	NA	NA
AWA01529.1|2828349_2829252_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWA01530.1|2829382_2830633_+	MFS transporter	NA	NA	NA	NA	NA
AWA01531.1|2830972_2832460_+	carboxypeptidase M32	NA	NA	NA	NA	NA
AWA01532.1|2832635_2833055_+	acid-shock protein	NA	NA	NA	NA	NA
AWA04021.1|2834067_2834805_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 4
CP028555	Klebsiella variicola strain WCHKP19 chromosome, complete genome	5507183	3244511	3333528	5507183	capsid,transposase,head,holin,tail,tRNA,terminase,portal,integrase	Klebsiella_phage(50.0%)	93	3310457:3310472	3333061:3333076
AWA01902.1|3244511_3245012_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
AWA01903.1|3245129_3245576_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AWA01904.1|3245559_3246351_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWA01905.1|3246451_3247636_+	cyanate MFS transporter	NA	NA	NA	NA	NA
AWA01906.1|3247667_3248360_-	hypothetical protein	NA	NA	NA	NA	NA
AWA01907.1|3248505_3249015_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
AWA04045.1|3249001_3249358_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AWA01908.1|3249347_3249587_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AWA01909.1|3249888_3250902_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	30.5	4.9e-13
AWA01910.1|3250959_3251061_+	hypothetical protein	NA	NA	NA	NA	NA
AWA04046.1|3251018_3251135_+	hypothetical protein	NA	NA	NA	NA	NA
AWA01911.1|3251254_3251380_+	hypothetical protein	NA	NA	NA	NA	NA
AWA01912.1|3251439_3251703_-	DUF2534 domain-containing protein	NA	NA	NA	NA	NA
AWA01913.1|3251833_3252472_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
AWA01914.1|3252561_3253476_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.0	3.2e-72
AWA01915.1|3254133_3255177_-	type II asparaginase	NA	NA	NA	NA	NA
AWA01916.1|3255485_3256694_+	HD domain-containing protein	NA	NA	NA	NA	NA
AWA01917.1|3256767_3258552_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
AWA01918.1|3258558_3259449_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AWA01919.1|3259569_3261072_+	3,4-dihydroxybenzoate decarboxylase	NA	NA	NA	NA	NA
AWA01920.1|3261147_3261558_-	hypothetical protein	NA	NA	NA	NA	NA
AWA01921.1|3261687_3262374_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AWA01922.1|3263008_3263641_-	DNA-binding protein	NA	NA	NA	NA	NA
AWA01923.1|3264214_3264412_+	hypothetical protein	NA	NA	NA	NA	NA
AWA01924.1|3264470_3265265_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AWA01925.1|3265342_3267394_+	FUSC family protein	NA	NA	NA	NA	NA
AWA01926.1|3267386_3267599_+	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
AWA01927.1|3267595_3268516_+	HlyD family secretion protein	NA	NA	NA	NA	NA
AWA01928.1|3268509_3269520_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AWA01929.1|3269516_3270923_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AWA01930.1|3270978_3271866_-	manganese catalase family protein	NA	NA	NA	NA	NA
AWA01931.1|3271882_3272389_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AWA01932.1|3272415_3272910_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AWA01933.1|3272999_3273185_-	stress-induced acidophilic repeat motif-containing protein	NA	NA	NA	NA	NA
AWA01934.1|3273794_3274988_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
AWA01935.1|3275095_3275323_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
AWA01936.1|3275377_3275923_-	cysteine hydrolase	NA	NA	NA	NA	NA
AWA01937.1|3276244_3276718_+	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AWA01938.1|3276855_3277179_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AWA01939.1|3277171_3277564_+	amino acid-binding protein	NA	NA	NA	NA	NA
AWA01940.1|3277560_3278274_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AWA01941.1|3278611_3279085_-	hypothetical protein	NA	NA	NA	NA	NA
AWA01942.1|3279081_3279420_-	hypothetical protein	NA	NA	NA	NA	NA
AWA01943.1|3279818_3279986_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	2.6e-20
AWA01944.1|3281087_3282152_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.2	2.7e-14
AWA01945.1|3282576_3284013_-|tail	phage tail protein	tail	A0A0P0IDN1	Klebsiella_phage	53.7	2.4e-98
AWA01946.1|3284074_3295291_-	hypothetical protein	NA	Q6UAW1	Klebsiella_phage	49.9	0.0e+00
AWA01947.1|3295353_3295947_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	75.6	2.2e-77
AWA01948.1|3295999_3296347_-	hypothetical protein	NA	NA	NA	NA	NA
AWA01949.1|3296379_3297090_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	89.8	9.4e-136
AWA01950.1|3297091_3297847_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.1	5.1e-124
AWA01951.1|3297843_3298182_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	2.4e-57
AWA01952.1|3298181_3301517_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	88.6	0.0e+00
AWA01953.1|3301516_3301735_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	90.5	5.4e-34
AWA01954.1|3301749_3302115_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
AWA01955.1|3302172_3302634_-|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
AWA01956.1|3302665_3303067_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	93.2	3.9e-62
AWA01957.1|3303063_3303453_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
AWA01958.1|3303433_3303772_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	90.2	2.8e-53
AWA01959.1|3303768_3304086_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
AWA01960.1|3304066_3304327_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	63.9	1.5e-22
AWA01961.1|3304385_3305672_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.3	4.4e-216
AWA01962.1|3305749_3306670_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
AWA01963.1|3306706_3307966_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	90.0	1.4e-222
AWA01964.1|3307965_3308145_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	3.1e-11
AWA01965.1|3308138_3309860_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.6	6.5e-191
AWA01966.1|3309859_3310294_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
3310457:3310472	attL	CCGGCTGCGCCGGCAG	NA	NA	NA	NA
AWA01967.1|3310543_3310975_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.3	1.8e-41
AWA01968.1|3310971_3311289_-	hypothetical protein	NA	NA	NA	NA	NA
AWA01969.1|3311240_3311603_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	81.7	3.4e-57
AWA01970.1|3311756_3311978_-	DNA gyrase subunit B	NA	NA	NA	NA	NA
AWA01971.1|3312084_3312273_-	hypothetical protein	NA	NA	NA	NA	NA
AWA01972.1|3313352_3313703_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	39.8	1.8e-10
AWA01973.1|3313699_3314197_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	85.8	1.9e-79
AWA01974.1|3314196_3314412_-|holin	holin	holin	A5LH82	Enterobacteria_phage	87.3	7.9e-30
AWA01975.1|3315835_3316438_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.1	2.4e-76
AWA01976.1|3316454_3317486_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	6.2e-96
AWA01977.1|3317485_3317689_-	hypothetical protein	NA	NA	NA	NA	NA
AWA01978.1|3317685_3318078_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	6.1e-12
AWA04047.1|3318118_3318358_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	58.6	1.5e-16
AWA01979.1|3318420_3318654_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.4	3.4e-26
AWA01980.1|3319105_3319303_+	DUF1737 domain-containing protein	NA	NA	NA	NA	NA
AWA01981.1|3319734_3319995_-	hypothetical protein	NA	NA	NA	NA	NA
AWA01982.1|3320170_3326062_+	DUF3320 domain-containing protein	NA	NA	NA	NA	NA
AWA01983.1|3326253_3327374_-|transposase	IS3-like element ISKpn34 family transposase	transposase	S5WIU1	Leptospira_phage	43.3	1.1e-50
AWA01984.1|3327426_3327720_+	transcriptional regulator	NA	NA	NA	NA	NA
AWA01985.1|3327946_3328225_+	hypothetical protein	NA	A0A2I7RDR9	Vibrio_phage	59.2	4.2e-23
AWA01986.1|3328277_3328523_+	excisionase	NA	NA	NA	NA	NA
AWA01987.1|3328503_3329631_+|integrase	integrase	integrase	O21925	Phage_21	58.4	2.6e-119
AWA01988.1|3329748_3330999_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
AWA01989.1|3331239_3331890_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AWA01990.1|3331906_3332365_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AWA04048.1|3332421_3333528_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
3333061:3333076	attR	CTGCCGGCGCAGCCGG	NA	NA	NA	NA
>prophage 5
CP028555	Klebsiella variicola strain WCHKP19 chromosome, complete genome	5507183	3455416	3488164	5507183	protease,capsid,tail,terminase,plate,portal,integrase	Enterobacteria_phage(43.33%)	39	3455306:3455326	3488234:3488254
3455306:3455326	attL	AACCCGGATTGCTCCGGGTTT	NA	NA	NA	NA
AWA02099.1|3455416_3455800_-	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	56.7	3.4e-39
AWA02100.1|3455897_3456146_-	hypothetical protein	NA	NA	NA	NA	NA
AWA02101.1|3456191_3457346_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	78.9	3.1e-173
AWA02102.1|3457498_3458680_+|tail	phage tail protein	tail	A0A0A7NV69	Enterobacteria_phage	69.3	6.7e-155
AWA02103.1|3458679_3459195_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	68.2	3.4e-63
AWA02104.1|3459249_3459549_+|tail	phage tail protein	tail	B9A7B2	Serratia_phage	76.8	7.4e-34
AWA02105.1|3459545_3459722_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	71.4	3.0e-11
AWA02106.1|3459702_3462423_+|tail	phage tail tape measure protein	tail	F1BUT7	Erwinia_phage	45.5	1.5e-128
AWA02107.1|3462434_3462923_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.3	4.7e-54
AWA02108.1|3463061_3464225_-|tail	phage tail protein	tail	S4TP62	Salmonella_phage	49.3	3.6e-44
AWA02109.1|3464615_3466664_-	hypothetical protein	NA	A0A1W5PUZ2	Salmonella_phage	35.2	1.3e-15
AWA02110.1|3466668_3467265_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	42.9	3.3e-41
AWA02111.1|3467257_3468157_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	60.9	8.1e-92
AWA02112.1|3468143_3468512_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	57.8	8.0e-30
AWA04059.1|3468508_3469087_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	62.1	1.1e-62
AWA02113.1|3469086_3469728_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	47.5	1.1e-42
AWA02114.1|3469724_3470183_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	47.7	3.7e-32
AWA02115.1|3470327_3470723_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
AWA02116.1|3470719_3471271_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	42.5	6.4e-31
AWA02117.1|3471267_3471549_-	hypothetical protein	NA	B9A7B8	Serratia_phage	58.4	8.2e-19
AWA02118.1|3471539_3471740_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	66.2	2.3e-15
AWA02119.1|3471739_3472237_-|capsid	capsid assembly protein	capsid	B9A7B7	Serratia_phage	71.5	9.1e-61
AWA02120.1|3472339_3473260_-|terminase	terminase	terminase	B9A7B6	Serratia_phage	76.7	8.5e-89
AWA02121.1|3473307_3474357_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	55.0	1.8e-106
AWA02122.1|3474381_3475215_-|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	64.4	2.7e-94
AWA02123.1|3475375_3477097_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	66.2	1.1e-225
AWA02124.1|3477096_3478143_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.2	3.2e-140
AWA02125.1|3478745_3479735_-|protease	serine protease	protease	NA	NA	NA	NA
AWA02126.1|3479963_3482558_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	52.4	1.6e-196
AWA04060.1|3482658_3482934_+	hypothetical protein	NA	NA	NA	NA	NA
AWA02127.1|3483417_3484383_-	adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	50.3	1.6e-77
AWA02128.1|3484391_3484970_-	3'-5' exoribonuclease	NA	F4YXP6	Roseobacter_phage	34.4	2.4e-12
AWA02129.1|3484966_3485191_-	hypothetical protein	NA	NA	NA	NA	NA
AWA02130.1|3485259_3485532_-	hypothetical protein	NA	NA	NA	NA	NA
AWA02131.1|3485547_3485934_-	hypothetical protein	NA	NA	NA	NA	NA
AWA04061.1|3485950_3486148_-	DUF4761 domain-containing protein	NA	NA	NA	NA	NA
AWA02132.1|3486339_3486672_-	hypothetical protein	NA	NA	NA	NA	NA
AWA02133.1|3486766_3487069_+	XRE family transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	51.0	1.9e-21
AWA02134.1|3487156_3488164_+|integrase	integrase	integrase	A0A0M4RTQ0	Salmonella_phage	52.5	2.0e-99
3488234:3488254	attR	AACCCGGATTGCTCCGGGTTT	NA	NA	NA	NA
>prophage 6
CP028555	Klebsiella variicola strain WCHKP19 chromosome, complete genome	5507183	3617496	3626944	5507183	protease,tRNA	Bacillus_phage(16.67%)	8	NA	NA
AWA02240.1|3617496_3619218_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	22.2	2.6e-14
AWA02241.1|3619257_3619962_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AWA02242.1|3620313_3620532_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AWA02243.1|3620650_3622930_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	3.7e-165
AWA02244.1|3622960_3623278_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AWA02245.1|3623603_3623825_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AWA02246.1|3623891_3625832_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.0	5.0e-38
AWA02247.1|3625828_3626944_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 7
CP028555	Klebsiella variicola strain WCHKP19 chromosome, complete genome	5507183	4118977	4159231	5507183	transposase,integrase,lysis	Escherichia_phage(30.0%)	55	4136612:4136671	4158040:4159261
AWA02679.1|4118977_4119295_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.0	6.9e-22
AWA02680.1|4119294_4119534_-	hypothetical protein	NA	NA	NA	NA	NA
AWA02681.1|4120081_4120498_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	2.7e-26
AWA04090.1|4120556_4121480_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
AWA02682.1|4122098_4122566_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	75.2	2.3e-58
AWA02683.1|4122596_4123235_-	hypothetical protein	NA	H9C189	Pectobacterium_phage	75.6	6.1e-94
AWA02684.1|4123964_4124315_-	hypothetical protein	NA	H2EQH5	Salmonella_phage	37.2	7.9e-11
AWA02685.1|4124311_4124806_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	93.9	1.1e-87
AWA02686.1|4124783_4125008_-|lysis	lysis protein	lysis	M9NZI9	Enterobacteria_phage	91.9	4.0e-32
AWA02687.1|4125737_4126427_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.5	2.3e-62
AWA02688.1|4126423_4126564_-	YlcG family protein	NA	NA	NA	NA	NA
AWA02689.1|4126560_4127199_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	68.4	2.7e-73
AWA04091.1|4127191_4127362_-	NinE family protein	NA	G8C7V4	Escherichia_phage	71.4	2.8e-14
AWA02690.1|4127367_4127964_-	DUF1367 domain-containing protein	NA	A0A0U2RT94	Escherichia_phage	54.3	2.1e-56
AWA02691.1|4128059_4128317_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	74.0	8.3e-26
AWA02692.1|4128388_4128832_+	hypothetical protein	NA	NA	NA	NA	NA
AWA02693.1|4128894_4129251_-	Eaf protein	NA	T1SA95	Salmonella_phage	48.1	2.7e-22
AWA02694.1|4129927_4130440_-	hypothetical protein	NA	G9L6B3	Escherichia_phage	74.9	5.6e-74
AWA02695.1|4130439_4130967_-	hypothetical protein	NA	H2BD37	Pseudomonas_phage	50.5	1.4e-22
AWA02696.1|4130963_4131221_-	hypothetical protein	NA	A0A1P7WFV2	Pectobacterium_phage	51.9	1.6e-16
AWA02697.1|4131217_4131649_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	36.5	1.2e-08
AWA02698.1|4131645_4131948_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AWA02699.1|4131947_4132724_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	65.4	2.3e-95
AWA04092.1|4132720_4133449_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	72.6	4.2e-38
AWA02700.1|4133582_4133804_-	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
AWA02701.1|4133843_4134071_-	Cro/Cl family transcriptional regulator	NA	A0A2I6PIE5	Escherichia_phage	61.2	3.3e-18
AWA02702.1|4134139_4134862_+	helix-turn-helix transcriptional regulator	NA	E7C9R0	Salmonella_phage	63.2	5.5e-75
AWA04093.1|4134884_4135004_+	hypothetical protein	NA	NA	NA	NA	NA
AWA02703.1|4135202_4135919_+	hypothetical protein	NA	NA	NA	NA	NA
AWA02704.1|4135909_4136455_+	PIN domain-containing protein	NA	NA	NA	NA	NA
4136612:4136671	attL	GTGACCTGCTCCCCGTTGATTAATACACCGTGATGTTAGTAATGTCTTCATAAGCCACAT	NA	NA	NA	NA
AWA02705.1|4136683_4137803_+|transposase	IS3-like element ISKpn34 family transposase	transposase	S5WIU1	Leptospira_phage	43.3	1.1e-50
AWA02706.1|4138191_4138386_+	hypothetical protein	NA	NA	NA	NA	NA
AWA02707.1|4138474_4138759_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	78.7	3.3e-39
AWA02708.1|4138774_4139620_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	58.8	1.5e-68
AWA02709.1|4139616_4140297_+	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	92.0	5.7e-122
AWA02710.1|4140293_4140722_+	regulator	NA	M9NYX4	Enterobacteria_phage	81.7	1.5e-64
AWA02711.1|4140718_4141375_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	86.6	7.9e-113
AWA02712.1|4141371_4141593_+	hypothetical protein	NA	NA	NA	NA	NA
AWA02713.1|4141589_4141862_+	hypothetical protein	NA	A0A192Y6Q6	Salmonella_phage	69.3	1.1e-23
AWA02714.1|4141858_4142581_+	hypothetical protein	NA	R9VWB9	Serratia_phage	64.8	6.3e-87
AWA02715.1|4142577_4142796_+	conjugal transfer protein TraR	NA	A0A0K2FI84	Escherichia_phage	53.6	8.9e-13
AWA04094.1|4142797_4143133_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AWA04095.1|4143129_4144173_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	85.9	2.2e-178
AWA02716.1|4145176_4145425_+	AlpA family phage regulatory protein	NA	T1SA17	Salmonella_phage	72.8	1.2e-26
AWA02717.1|4145438_4145813_+	hypothetical protein	NA	A0A193GYJ9	Enterobacter_phage	46.5	7.4e-23
AWA02718.1|4146006_4146639_+	hypothetical protein	NA	NA	NA	NA	NA
AWA02719.1|4146737_4146890_+	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	83.7	5.6e-14
AWA02720.1|4146929_4147313_-	hypothetical protein	NA	NA	NA	NA	NA
AWA02721.1|4147315_4149883_-	hypothetical protein	NA	W6MWW8	Pseudomonas_phage	41.5	4.5e-180
AWA02722.1|4150366_4151347_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.2e-184
AWA02723.1|4152802_4155499_-	Lytic transglycosylase, catalytic	NA	K4NWI2	Pseudomonas_phage	28.4	7.2e-35
AWA02724.1|4155539_4155836_-	hypothetical protein	NA	NA	NA	NA	NA
AWA02725.1|4156289_4156835_+	hypothetical protein	NA	NA	NA	NA	NA
AWA02726.1|4157210_4157972_+	hypothetical protein	NA	NA	NA	NA	NA
AWA02727.1|4158111_4159231_+|transposase	IS3-like element ISKpn34 family transposase	transposase	S5WIU1	Leptospira_phage	43.3	1.1e-50
4158040:4159261	attR	GTGACCTGCTCCCCGTTGATTAATACACCGTGATGTTAGTAATGTCTTCATAAGCCACATGAGGACATCCCCATGAAGAAGCGTTTTTCCGACGAACAGATCATATGTATTCTCCGCGAGGCCGAAGCCGGCGTTTCTGCCCGTGAGCTCTGCCGTAAGCACGCCATTTCCGACGCCACCTTTTACACATGGCGTAAGAAGTATGGCGGTATGGAGGTGCCTGAGGTTAAGCGCCTGAAGTCGCTTGAGGAAGAGAACGCCAGACTCAAGAAGCTGCTTGCTGAAGCCATGCTGGATAAGGAGGCGCTTCAGGTGGCTCTTGGGCGAAAGTACTGACGACAGACCAGAAGCGGGAAGCCGTGGAAGTCATGTGCGAGGCTAAGGGTCTGTCGCAACGTCGTGCCTGCAGGCTGGCAGGTCTGTCCCTGTCAACCTGCCGATATTCGGCTCAGCGTCCGGCTGCTGACGCGCAGCTGTCTCTACGCATCACAGAGCTGGCACTTGAACGCCGCCGTTTTGGTTACCGGCGTATCTGGCAGCTTCTGCGACGTGAAGGTCTTTGCGTTAACCACAAGCGGGTTTACCGCATCTATCAACTTAATGGCCTGAGTGTAAAACGCAGACGACGTCGTAAAGGGCTGGCAACAGAACGTCTGCCGCTGCTCCGCCCGATGGCGCCCAATCTGACCTGGTCAATGGATTTCGTCATGGACGCACTGGCCACAGGTCGCAGGATCAAGTGCCTGACCTGCGTGGATGATTTCACAAAGGAATGCCTGACGGTCACTGTTGCCTTCGGGATTTCAGGCGTGCAGGTCACGCGTATTCTGGACAGCATTGCGCTGTTTCGCGGCTATCCGGCTATGATAAGAACCGATCAGGGCCCGGAGTTTACCTGCCGCGCACTCGATCAGTGGGCTTTTGAGCATGGTGTGGAGCTGCGACTTATCCAGCCCGGCAAGCCAACGCAGAACGGATTTATTGAGAGTTTTAACGGACGCTTTCGTGATGAATGCCTGAATGAGCACTGGTTCAGCGATATTGTTCACGCCAGGAAGATCATTAATGACTGGCGACTGGATTATAACGAGTGTCGACCACATTCATCACTGAATTACCTGACGCCGGCTGAATTTGCAGCGGGCTGGCGAAACGGGAAATATGAAGAAAAACCAACCGACATTACTAACTGAAGGTTGTATCTAACTCTGGGGGCAGGTCA	NA	NA	NA	NA
>prophage 1
CP028549	Klebsiella variicola strain WCHKP19 plasmid p1_020019, complete sequence	263455	77574	155040	263455	protease,transposase,integrase	Planktothrix_phage(19.05%)	70	78397:78425	146398:146426
AVZ98484.1|77574_78492_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.4	1.2e-146
78397:78425	attL	GGCTTTGTTGAATAAATCAGATTTCGGGT	NA	NA	NA	NA
AVZ98340.1|79039_79207_+|integrase	integrase	integrase	NA	NA	NA	NA
AVZ98341.1|79491_80619_+	regulator	NA	NA	NA	NA	NA
AVZ98342.1|80615_81209_+	response regulator	NA	NA	NA	NA	NA
AVZ98343.1|81205_82054_+	ABC transporter permease	NA	NA	NA	NA	NA
AVZ98344.1|82053_82974_+	ABC transporter permease	NA	NA	NA	NA	NA
AVZ98345.1|82986_84591_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVZ98346.1|84635_85583_+	acetamidase	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
AVZ98347.1|85590_87324_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
AVZ98348.1|89144_90683_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	98.0	8.5e-291
AVZ98485.1|90731_91148_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	98.2	5.4e-59
AVZ98349.1|93120_94077_-	isoaspartyl peptidase/L-asparaginase	NA	NA	NA	NA	NA
AVZ98350.1|94105_95095_-	peptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.6	1.7e-13
AVZ98351.1|95084_96083_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	3.6e-16
AVZ98486.1|96099_96930_-	ABC transporter permease	NA	NA	NA	NA	NA
AVZ98352.1|96938_97877_-	ABC transporter permease	NA	NA	NA	NA	NA
AVZ98353.1|97931_99527_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVZ98354.1|99770_100769_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ98355.1|100755_101451_+	creatininase family protein	NA	NA	NA	NA	NA
AVZ98356.1|101788_102055_-	hypothetical protein	NA	S5WIU1	Leptospira_phage	52.2	2.0e-14
AVZ98357.1|102058_102337_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ98358.1|102880_103747_-	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AVZ98359.1|103767_104598_-	xylose isomerase	NA	NA	NA	NA	NA
AVZ98360.1|104597_105338_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.0	4.7e-29
AVZ98361.1|105337_106000_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AVZ98362.1|106043_106799_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVZ98363.1|106864_107695_-	carbohydrate kinase	NA	NA	NA	NA	NA
AVZ98364.1|107700_108738_-	SIS domain-containing protein	NA	NA	NA	NA	NA
AVZ98365.1|108968_110066_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AVZ98366.1|110569_110761_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ98487.1|110813_112160_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AVZ98367.1|112371_112854_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVZ98368.1|112841_113108_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AVZ98369.1|113552_113783_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ98370.1|113796_114000_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
AVZ98371.1|114060_114552_-	DNA-binding protein	NA	NA	NA	NA	NA
AVZ98372.1|114786_114990_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ98373.1|114935_115640_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AVZ98374.1|116882_117359_+	DNA starvation/stationary phase protection protein	NA	G0X506	Salmonella_phage	29.0	8.8e-05
AVZ98375.1|117663_118014_-	transcriptional regulator	NA	NA	NA	NA	NA
AVZ98376.1|118175_118487_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ98377.1|118631_119751_+|transposase	IS3-like element ISKpn34 family transposase	transposase	S5WIU1	Leptospira_phage	43.3	1.1e-50
AVZ98378.1|119748_120883_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.0	5.9e-148
AVZ98379.1|123910_125953_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AVZ98380.1|125945_127397_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AVZ98381.1|127421_128590_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	95.7	5.6e-178
AVZ98488.1|128878_129514_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AVZ98489.1|129613_129895_+	DNA-binding protein	NA	NA	NA	NA	NA
AVZ98382.1|129929_130499_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AVZ98383.1|130604_133454_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.1	2.6e-128
AVZ98490.1|134371_134512_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ98384.1|134599_135058_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AVZ98385.1|135080_135995_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ98386.1|136097_136985_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ98387.1|137074_137716_+	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
AVZ98388.1|137764_138910_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ98389.1|138899_139340_+	thioredoxin TrxC	NA	A0A023NHA9	Dinoroseobacter_phage	34.7	5.8e-11
AVZ98390.1|139343_141053_+	sodium:proton exchanger	NA	NA	NA	NA	NA
AVZ98391.1|141055_141553_+	phosphate-starvation-inducible E family protein	NA	NA	NA	NA	NA
AVZ98392.1|141530_142496_+|protease	Zn-dependent protease	protease	NA	NA	NA	NA
AVZ98393.1|142520_143672_+	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	7.5e-26
AVZ98394.1|144515_145511_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.3	7.0e-20
AVZ98395.1|145704_146133_+	S-(hydroxymethyl)glutathione synthase	NA	NA	NA	NA	NA
AVZ98396.1|146453_147377_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.0	3.9e-174
146398:146426	attR	GGCTTTGTTGAATAAATCAGATTTCGGGT	NA	NA	NA	NA
AVZ98397.1|148996_150070_-	FUSC family protein	NA	NA	NA	NA	NA
AVZ98398.1|150335_150845_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
AVZ98399.1|152043_152967_+|transposase	IS5/IS1182 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	2.3e-166
AVZ98491.1|153011_153077_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ98400.1|153192_153858_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AVZ98401.1|154116_155040_+|transposase	IS5/IS1182 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	2.3e-166
>prophage 1
CP028550	Klebsiella variicola strain WCHKP19 plasmid p2_020019, complete sequence	110186	1549	109866	110186	integrase,terminase,capsid,tail	Salmonella_phage(90.72%)	115	10653:10669	47469:47485
AVZ98499.1|1549_1762_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	80.0	4.3e-28
AVZ98500.1|1761_2097_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	66.7	8.0e-37
AVZ98501.1|2093_2273_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ98502.1|2796_3507_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ98503.1|4723_5800_-	recombinase	NA	J9Q736	Salmonella_phage	95.5	1.2e-195
AVZ98504.1|5802_6069_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	84.1	1.7e-34
AVZ98505.1|6068_7013_-	exonuclease	NA	J9Q7S6	Salmonella_phage	93.0	1.4e-171
AVZ98506.1|7073_8078_-	regulator	NA	J9Q7Z3	Salmonella_phage	90.0	1.5e-147
AVZ98507.1|8197_8629_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	91.6	1.1e-65
AVZ98508.1|8692_9679_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ98509.1|9710_10154_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	97.2	5.6e-70
AVZ98510.1|10150_13669_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	93.4	0.0e+00
10653:10669	attL	GCCATGCGAGTCATCAG	NA	NA	NA	NA
AVZ98511.1|13643_13847_-	hypothetical protein	NA	J9Q6I7	Salmonella_phage	80.6	3.3e-25
AVZ98512.1|13849_15082_-	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	86.1	1.8e-211
AVZ98513.1|15178_17482_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	66.4	3.6e-245
AVZ98613.1|17598_17811_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ98514.1|18083_18464_+	transcriptional regulator	NA	NA	NA	NA	NA
AVZ98515.1|18458_19559_-|integrase	integrase	integrase	A0A1P8DTG6	Proteus_phage	28.4	1.6e-17
AVZ98516.1|19812_20277_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ98517.1|20248_20668_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ98518.1|20984_21344_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ98519.1|21408_21819_-	toxin YafO	NA	NA	NA	NA	NA
AVZ98520.1|21828_22446_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ98521.1|22540_22786_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	47.4	1.2e-13
AVZ98522.1|22782_23169_-	hypothetical protein	NA	Q716B1	Shigella_phage	71.4	2.9e-46
AVZ98523.1|23178_23955_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	65.8	2.9e-90
AVZ98524.1|24198_24915_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ98525.1|26689_26989_-	C-type natriuretic protein	NA	J9Q7S1	Salmonella_phage	65.6	6.7e-27
AVZ98526.1|26985_27138_-	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	84.0	7.1e-17
AVZ98527.1|27134_27350_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	78.6	1.9e-23
AVZ98528.1|27333_27513_-	hypothetical protein	NA	J9Q729	Salmonella_phage	74.5	2.7e-15
AVZ98529.1|27509_28832_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	85.7	7.4e-227
AVZ98530.1|28831_29299_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	63.9	9.8e-49
AVZ98614.1|29378_30167_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	51.1	9.0e-71
AVZ98531.1|30323_31466_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ98532.1|31552_32668_-	DNA primase	NA	J9Q720	Salmonella_phage	91.1	6.3e-203
AVZ98533.1|32821_34162_-	DNA helicase	NA	J9Q7G4	Salmonella_phage	95.5	7.7e-240
AVZ98534.1|34226_34952_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	88.4	6.2e-127
AVZ98535.1|35124_36843_-	hypothetical protein	NA	X2KLG0	Campylobacter_phage	29.0	5.2e-15
AVZ98536.1|36885_37248_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.2e-43
AVZ98537.1|37247_37913_-	plasmid stability protein	NA	J9Q7R7	Salmonella_phage	84.6	4.4e-103
AVZ98538.1|38340_38610_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AVZ98539.1|38613_39138_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVZ98540.1|39165_39507_-	hypothetical protein	NA	J9Q7G2	Salmonella_phage	79.2	1.5e-27
AVZ98541.1|39575_40268_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	90.0	6.4e-121
AVZ98542.1|40281_40605_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	95.3	2.3e-49
AVZ98543.1|40695_42141_-	endosialidase chaperone	NA	A0A0H4TGH1	Klebsiella_phage	38.6	1.0e-40
AVZ98544.1|42263_54398_-	hypothetical protein	NA	J9Q713	Salmonella_phage	62.3	6.3e-30
47469:47485	attR	GCCATGCGAGTCATCAG	NA	NA	NA	NA
AVZ98545.1|54414_55026_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	72.1	1.1e-76
AVZ98546.1|55013_55811_-|tail	phage tail protein	tail	J9Q7R4	Salmonella_phage	85.3	5.4e-140
AVZ98547.1|55803_56502_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	87.4	1.2e-122
AVZ98548.1|56588_56924_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	84.5	2.6e-51
AVZ98549.1|56967_61500_-|tail	phage tail tape measure protein	tail	J9Q712	Salmonella_phage	71.4	0.0e+00
AVZ98550.1|61507_61741_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	93.5	3.4e-34
AVZ98551.1|61857_62175_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	93.3	1.8e-46
AVZ98552.1|62236_62983_-	hypothetical protein	NA	J9Q7Y4	Salmonella_phage	83.0	3.7e-106
AVZ98553.1|63050_63443_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	69.8	1.4e-48
AVZ98554.1|63444_63918_-	hypothetical protein	NA	J9Q711	Salmonella_phage	93.0	7.3e-76
AVZ98555.1|63908_64253_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	91.2	8.2e-53
AVZ98556.1|64350_65184_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	83.8	3.7e-131
AVZ98557.1|65183_65618_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	84.7	7.6e-64
AVZ98558.1|65665_66094_-	hypothetical protein	NA	J9Q6D6	Salmonella_phage	70.6	2.3e-28
AVZ98559.1|66172_67051_-|capsid	phage major capsid protein	capsid	J9Q710	Salmonella_phage	94.2	4.7e-153
AVZ98560.1|67077_67977_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	82.6	1.0e-123
AVZ98561.1|67999_69589_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	88.7	2.3e-275
AVZ98562.1|69606_70863_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	97.4	9.4e-248
AVZ98563.1|70865_71507_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	88.2	5.0e-96
AVZ98564.1|71682_71949_-	hypothetical protein	NA	J9Q757	Salmonella_phage	90.9	1.3e-37
AVZ98565.1|71958_72858_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	96.6	1.2e-164
AVZ98566.1|72854_73109_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	96.4	2.0e-40
AVZ98567.1|73101_73740_-	adenylyl-sulfate kinase	NA	J9Q807	Salmonella_phage	97.2	3.9e-109
AVZ98568.1|73736_74405_-	chromosome partitioning protein ParB	NA	J9Q6L1	Salmonella_phage	91.9	6.6e-107
AVZ98569.1|74404_75085_-	chromosome partitioning protein ParB	NA	J9Q756	Salmonella_phage	89.3	2.1e-108
AVZ98570.1|75172_76732_+	ATP-dependent helicase	NA	J9Q7I4	Salmonella_phage	92.3	1.7e-278
AVZ98571.1|76734_77010_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	68.1	3.1e-26
AVZ98572.1|77060_77498_-	hypothetical protein	NA	A0A1V0E8D6	Vibrio_phage	37.7	7.3e-14
AVZ98573.1|77653_78184_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	84.5	1.0e-70
AVZ98574.1|78817_79468_+	hypothetical protein	NA	J9Q754	Salmonella_phage	91.7	8.4e-107
AVZ98575.1|79518_79722_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	95.5	4.1e-28
AVZ98576.1|80314_80797_-	hypothetical protein	NA	J9Q805	Salmonella_phage	77.5	1.6e-70
AVZ98577.1|81002_81284_-	ABC transporter	NA	J9Q753	Salmonella_phage	82.8	1.2e-41
AVZ98578.1|81410_81818_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ98579.1|81937_82249_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	68.0	2.3e-30
AVZ98580.1|82385_82745_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ98581.1|83509_83767_+	hypothetical protein	NA	J9Q7T6	Salmonella_phage	65.1	8.9e-12
AVZ98582.1|84284_85511_-	hypothetical protein	NA	J9Q803	Salmonella_phage	54.1	4.7e-119
AVZ98583.1|85681_85999_-	hypothetical protein	NA	J9Q750	Salmonella_phage	75.2	4.1e-43
AVZ98584.1|86197_86626_-	S-(hydroxymethyl)glutathione synthase	NA	NA	NA	NA	NA
AVZ98585.1|86806_87070_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	70.5	3.7e-29
AVZ98586.1|87221_87950_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	68.0	2.0e-80
AVZ98587.1|88011_89697_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	90.2	8.1e-311
AVZ98588.1|89825_90404_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	57.5	1.7e-55
AVZ98589.1|90531_90687_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	59.2	3.7e-05
AVZ98590.1|90686_91112_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	80.9	9.8e-56
AVZ98591.1|91214_91403_-	hypothetical protein	NA	J9Q800	Salmonella_phage	52.5	3.3e-08
AVZ98592.1|91399_91678_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ98593.1|93265_93499_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	82.9	7.8e-31
AVZ98594.1|93696_94290_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	85.3	5.9e-99
AVZ98595.1|94474_95308_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	53.1	3.3e-63
AVZ98596.1|95432_95990_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	84.2	1.4e-86
AVZ98597.1|95999_96419_-	hypothetical protein	NA	J9Q743	Salmonella_phage	74.1	3.8e-52
AVZ98598.1|96482_97127_-	hypothetical protein	NA	J9Q7H4	Salmonella_phage	77.1	1.4e-93
AVZ98599.1|97126_97603_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	79.6	8.4e-72
AVZ98600.1|97599_98013_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	77.4	6.2e-55
AVZ98601.1|98014_99118_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	80.4	2.3e-181
AVZ98602.1|99311_100187_-	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	84.4	7.7e-140
AVZ98603.1|100264_101407_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	95.5	3.4e-212
AVZ98604.1|101537_103841_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	90.8	0.0e+00
AVZ98605.1|103916_104486_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	90.5	3.8e-95
AVZ98606.1|104495_105242_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	62.1	4.1e-81
AVZ98607.1|105231_107148_-	exonuclease	NA	J9Q741	Salmonella_phage	84.6	9.5e-300
AVZ98608.1|107144_107378_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	66.1	4.4e-18
AVZ98609.1|107377_108463_-	exonuclease	NA	J9Q7S9	Salmonella_phage	84.5	5.4e-183
AVZ98610.1|108651_109146_-	N-acetyltransferase	NA	J9Q6J3	Salmonella_phage	67.1	1.0e-59
AVZ98611.1|109221_109866_-	hypothetical protein	NA	J9Q739	Salmonella_phage	81.1	3.7e-99
>prophage 1
CP028551	Klebsiella variicola strain WCHKP19 plasmid p3_020019, complete sequence	74189	0	65555	74189	transposase,integrase	Escherichia_phage(31.82%)	54	16349:16368	59982:60001
AVZ98616.1|2872_3949_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AVZ98617.1|4834_5986_-|transposase	IS30 family transposase IS30	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
AVZ98618.1|5942_6311_-	hypothetical protein	NA	Q716C1	Shigella_phage	97.7	7.2e-39
AVZ98619.1|7462_7819_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ98620.1|7944_8202_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ98621.1|8246_9367_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.3e-51
AVZ98622.1|10220_10841_+	serine recombinase	NA	A0A219Y912	Aeromonas_phage	31.5	7.7e-09
AVZ98623.1|11013_11964_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	56.5	3.6e-74
AVZ98624.1|12226_12505_-	cytoplasmic protein	NA	NA	NA	NA	NA
AVZ98625.1|12677_13013_+	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
AVZ98626.1|13119_14037_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.0	2.4e-168
16349:16368	attL	GGGGCTTTGTTGAATAAATC	NA	NA	NA	NA
AVZ98627.1|16427_17351_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
AVZ98628.1|18024_19005_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.2e-184
AVZ98629.1|19740_19941_-	glycogen synthesis protein GlgS	NA	NA	NA	NA	NA
AVZ98630.1|20241_21165_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
AVZ98631.1|21582_23775_+	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
AVZ98632.1|23904_25188_+	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
AVZ98633.1|25324_26029_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ98634.1|26430_27039_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AVZ98635.1|27134_27836_+	molecular chaperone	NA	NA	NA	NA	NA
AVZ98636.1|27847_30334_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AVZ98637.1|30324_31320_+	fimbrial protein	NA	NA	NA	NA	NA
AVZ98638.1|31333_31969_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AVZ98639.1|32003_32720_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AVZ98640.1|33838_34162_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ98641.1|34594_37492_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	5.5e-182
AVZ98642.1|37586_38192_+	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
AVZ98643.1|38851_40033_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	64.2	1.9e-120
AVZ98644.1|40459_40774_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ98645.1|41028_41385_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AVZ98646.1|41374_41776_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
AVZ98647.1|41772_42063_-	nucleotidyltransferase	NA	NA	NA	NA	NA
AVZ98648.1|42137_45104_+|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
AVZ98649.1|45182_46187_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AVZ98650.1|46368_46572_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ98651.1|46585_46789_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
AVZ98652.1|46822_47191_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ98653.1|47234_47729_-	DNA-binding protein	NA	NA	NA	NA	NA
AVZ98654.1|47759_48332_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ98655.1|48328_48577_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ98656.1|49013_49703_+	RES domain-containing protein	NA	NA	NA	NA	NA
AVZ98657.1|49734_50424_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ98658.1|50952_51303_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ98659.1|51353_52097_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ98660.1|52093_52870_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.4e-52
AVZ98661.1|52927_53185_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ98662.1|53952_54819_+	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	2.6e-23
AVZ98663.1|55744_56950_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.1	1.2e-162
AVZ98664.1|56946_57924_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.1	1.1e-86
AVZ98665.1|58005_59277_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.3	6.4e-151
AVZ98666.1|59276_59708_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
AVZ98667.1|60039_60963_-|transposase	IS5/IS1182 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.1	3.6e-172
59982:60001	attR	GGGGCTTTGTTGAATAAATC	NA	NA	NA	NA
AVZ98668.1|61194_62619_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ98669.1|62615_65555_-	DUF4145 domain-containing protein	NA	A0A2K9L5A2	Tupanvirus	23.8	9.9e-22
>prophage 2
CP028551	Klebsiella variicola strain WCHKP19 plasmid p3_020019, complete sequence	74189	70612	72169	74189		Staphylococcus_phage(100.0%)	1	NA	NA
AVZ98673.1|70612_72169_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	43.0	1.9e-104
>prophage 1
CP028553	Klebsiella variicola strain WCHKP19 plasmid pCTXM15_020019, complete sequence	117244	2955	54423	117244	integrase,transposase	Escherichia_phage(25.0%)	69	23828:23887	36349:37169
AVZ98683.1|2955_3750_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
AVZ98684.1|3947_4964_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ98685.1|4974_5289_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ98822.1|5315_5675_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ98686.1|5879_6185_-	plasmid maintenance protein CcdB	NA	NA	NA	NA	NA
AVZ98687.1|6186_6405_-	plasmid maintenance protein CcdA	NA	NA	NA	NA	NA
AVZ98688.1|6456_6651_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ98823.1|6574_6913_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ98689.1|7035_7233_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ98690.1|7222_7513_-	korC	NA	NA	NA	NA	NA
AVZ98691.1|7509_8637_-	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
AVZ98824.1|8670_10263_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ98692.1|10469_11249_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ98693.1|11261_11762_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ98694.1|12036_12300_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ98695.1|12296_12863_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ98696.1|12893_13388_+	DNA-binding protein	NA	NA	NA	NA	NA
AVZ98697.1|13431_13800_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ98698.1|13833_14037_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
AVZ98699.1|14085_14343_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ98700.1|14418_14673_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ98701.1|14808_15585_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
AVZ98702.1|15825_16149_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ98703.1|16327_16561_-	hypothetical protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	51.3	1.7e-17
AVZ98704.1|17387_18569_+	DUF4268 domain-containing protein	NA	NA	NA	NA	NA
AVZ98825.1|18932_19145_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ98826.1|19266_19455_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ98705.1|19760_20618_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AVZ98827.1|20610_20688_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
AVZ98828.1|20919_21171_-	transcriptional regulator	NA	NA	NA	NA	NA
AVZ98706.1|21306_21816_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	31.7	3.7e-17
AVZ98707.1|21989_23567_-	PAS domain S-box protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.2e-95
23828:23887	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
AVZ98708.1|23890_24595_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ98709.1|24716_25622_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AVZ98710.1|25618_26857_+	MFS transporter	NA	NA	NA	NA	NA
AVZ98711.1|26856_27441_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AVZ98712.1|27386_27743_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ98713.1|27933_28698_-|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AVZ98714.1|28785_28899_+	NTP-binding protein	NA	NA	NA	NA	NA
AVZ98715.1|29204_29705_-	N-acetyltransferase	NA	NA	NA	NA	NA
AVZ98716.1|29723_29903_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ98717.1|29832_30672_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AVZ98718.1|30665_31013_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AVZ98829.1|31129_31975_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA16	NA	NA	NA	NA	NA
AVZ98719.1|32155_32629_-	trimethoprim-resistant dihydrofolate reductase DfrA27	NA	G3MBI7	Bacillus_virus	29.1	1.4e-15
AVZ98720.1|32761_33214_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
AVZ98830.1|33310_33865_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
AVZ98721.1|34156_35170_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AVZ98722.1|35108_35423_+|transposase	transposase	transposase	NA	NA	NA	NA
AVZ98723.1|35640_36345_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ98724.1|37526_38084_+	recombinase	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
36349:37169	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCGTTTTTTCTGCCCAATCTTTCTGGCGTCACGGATGATAACGGCCAGCATGGCGTCCAGAACGTCCAATGCATCATCCAGCGCCAGCGTTTCCCATGCAAGGACAAAGGCAACCAGAACCGCCATCCTTTTCTGCGGTGACATCCTGGCAATATTGAACACCGAAGTCATACCAGCATAACGTGCGAGATTTTTCAGGCGCACAGCCGGGAGTGTACTCAGGTTTTCAGCATGCAGGCCAAAATCGTTCAGAGTTTTCCAGCGTTCAATTGCTTCATTAAACGCCGGACCACTGATGGTCACAGGGCCCTTTTTCAGTGATTCCAGTAAAGACAGGCGGCTGCAATCAGTTGGCCCCAGCAGCATCTCCAGCTGTGAACGCTGTTCGGCTGACGGTATCAGTGCCAGTTTGTTCCACAGGCGCAACGTCGCCTTTTCCCTTACCTCTGAAATCAACCGGGTCAGCGTAGTGGCTCCGGGGAGAATAATACGATGTTGCATAAGCCACCCTGTCGCCAGATCGAAAAGCAGGCCAGGACGTTCGTTGCTTATCCAGCTCCGGGTATATAAAAGACGGGTAAGGCGAAATGTCCAGGGCCAGGCAAATTCACGATACTGATAGTGCTGACGTATCAGCGCTGCATGCTCACGGCGGGTATTTTCCCTCTGACCGTATTCTGCAAGAACGGTGATATCACGAATCCCGAGCTGTCTGGCGGTAAAATGCCGGACGCCGGAAGGAATATGATTCATATCGGTGAGG	NA	NA	NA	NA
AVZ98725.1|38266_39127_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AVZ98726.1|39385_39862_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AVZ98727.1|39908_40784_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
AVZ98728.1|44116_44773_-	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
AVZ98729.1|45054_46446_-|transposase	ISKra4 family transposase ISKpn19	transposase	NA	NA	NA	NA
AVZ98730.1|46482_47055_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
AVZ98731.1|47191_47782_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
AVZ98732.1|47832_48408_+	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	59.3	1.6e-45
AVZ98733.1|48554_48836_-	XRE family transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
AVZ98734.1|48816_49146_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
AVZ98735.1|49381_49639_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ98736.1|49672_50377_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AVZ98737.1|50564_50873_-	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	31.7	1.1e-08
AVZ98738.1|50869_51520_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
AVZ98739.1|51575_52220_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ98740.1|52269_52866_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ98741.1|53032_53626_-	conjugal transfer protein	NA	NA	NA	NA	NA
AVZ98742.1|53697_54423_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	28.3	1.2e-05
>prophage 1
CP028554	Klebsiella variicola strain WCHKP19 plasmid pKPC2_020019, complete sequence	89738	13507	20469	89738		Aeromonas_phage(16.67%)	10	NA	NA
AVZ98847.1|13507_14104_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	37.2	1.8e-23
AVZ98848.1|14643_15162_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ98849.1|15507_16155_+	chromosome partitioning protein ParA	NA	A0A222YXS3	Escherichia_phage	43.5	9.7e-39
AVZ98850.1|16145_16421_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ98851.1|16621_16822_-	hypothetical protein	NA	NA	NA	NA	NA
AVZ98852.1|16923_18195_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	60.7	2.5e-147
AVZ98931.1|18206_18656_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	52.0	5.2e-31
AVZ98853.1|18652_18898_-	DinI family protein	NA	Q7Y3V9	Yersinia_phage	39.3	1.5e-08
AVZ98854.1|19101_19332_+	hypothetical protein	NA	NA	NA	NA	NA
AVZ98855.1|19767_20469_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	34.4	9.6e-24
