The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP028589	Escherichia coli strain WCHEC4533 chromosome, complete genome	5099973	1115450	1122590	5099973		Escherichia_phage(83.33%)	6	NA	NA
AWA15745.1|1115450_1116089_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AWA15746.1|1116085_1117348_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
AWA15747.1|1117344_1118253_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.1e-117
AWA15748.1|1118448_1119216_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
AWA15749.1|1119266_1119923_-	serine/threonine protein phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	5.0e-51
AWA15750.1|1120028_1122590_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	9.2e-32
>prophage 2
CP028589	Escherichia coli strain WCHEC4533 chromosome, complete genome	5099973	1498361	1536342	5099973	portal,terminase,lysis,holin,head,capsid	Enterobacteria_phage(48.28%)	60	NA	NA
AWA16072.1|1498361_1498553_-	AlpA family transcriptional regulator	NA	E5E3Y1	Burkholderia_phage	49.0	4.2e-06
AWA16073.1|1498709_1499456_-	hypothetical protein	NA	NA	NA	NA	NA
AWA16074.1|1499457_1500744_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	37.3	1.1e-65
AWA16075.1|1500996_1501197_-	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
AWA16076.1|1501254_1501422_-	hypothetical protein	NA	K7P728	Enterobacteria_phage	92.7	9.2e-26
AWA16077.1|1501493_1501778_-	RNA-binding protein	NA	A0A2D1GLL3	Escherichia_phage	94.7	9.4e-47
AWA16078.1|1501770_1502562_-	DUF551 domain-containing protein	NA	A0A0H4IU61	Shigella_phage	51.8	1.0e-58
AWA16079.1|1502558_1502798_-	hypothetical protein	NA	Q9XJH3	Enterobacteria_phage	96.0	8.8e-38
AWA16080.1|1502769_1503462_-	hypothetical protein	NA	A0A088CC42	Shigella_phage	55.4	1.2e-82
AWA16081.1|1503448_1503703_-	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	95.2	3.2e-38
AWA16082.1|1503699_1503867_-	DUF2737 domain-containing protein	NA	Q716F2	Shigella_phage	98.2	5.0e-24
AWA16083.1|1503863_1504145_-	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	96.8	2.8e-43
AWA16084.1|1504161_1504476_-	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	100.0	1.2e-50
AWA16085.1|1504487_1504970_-	hypothetical protein	NA	K7P6T5	Enterobacteria_phage	97.5	6.1e-78
AWA16086.1|1504953_1505865_-	DNA recombinase	NA	K7PKG9	Enterobacteria_phage	98.7	2.4e-168
AWA16087.1|1505861_1506170_-	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	100.0	1.1e-53
AWA16088.1|1506254_1506407_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
AWA16089.1|1506391_1506526_-	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
AWA16090.1|1506752_1506953_-	restriction endonuclease	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
AWA16091.1|1507031_1507412_-	antitermination protein	NA	A4KWR0	Enterobacteria_phage	99.1	5.3e-53
AWA16092.1|1507661_1508066_-	hypothetical protein	NA	Q716D7	Shigella_phage	96.2	2.1e-68
AWA16093.1|1508062_1508695_-	LexA family transcriptional repressor	NA	K7P850	Enterobacteria_phage	99.5	1.6e-118
AWA16094.1|1508798_1509014_+	XRE family transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
AWA16095.1|1509133_1509427_+	hypothetical protein	NA	A5VW96	Enterobacteria_phage	100.0	1.7e-46
AWA16096.1|1509449_1509722_+	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
AWA16097.1|1509724_1510672_+	replication protein	NA	A5VW95	Enterobacteria_phage	98.4	5.1e-153
AWA16098.1|1510668_1512045_+	replicative DNA helicase	NA	A0A0P0ZC27	Stx2-converting_phage	99.8	1.6e-253
AWA16099.1|1512100_1512559_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.6e-80
AWA16100.1|1512555_1513083_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	1.2e-100
AWA16101.1|1513079_1513262_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	98.3	1.3e-28
AWA16102.1|1513258_1513429_+	protein ninF	NA	K7PLU6	Enterobacteria_phage	100.0	2.5e-26
AWA16103.1|1513421_1514144_+	DNA-binding protein	NA	K7P7L0	Enterobacteria_phage	97.5	1.1e-128
AWA16104.1|1514143_1514434_+	DUF1364 domain-containing protein	NA	Q9MCN9	Enterobacteria_phage	100.0	3.4e-52
AWA16105.1|1514430_1514955_+	HNH endonuclease	NA	K4F9R1	Cronobacter_phage	42.9	7.1e-32
AWA16106.1|1514955_1515318_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PJW5	Enterobacteria_phage	97.5	6.6e-61
AWA16107.1|1515314_1515503_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
AWA16108.1|1515499_1516018_+	DUF1133 domain-containing protein	NA	Q716B8	Shigella_phage	99.4	5.9e-95
AWA16109.1|1516135_1516366_-	hypothetical protein	NA	NA	NA	NA	NA
AWA16110.1|1516613_1516937_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
AWA16111.1|1516920_1517397_+	lysozyme	NA	A5VW81	Enterobacteria_phage	100.0	7.5e-89
AWA16112.1|1517393_1517861_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	95.5	1.5e-73
AWA16113.1|1517848_1518001_+	hypothetical protein	NA	Q716B2	Shigella_phage	94.0	3.1e-20
AWA19430.1|1518206_1518692_+	helicase	NA	C6ZR70	Salmonella_phage	100.0	8.5e-88
AWA16114.1|1518940_1519183_+	DUF2560 domain-containing protein	NA	A5VW77	Enterobacteria_phage	100.0	3.7e-36
AWA16115.1|1519186_1519474_+	hypothetical protein	NA	I1TQD4	Pseudomonas_phage	33.3	1.3e-06
AWA16116.1|1519483_1519663_+	hypothetical protein	NA	Q9AZ02	Salmonella_phage	93.2	1.2e-23
AWA19431.1|1519686_1520109_+	ubiquitin carboxyl-hydrolase	NA	Q716H4	Shigella_phage	100.0	7.2e-75
AWA16117.1|1520105_1521518_+|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	99.8	5.8e-278
AWA16118.1|1521520_1523647_+|portal	portal protein	portal	Q9AYZ9	Salmonella_phage	99.6	0.0e+00
AWA16119.1|1523660_1524545_+|capsid	phage capsid protein	capsid	Q716H1	Shigella_phage	99.7	8.1e-145
AWA16120.1|1524556_1525828_+|head	head protein	head	Q9AYZ7	Salmonella_phage	99.5	7.3e-240
AWA16121.1|1525870_1526056_+	hypothetical protein	NA	Q716G9	Shigella_phage	100.0	2.7e-26
AWA16122.1|1526030_1526513_+	packaged DNA stabilization protein p27	NA	Q716G8	Shigella_phage	100.0	3.8e-88
AWA16123.1|1526521_1527940_+	hypothetical protein	NA	Q9AYZ4	Salmonella_phage	98.7	2.3e-274
AWA16124.1|1527939_1528893_+	hypothetical protein	NA	Q716G6	Shigella_phage	84.9	5.4e-94
AWA16125.1|1528892_1529348_+	hypothetical protein	NA	A5VW67	Enterobacteria_phage	97.4	2.8e-85
AWA16126.1|1529350_1530043_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	99.6	2.7e-111
AWA16127.1|1530052_1531384_+	acyltransferase	NA	A0A2D1GLX5	Escherichia_phage	98.2	5.5e-214
AWA16128.1|1531384_1533778_+	lytic transglycosylase domain-containing protein	NA	Q716G2	Shigella_phage	96.8	0.0e+00
AWA16129.1|1533942_1536342_+|head	phage head protein	head	A5VW57	Enterobacteria_phage	90.6	8.0e-78
>prophage 3
CP028589	Escherichia coli strain WCHEC4533 chromosome, complete genome	5099973	1783911	1793354	5099973		Enterobacteria_phage(85.71%)	10	NA	NA
AWA16352.1|1783911_1784838_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
AWA16353.1|1784842_1785574_+	ABC transporter permease	NA	NA	NA	NA	NA
AWA16354.1|1785554_1785662_-	hypothetical protein	NA	NA	NA	NA	NA
AWA16355.1|1785721_1786453_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
AWA16356.1|1786674_1788360_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
AWA16357.1|1788356_1789076_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AWA16358.1|1789122_1789593_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AWA16359.1|1789634_1790096_-	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AWA16360.1|1790220_1792221_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
AWA16361.1|1792217_1793354_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	2.5e-162
>prophage 4
CP028589	Escherichia coli strain WCHEC4533 chromosome, complete genome	5099973	1804793	1869880	5099973	tail,integrase,transposase,tRNA,portal,terminase,lysis,holin,plate,head,capsid	Escherichia_phage(41.3%)	75	1832687:1832713	1865566:1865592
AWA16364.1|1804793_1806827_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.3	2.3e-54
AWA16365.1|1806958_1808068_+	protein mrp	NA	NA	NA	NA	NA
AWA16366.1|1808330_1808612_+	DUF2574 domain-containing protein	NA	NA	NA	NA	NA
AWA16367.1|1808665_1808869_+	hypothetical protein	NA	NA	NA	NA	NA
AWA16368.1|1808774_1809284_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
AWA16369.1|1809618_1810161_+	hypothetical protein	NA	NA	NA	NA	NA
AWA16370.1|1810241_1810916_+	fimbrial assembly protein	NA	NA	NA	NA	NA
AWA16371.1|1810931_1813412_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AWA16372.1|1813427_1814462_+	adhesin	NA	NA	NA	NA	NA
AWA16373.1|1814543_1814882_-	nickel/cobalt homeostasis protein RcnB	NA	NA	NA	NA	NA
AWA16374.1|1815100_1815925_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
AWA16375.1|1816045_1816318_+	transcriptional regulator	NA	NA	NA	NA	NA
AWA16376.1|1816540_1817329_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
AWA16377.1|1817325_1818126_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AWA16378.1|1818190_1819009_+	hypothetical protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.1e-23
AWA16379.1|1819060_1819807_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWA16380.1|1819780_1820746_-	sugar kinase	NA	NA	NA	NA	NA
AWA16381.1|1820742_1821747_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.7	4.4e-14
AWA16382.1|1821743_1823021_-	MFS transporter	NA	NA	NA	NA	NA
AWA16383.1|1823277_1824330_+	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
AWA16384.1|1824559_1825414_+	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
AWA16385.1|1826709_1827162_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
AWA16386.1|1827192_1827477_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
AWA16387.1|1827480_1828836_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
AWA16388.1|1828883_1829924_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
AWA16389.1|1830023_1830803_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AWA16390.1|1830884_1831784_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	4.8e-12
AWA16391.1|1832198_1832516_+	hypothetical protein	NA	NA	NA	NA	NA
AWA16392.1|1832503_1832695_+	hypothetical protein	NA	NA	NA	NA	NA
1832687:1832713	attL	AAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
AWA16393.1|1832792_1833806_-|integrase	integrase	integrase	Q83VS6	Escherichia_phage	98.8	2.7e-192
AWA16394.1|1833921_1834221_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
AWA16395.1|1834342_1834618_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	98.9	2.2e-48
AWA16396.1|1834795_1835296_+	replication protein B	NA	S4TTB7	Salmonella_phage	98.8	1.9e-90
AWA16397.1|1835359_1835584_+	DUF2732 domain-containing protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
AWA16398.1|1835583_1835886_+	hypothetical protein	NA	A0A0F7LCL4	Escherichia_phage	100.0	3.5e-47
AWA16399.1|1835885_1836110_+	hypothetical protein	NA	A0A0F7LDG9	Escherichia_phage	98.6	3.8e-35
AWA16400.1|1836106_1836382_+	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	1.5e-44
AWA16401.1|1838717_1839869_+	DNA (cytosine-5-)-methyltransferase	NA	M1PSQ0	Streptococcus_phage	31.2	1.4e-32
AWA16402.1|1839819_1840812_-	hypothetical protein	NA	NA	NA	NA	NA
AWA16403.1|1840808_1842233_-	ATP-binding protein	NA	NA	NA	NA	NA
AWA16404.1|1842356_1842581_+	hypothetical protein	NA	M1TAP7	Escherichia_phage	94.3	8.6e-19
AWA16405.1|1842619_1843654_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	2.7e-200
AWA16406.1|1843653_1845426_-	oxidoreductase	NA	A0A0F7LCM8	Escherichia_phage	100.0	0.0e+00
AWA16407.1|1845599_1846454_+|capsid	capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	98.2	8.1e-134
AWA16408.1|1846512_1847586_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.2	2.5e-201
AWA16409.1|1847589_1848333_+|terminase	terminase	terminase	A0A0F7LDU4	Escherichia_phage	99.2	3.0e-124
AWA16410.1|1848432_1848942_+|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	100.0	8.6e-91
AWA16411.1|1848941_1849145_+|tail	phage tail protein	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
AWA16412.1|1849148_1849430_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
AWA16413.1|1849429_1849927_+	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
AWA16414.1|1849941_1850367_+	protein lysA	NA	U5N096	Enterobacteria_phage	95.7	2.3e-57
AWA16415.1|1850354_1850780_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	98.6	1.9e-67
AWA16416.1|1850751_1850925_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	91.2	9.8e-23
AWA16417.1|1850887_1851355_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	2.5e-81
AWA16418.1|1851347_1851800_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	98.0	1.5e-75
AWA16419.1|1851871_1852657_-	hypothetical protein	NA	NA	NA	NA	NA
AWA16420.1|1852740_1853376_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.5	1.2e-113
AWA16421.1|1853372_1853720_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
AWA16422.1|1853724_1854633_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	4.4e-162
AWA16423.1|1854625_1855156_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
AWA16424.1|1855166_1857188_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	64.5	2.7e-260
AWA16425.1|1857189_1857717_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	92.6	4.9e-89
AWA16426.1|1857938_1858532_+	lysogenic conversion protein	NA	Q858S7	Enterobacteria_phage	99.0	1.0e-106
AWA16427.1|1858861_1860052_+|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	9.0e-224
AWA16428.1|1860064_1860583_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	3.2e-93
AWA16429.1|1860639_1860915_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
AWA16430.1|1860947_1861067_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AWA16431.1|1861059_1863507_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.7	0.0e+00
AWA16432.1|1863521_1864001_+|tail	phage tail protein	tail	O64315	Escherichia_phage	98.1	9.6e-84
AWA16433.1|1864000_1865164_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	1.8e-205
AWA16434.1|1865209_1865464_+	transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	6.1e-45
AWA16435.1|1865736_1867098_-	U32 family peptidase	NA	Q6DW11	Phage_TP	99.2	1.6e-216
1865566:1865592	attR	AAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
AWA16436.1|1867245_1867578_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AWA16437.1|1867757_1868480_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
AWA16438.1|1868476_1869880_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	2.7e-33
>prophage 5
CP028589	Escherichia coli strain WCHEC4533 chromosome, complete genome	5099973	1917285	1924803	5099973		Escherichia_phage(42.86%)	8	NA	NA
AWA16473.1|1917285_1918680_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	7.5e-20
AWA16474.1|1918837_1919833_+	N-acetyl-alpha-D-glucosaminyl-diphospho-ditrans, octacis-undecaprenol 4-epimerase	NA	A0A1V0QG29	Shearwaterpox_virus	26.0	2.5e-09
AWA16475.1|1920064_1920958_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
AWA16476.1|1920994_1921258_-	hypothetical protein	NA	NA	NA	NA	NA
AWA16477.1|1921329_1922415_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	2.3e-101
AWA16478.1|1922414_1923314_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.1	1.7e-28
AWA16479.1|1923371_1924250_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	64.5	1.9e-106
AWA16480.1|1924254_1924803_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.4	4.4e-48
>prophage 6
CP028589	Escherichia coli strain WCHEC4533 chromosome, complete genome	5099973	2416302	2474757	5099973	tail,transposase,portal,terminase,lysis,head,capsid	Enterobacteria_phage(43.4%)	79	NA	NA
AWA16940.1|2416302_2416629_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.2e-23
AWA16941.1|2416665_2416854_+	hypothetical protein	NA	NA	NA	NA	NA
AWA16942.1|2416834_2418049_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AWA16943.1|2418060_2419080_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
AWA16944.1|2419137_2419266_+	transporter	NA	NA	NA	NA	NA
AWA16945.1|2419267_2420563_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.6	5.1e-156
AWA16946.1|2420603_2422175_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	3.2e-168
AWA16947.1|2422194_2422542_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AWA16948.1|2422541_2423219_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AWA16949.1|2423195_2423297_+	copper resistance protein	NA	NA	NA	NA	NA
AWA16950.1|2423289_2423541_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AWA16951.1|2423613_2426085_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	1.2e-57
AWA16952.1|2426178_2426370_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWA16953.1|2426366_2426555_-	division inhibition protein DicB	NA	NA	NA	NA	NA
AWA16954.1|2427041_2427659_-	hypothetical protein	NA	NA	NA	NA	NA
AWA16955.1|2427618_2427774_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
AWA16956.1|2427942_2428350_-	transcriptional regulator	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
AWA16957.1|2428430_2428658_+	transcriptional regulator	NA	NA	NA	NA	NA
AWA16958.1|2428641_2429163_+	hypothetical protein	NA	NA	NA	NA	NA
AWA16959.1|2429089_2430109_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.8e-56
AWA16960.1|2430149_2430548_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	93.9	7.7e-63
AWA16961.1|2430750_2431416_+	hypothetical protein	NA	NA	NA	NA	NA
AWA16962.1|2431624_2432239_+	hypothetical protein	NA	NA	NA	NA	NA
AWA16963.1|2432235_2433264_+	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
AWA16964.1|2433747_2435061_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AWA16965.1|2435105_2435228_+	plasmid mobilization protein	NA	NA	NA	NA	NA
AWA16966.1|2435497_2435830_-	protein FlxA	NA	NA	NA	NA	NA
AWA16967.1|2436032_2436338_-	hypothetical protein	NA	NA	NA	NA	NA
AWA16968.1|2436362_2436602_+	antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
AWA16969.1|2436601_2436889_+	mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
AWA16970.1|2436960_2437116_+	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
AWA16971.1|2437332_2437584_+	hypothetical protein	NA	NA	NA	NA	NA
AWA16972.1|2437650_2437929_+	hypothetical protein	NA	NA	NA	NA	NA
AWA16973.1|2437930_2438980_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.0	2.8e-112
AWA16974.1|2438993_2439746_+	antitermination protein Q	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
AWA16975.1|2440167_2440380_-	cold-shock protein CspF	NA	NA	NA	NA	NA
AWA16976.1|2440680_2440896_+	cold-shock protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
AWA16977.1|2441144_2441390_+	hypothetical protein	NA	NA	NA	NA	NA
AWA16978.1|2441295_2441805_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
AWA16979.1|2442361_2442577_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
AWA16980.1|2442581_2442893_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
AWA16981.1|2442889_2443423_+	lysozyme from lambdoid prophage Qin	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
AWA16982.1|2443419_2443917_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
AWA16983.1|2444279_2444492_+	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AWA16984.1|2444502_2444691_+	cold-shock protein	NA	NA	NA	NA	NA
AWA16985.1|2444721_2444994_+	hypothetical protein	NA	NA	NA	NA	NA
AWA16986.1|2445165_2445339_+	protein GnsB	NA	NA	NA	NA	NA
AWA16987.1|2445490_2445901_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
AWA16988.1|2445958_2446192_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
AWA16989.1|2446339_2446441_+	hypothetical protein	NA	NA	NA	NA	NA
AWA16990.1|2446580_2447126_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
AWA16991.1|2447100_2449026_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
AWA16992.1|2449022_2449229_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AWA16993.1|2449225_2450827_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
AWA16994.1|2450807_2452127_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	2.2e-231
AWA16995.1|2452136_2452469_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
AWA16996.1|2452523_2453549_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	99.7	2.7e-192
AWA16997.1|2453590_2453989_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	2.3e-62
AWA16998.1|2454000_2454354_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
AWA16999.1|2454365_2454944_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
AWA17000.1|2454940_2455336_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
AWA19470.1|2455343_2456084_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
AWA17001.1|2456099_2456522_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
AWA17002.1|2456503_2456938_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AWA17003.1|2456930_2459492_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	96.0	0.0e+00
AWA17004.1|2459488_2459818_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
AWA17005.1|2459817_2460516_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	8.9e-131
AWA17006.1|2460521_2461265_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	9.5e-147
AWA17007.1|2461162_2461804_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.5	1.1e-95
AWA17008.1|2461864_2465344_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
AWA17009.1|2465411_2466011_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	91.5	9.8e-102
AWA17010.1|2466075_2468475_+|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	55.3	3.9e-133
AWA17011.1|2468471_2468753_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.2e-17
AWA17012.1|2468762_2469467_+	chaperone of endosialidase	NA	A0A1X7QGH6	Escherichia_phage	61.7	1.2e-58
AWA17013.1|2469477_2469771_+	hypothetical protein	NA	NA	NA	NA	NA
AWA17014.1|2469998_2470589_-	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AWA17015.1|2470905_2471139_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AWA17016.1|2471924_2473208_+	MFS transporter	NA	NA	NA	NA	NA
AWA17017.1|2473296_2474757_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.7	5.1e-43
>prophage 7
CP028589	Escherichia coli strain WCHEC4533 chromosome, complete genome	5099973	2900505	2958947	5099973	tail,integrase,tRNA,portal,terminase,lysis,holin,head,capsid	Escherichia_phage(35.85%)	76	2908698:2908712	2959049:2959063
AWA17388.1|2900505_2901612_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AWA19494.1|2901647_2902289_+	lysogenization protein HflD	NA	NA	NA	NA	NA
AWA17389.1|2902292_2903663_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
AWA17390.1|2903832_2904504_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AWA17391.1|2904503_2905964_+	sensor protein PhoQ	NA	NA	NA	NA	NA
AWA17392.1|2906039_2907161_+	50S ribosomal protein L16 arginine hydroxylase	NA	NA	NA	NA	NA
AWA17393.1|2907209_2908436_-	peptidase T	NA	NA	NA	NA	NA
AWA19495.1|2908491_2908707_+	hypothetical protein	NA	NA	NA	NA	NA
AWA17394.1|2908685_2909822_+	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
2908698:2908712	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
AWA17395.1|2909805_2910669_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
AWA17396.1|2910900_2911167_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.8	1.5e-17
AWA19496.1|2911265_2911892_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AWA17397.1|2911836_2911974_-|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AWA17398.1|2911946_2912531_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
AWA17399.1|2912530_2915557_-	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	54.6	1.4e-55
AWA17400.1|2915708_2916308_-	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
AWA17401.1|2916375_2920068_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	86.0	0.0e+00
AWA17402.1|2920411_2921092_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.9	3.7e-113
AWA17403.1|2920989_2921733_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
AWA17404.1|2921743_2922442_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	3.2e-128
AWA17405.1|2922441_2922771_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AWA17406.1|2922767_2925329_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.5	0.0e+00
AWA17407.1|2925309_2925723_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
AWA17408.1|2925749_2926181_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	1.8e-41
AWA17409.1|2926194_2926947_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	2.7e-133
AWA17410.1|2926954_2927350_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
AWA17411.1|2927346_2927922_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	56.8	1.6e-48
AWA17412.1|2927937_2928291_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
AWA17413.1|2928283_2928706_-	hypothetical protein	NA	NA	NA	NA	NA
AWA17414.1|2928709_2929738_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.9	4.1e-116
AWA17415.1|2929795_2930143_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	59.1	6.8e-23
AWA17416.1|2930179_2931685_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.1	1.0e-99
AWA17417.1|2931674_2933267_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	4.9e-185
AWA17418.1|2933263_2933470_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	55.4	3.0e-10
AWA17419.1|2933453_2935382_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	1.4e-261
AWA17420.1|2935353_2935863_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
AWA17421.1|2935984_2936164_-	DNA-packaging protein	NA	NA	NA	NA	NA
AWA17422.1|2936137_2936458_+	hypothetical protein	NA	NA	NA	NA	NA
AWA17423.1|2936345_2936699_+	hypothetical protein	NA	NA	NA	NA	NA
AWA17424.1|2936821_2937202_-	hypothetical protein	NA	H6WZK5	Escherichia_phage	72.2	2.6e-39
AWA19497.1|2937458_2937926_-|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	84.4	6.7e-66
AWA17425.1|2938074_2938290_-	hypothetical protein	NA	NA	NA	NA	NA
AWA17426.1|2938413_2938947_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	6.7e-102
AWA17427.1|2938983_2939874_-	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	70.9	2.1e-108
AWA17428.1|2939878_2940094_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
AWA17429.1|2940243_2940405_-	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	89.1	1.6e-14
AWA17430.1|2940401_2940605_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	96.8	2.7e-27
AWA17431.1|2940850_2941186_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
AWA17432.1|2941555_2941888_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	93.4	7.0e-33
AWA17433.1|2941965_2942655_-	antiterminator	NA	I6PDF8	Cronobacter_phage	48.1	7.1e-56
AWA17434.1|2942647_2943016_-	hypothetical protein	NA	V5URS4	Shigella_phage	62.8	2.4e-34
AWA17435.1|2943016_2944075_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.3	1.8e-90
AWA17436.1|2944076_2944355_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	45.3	6.3e-11
AWA17437.1|2944421_2944673_-	hypothetical protein	NA	NA	NA	NA	NA
AWA17438.1|2944889_2945045_-	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
AWA17439.1|2945303_2945483_-	hypothetical protein	NA	NA	NA	NA	NA
AWA17440.1|2945603_2946590_-	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	41.5	1.8e-44
AWA17441.1|2946586_2946952_-	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	99.2	1.9e-68
AWA17442.1|2946953_2947361_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	60.4	1.0e-22
AWA17443.1|2947456_2947813_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	1.1e-57
AWA17444.1|2947790_2948252_-	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	2.6e-38
AWA17445.1|2948248_2948545_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
AWA17446.1|2948541_2948949_-	DUF977 domain-containing protein	NA	A0A088CBK9	Shigella_phage	63.3	1.6e-39
AWA17447.1|2948949_2949720_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.4	1.1e-86
AWA17448.1|2949753_2950419_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.4e-79
AWA17449.1|2951219_2951771_-	hypothetical protein	NA	NA	NA	NA	NA
AWA17450.1|2951754_2951982_-	transcriptional regulator	NA	NA	NA	NA	NA
AWA17451.1|2952058_2952466_+	transcriptional regulator	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
AWA19498.1|2952672_2952825_+	DUF1391 domain-containing protein	NA	NA	NA	NA	NA
AWA19499.1|2952836_2953211_+	hypothetical protein	NA	NA	NA	NA	NA
AWA17452.1|2953741_2954596_+	transcriptional regulator	NA	A0A0P0ZE80	Stx2-converting_phage	63.2	3.6e-65
AWA17453.1|2954606_2954795_+	cell division inhibitor	NA	NA	NA	NA	NA
AWA17454.1|2954791_2954995_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AWA17455.1|2955072_2957529_+	exonuclease	NA	V5UQJ3	Shigella_phage	42.6	2.5e-103
AWA17456.1|2957590_2957860_+	excisionase	NA	NA	NA	NA	NA
AWA17457.1|2957828_2958947_+|integrase	integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
2959049:2959063	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 8
CP028589	Escherichia coli strain WCHEC4533 chromosome, complete genome	5099973	3321050	3377252	5099973	tail,integrase,transposase,protease,portal,terminase,holin,head,capsid	Enterobacteria_phage(37.93%)	79	3343778:3343794	3385127:3385143
AWA17788.1|3321050_3321560_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
AWA17789.1|3321465_3321681_-	hypothetical protein	NA	NA	NA	NA	NA
AWA17790.1|3321697_3322402_-	BAX inhibitor (BI)-1/YccA family protein	NA	NA	NA	NA	NA
AWA17791.1|3322538_3322991_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
AWA17792.1|3322992_3323238_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
AWA17793.1|3323230_3323716_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
AWA17794.1|3323718_3324231_-	molybdenum cofactor biosynthesis protein	NA	NA	NA	NA	NA
AWA17795.1|3324252_3325242_-	cyclic pyranopterin monophosphate synthase	NA	NA	NA	NA	NA
AWA17796.1|3325638_3326547_+	gluconeogenesis factor	NA	A1IMD5	Streptococcus_phage	30.7	3.2e-27
AWA17797.1|3326584_3328606_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AWA17798.1|3329184_3329862_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
AWA17799.1|3329854_3330610_-	malonyl-[acyl-carrier protein] O-methyltransferase BioC	NA	NA	NA	NA	NA
AWA17800.1|3330596_3331751_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
AWA17801.1|3331747_3332788_-	biotin synthase	NA	NA	NA	NA	NA
AWA17802.1|3332874_3334164_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
AWA17803.1|3334222_3334699_+	kinase inhibitor	NA	NA	NA	NA	NA
AWA17804.1|3334613_3334793_+	hypothetical protein	NA	NA	NA	NA	NA
AWA17805.1|3335444_3336776_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
AWA19516.1|3336988_3337282_-	hypothetical protein	NA	NA	NA	NA	NA
AWA17806.1|3337324_3338365_-	peptidase S74	NA	A0A0E3M4A9	Enterobacteria_phage	67.9	2.9e-125
AWA17807.1|3338374_3338656_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	1.4e-18
AWA17808.1|3338655_3341028_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.0	1.8e-167
AWA17809.1|3341179_3341779_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	97.0	9.1e-108
AWA17810.1|3341846_3345326_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.8	0.0e+00
3343778:3343794	attL	CGGAAGATGGCAGCGTG	NA	NA	NA	NA
AWA17811.1|3345386_3346034_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
AWA17812.1|3345931_3346675_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	5.0e-148
AWA17813.1|3346680_3347379_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	7.6e-130
AWA17814.1|3347378_3347735_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
AWA19517.1|3347712_3350940_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.6	0.0e+00
AWA19518.1|3350986_3351247_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	96.5	1.7e-39
AWA17815.1|3351288_3351675_-|tail	phage tail protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
AWA17816.1|3351674_3352379_-|tail	phage tail protein	tail	A0A1B5FP82	Escherichia_phage	93.6	1.7e-113
AWA17817.1|3352439_3352784_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	2.3e-55
AWA17818.1|3352780_3353230_-	hypothetical protein	NA	S4TR46	Salmonella_phage	80.5	1.0e-63
AWA17819.1|3353226_3353565_-|head,tail	head-tail adaptor protein	head,tail	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
AWA17820.1|3353573_3353891_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	6.2e-23
AWA17821.1|3353967_3355185_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.4	1.7e-161
AWA17822.1|3355199_3355799_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
AWA17823.1|3355791_3357018_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	82.8	3.1e-203
AWA17824.1|3357165_3358923_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
AWA17825.1|3358922_3359405_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	4.3e-84
AWA17826.1|3359552_3359903_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	1.4e-63
AWA17827.1|3360041_3360581_+	hypothetical protein	NA	NA	NA	NA	NA
AWA17828.1|3360586_3360853_-	hypothetical protein	NA	NA	NA	NA	NA
AWA17829.1|3361070_3361256_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
AWA17830.1|3361472_3362006_-	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	3.6e-100
AWA17831.1|3362069_3362420_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.9e-37
AWA17832.1|3362424_3362640_-|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
AWA17833.1|3363005_3363494_-	antiterminator	NA	M1FPN0	Enterobacteria_phage	100.0	5.3e-90
AWA17834.1|3363537_3364149_-	recombination protein NinG	NA	Q716C3	Shigella_phage	100.0	2.7e-99
AWA17835.1|3364141_3364312_-	protein ninF	NA	Q8H9Z5	Enterobacteria_phage	96.4	3.5e-25
AWA19519.1|3364308_3364491_-	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	4.3e-29
AWA17836.1|3364487_3364946_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.6e-80
AWA17837.1|3365001_3365292_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
AWA17838.1|3365288_3365990_-	Replication protein P	NA	A0A0K2FIT1	Enterobacteria_phage	99.1	6.4e-129
AWA17839.1|3365986_3366886_-	Replication protein O	NA	A0A0K2FJ31	Enterobacteria_phage	100.0	3.8e-174
AWA17840.1|3366918_3367215_-	hypothetical protein	NA	A0A1U9AJB5	Stx1_converting_phage	98.0	1.5e-47
AWA17841.1|3367353_3367581_-	DNA-binding protein	NA	G9L677	Escherichia_phage	98.7	1.7e-35
AWA17842.1|3367660_3368368_+	phage repressor protein C	NA	G9L676	Escherichia_phage	99.6	4.3e-133
AWA17843.1|3368491_3368812_+	hypothetical protein	NA	NA	NA	NA	NA
AWA17844.1|3368811_3369495_+	DUF1640 domain-containing protein	NA	NA	NA	NA	NA
AWA17845.1|3369945_3370218_+	antitermination protein N	NA	A0A0N7C217	Escherichia_phage	97.8	2.2e-40
AWA17846.1|3370346_3370547_+	restriction endonuclease	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	4.2e-33
AWA17847.1|3370668_3370944_+	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	100.0	1.6e-46
AWA17848.1|3371028_3371337_+	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	99.0	3.3e-53
AWA17849.1|3371333_3372245_+	DNA recombinase	NA	K7PKG9	Enterobacteria_phage	99.3	1.1e-168
AWA17850.1|3372228_3372711_+	hypothetical protein	NA	K7P6T5	Enterobacteria_phage	96.2	2.3e-77
AWA17851.1|3372722_3373037_+	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	100.0	1.2e-50
AWA17852.1|3373053_3373335_+	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	96.8	2.8e-43
AWA17853.1|3373331_3373499_+	DUF2737 domain-containing protein	NA	Q716F2	Shigella_phage	98.2	5.0e-24
AWA17854.1|3373495_3373750_+	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	95.2	3.2e-38
AWA17855.1|3373736_3374231_+	hypothetical protein	NA	A0A0P0ZD75	Stx2-converting_phage	55.0	3.0e-24
AWA17856.1|3374403_3374592_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	93.5	2.9e-28
AWA19521.1|3374521_3374803_+	hypothetical protein	NA	Q9XJH3	Enterobacteria_phage	90.3	1.5e-44
AWA17857.1|3374799_3375678_+	DUF551 domain-containing protein	NA	A0A0H4IU61	Shigella_phage	53.4	6.7e-67
AWA19520.1|3375642_3375846_-	hypothetical protein	NA	NA	NA	NA	NA
AWA17858.1|3375778_3375946_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	4.9e-27
AWA17859.1|3375985_3376204_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
AWA17860.1|3376181_3377252_+|integrase	integrase	integrase	Q9MCR4	Enterobacteria_phage	99.4	9.6e-201
3385127:3385143	attR	CACGCTGCCATCTTCCG	NA	NA	NA	NA
>prophage 1
CP028585	Escherichia coli strain WCHEC4533 plasmid p1_000533, complete sequence	92537	0	77510	92537	integrase,terminase,transposase,plate,capsid,tail,head,portal	Escherichia_phage(88.3%)	103	7385:7403	67919:67937
AWA14392.1|221_596_+	hypothetical protein	NA	A0A222YWB0	Escherichia_phage	93.5	2.8e-38
AWA14393.1|712_1921_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	92.8	8.6e-214
AWA14394.1|2027_3413_+	hypothetical protein	NA	A0A222YY44	Escherichia_phage	96.7	5.4e-236
AWA14395.1|3927_5160_+|portal	phage portal protein	portal	A0A222YXQ7	Escherichia_phage	100.0	9.6e-237
AWA14396.1|5173_6172_+|head	head processing protein	head	A0A222YWA7	Escherichia_phage	98.5	1.9e-179
AWA14397.1|6372_7335_+	lytic replication protein	NA	A0A222YXV1	Escherichia_phage	98.8	5.6e-176
7385:7403	attL	ATTTGTGTTAGAAAATTAA	NA	NA	NA	NA
AWA14398.1|7749_7974_+	host cell division inhibitor Icd-like protein	NA	A0A222YWB3	Escherichia_phage	100.0	8.8e-40
AWA14399.1|7973_8681_+	DNA-binding protein	NA	A0A222YXY0	Escherichia_phage	90.6	1.1e-115
AWA14400.1|8680_8878_+	hypothetical protein	NA	A0A222YWF5	Escherichia_phage	100.0	3.1e-33
AWA14401.1|8910_9396_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	100.0	3.3e-92
AWA14402.1|9547_16384_+	helicase SNF2	NA	A0A222YYH3	Escherichia_phage	98.9	0.0e+00
AWA14403.1|16420_16855_+	olxA	NA	A0A222YZ35	Escherichia_phage	93.8	2.1e-74
AWA14404.1|16857_17118_+	hypothetical protein	NA	A0A222YXI8	Escherichia_phage	98.8	3.1e-44
AWA14405.1|17452_17749_+	VRR-NUC domain-containing protein	NA	A0A222YXP1	Escherichia_phage	100.0	5.4e-53
AWA14406.1|17763_17964_+	hypothetical protein	NA	A0A222YWF9	Escherichia_phage	98.5	3.3e-30
AWA14496.1|17978_18260_+	hypothetical protein	NA	A0A222YW96	Escherichia_phage	95.7	3.2e-39
AWA14407.1|18373_19582_+	hypothetical protein	NA	A0A222YW83	Escherichia_phage	99.5	4.5e-231
AWA14408.1|20940_21126_-	hypothetical protein	NA	Q71T99	Escherichia_phage	100.0	1.5e-16
AWA14409.1|21941_22376_+	tellurite resistance protein	NA	A0A222YXQ0	Escherichia_phage	100.0	3.7e-74
AWA14410.1|22375_22540_+	DUF3927 domain-containing protein	NA	A0A222YXW5	Escherichia_phage	100.0	1.8e-18
AWA14497.1|23573_23765_+	hypothetical protein	NA	A0A222YWJ0	Escherichia_phage	100.0	3.2e-30
AWA14498.1|23971_24157_+	hypothetical protein	NA	Q5QBF3	Escherichia_phage	98.4	6.4e-28
AWA14411.1|24265_24658_+	late promoter activating protein	NA	NA	NA	NA	NA
AWA14499.1|25038_26019_+	DNA pacase A subunit	NA	NA	NA	NA	NA
AWA14412.1|26018_27527_+|terminase	terminase	terminase	Q5QBP2	Enterobacteria_phage	56.8	1.2e-161
AWA14500.1|27554_27794_-	hypothetical protein	NA	Q5QBE5	Escherichia_phage	96.4	1.4e-06
AWA14413.1|28986_30015_+|integrase	integrase	integrase	Q5XLQ5	Enterobacteria_phage	41.9	1.2e-59
AWA14414.1|30089_30434_+	hypothetical protein	NA	A0A222YYS6	Escherichia_phage	94.7	3.9e-55
AWA14415.1|30430_30907_+	hypothetical protein	NA	NA	NA	NA	NA
AWA14416.1|30903_31398_+	dUTP diphosphatase	NA	A0A222YYP1	Escherichia_phage	94.5	8.1e-86
AWA14417.1|31412_32075_+	DUF2829 domain-containing protein	NA	A0A1B0VBT1	Salmonella_phage	81.0	5.0e-99
AWA14418.1|32081_32849_+	hypothetical protein	NA	A0A222YXM9	Escherichia_phage	98.4	8.6e-135
AWA14419.1|32838_33933_+	hypothetical protein	NA	Q71T61	Escherichia_phage	32.7	1.3e-40
AWA14420.1|33968_34349_-	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	91.1	6.1e-57
AWA14421.1|34348_34570_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
AWA14422.1|34642_35032_-	DNA repair protein	NA	A0A077SK24	Escherichia_phage	95.3	3.5e-68
AWA14423.1|35155_35407_-	DNA polymerase III subunit theta	NA	A0A077SLL5	Escherichia_phage	97.6	1.6e-37
AWA14501.1|35409_35610_-	hypothetical protein	NA	NA	NA	NA	NA
AWA14424.1|35721_36492_-	hypothetical protein	NA	A0A1B0VDS6	Salmonella_phage	73.0	3.1e-116
AWA14425.1|36488_36797_-	hypothetical protein	NA	NA	NA	NA	NA
AWA14426.1|36796_37090_-	hypothetical protein	NA	A0A077SK23	Escherichia_phage	93.8	9.7e-47
AWA14502.1|37102_37519_-	hypothetical protein	NA	A0A076G6X8	Escherichia_phage	61.2	1.8e-25
AWA14427.1|37804_38065_-	eaa protein	NA	A0A077SLR0	Escherichia_phage	98.8	8.4e-42
AWA14428.1|38061_38751_-	DUF551 domain-containing protein	NA	A0A2D1GLX9	Escherichia_phage	89.9	2.9e-113
AWA14429.1|38747_39029_-	hypothetical protein	NA	Q9XJH3	Enterobacteria_phage	90.3	2.5e-44
AWA14430.1|38958_39147_-	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	98.4	1.4e-30
AWA14431.1|39492_39939_-	hypothetical protein	NA	A0A222YWN7	Escherichia_phage	82.4	7.4e-38
AWA14432.1|39935_40556_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	79.7	2.6e-25
AWA14433.1|40552_40744_-	DUF1382 domain-containing protein	NA	A0A0P0ZC60	Stx2-converting_phage	81.4	3.1e-17
AWA14434.1|40740_40827_-	hypothetical protein	NA	NA	NA	NA	NA
AWA14435.1|40840_41836_-	DUF968 domain-containing protein	NA	A0A222YWL6	Escherichia_phage	97.6	6.2e-194
AWA14436.1|41932_42601_-	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	87.7	8.6e-115
AWA14437.1|42637_43846_-|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	94.0	3.4e-210
AWA14438.1|43957_44269_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	99.0	1.8e-59
AWA14439.1|44265_44490_-	hypothetical protein	NA	A0A222YYR6	Escherichia_phage	94.6	2.5e-34
AWA14440.1|44467_44761_-	DUF4752 domain-containing protein	NA	A0A222YWQ2	Escherichia_phage	86.5	1.0e-35
AWA14441.1|44757_45006_-	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	84.8	3.5e-29
AWA14442.1|45002_45644_-	hypothetical protein	NA	A0A222YWM9	Escherichia_phage	90.0	8.6e-104
AWA14443.1|45640_46150_-	hypothetical protein	NA	E7C9P6	Salmonella_phage	66.0	1.7e-38
AWA14503.1|46139_46424_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	96.8	5.2e-45
AWA14444.1|46453_47077_-	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	82.8	5.8e-89
AWA14445.1|47349_47928_+	recombinase	NA	A0A222YXV2	Escherichia_phage	96.9	6.4e-74
AWA14446.1|48600_48720_+	hypothetical protein	NA	NA	NA	NA	NA
AWA14447.1|48738_48954_+	host cell division inhibitor Icd-like protein	NA	A0A222YWG3	Escherichia_phage	98.6	7.4e-36
AWA14448.1|48953_49880_+	Rha family transcriptional regulator	NA	A0A222YWG0	Escherichia_phage	84.3	3.7e-148
AWA14449.1|49939_50251_+	transcriptional regulator	NA	A0A222YY28	Escherichia_phage	83.0	1.0e-33
AWA14504.1|50247_50475_-	hypothetical protein	NA	NA	NA	NA	NA
AWA14450.1|50660_51269_-	hypothetical protein	NA	NA	NA	NA	NA
AWA14451.1|51552_52206_+	maturation control protein	NA	A0A222YZ79	Escherichia_phage	99.5	4.9e-115
AWA14452.1|52542_52824_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2L1IV28	Escherichia_phage	45.2	7.5e-20
AWA14453.1|52832_53114_+	addiction module antidote protein, HigA family	NA	I6ZVM3	Aeromonas_phage	44.7	1.3e-08
AWA14454.1|53206_53536_+|plate	baseplate protein	plate	A0A222YYR0	Escherichia_phage	100.0	3.6e-58
AWA14455.1|53528_54722_+|tail	phage tail protein	tail	A0A222YXT1	Escherichia_phage	96.5	1.3e-198
AWA14456.1|54755_55484_-	hypothetical protein	NA	A0A222YY57	Escherichia_phage	58.3	1.2e-72
AWA14457.1|55505_55706_-	hypothetical protein	NA	A0A222YXG1	Escherichia_phage	90.8	8.1e-29
AWA14458.1|55762_56101_-	addiction module antidote protein, HigA family	NA	A0A222YWD7	Escherichia_phage	100.0	1.3e-55
AWA14459.1|56171_56474_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	100.0	5.9e-55
AWA14460.1|56636_57428_+|tail	phage tail protein	tail	A0A222YXU3	Escherichia_phage	98.5	2.8e-149
AWA14461.1|57424_58192_+|plate	baseplate	plate	A0A222YWF4	Escherichia_phage	100.0	4.4e-139
AWA14462.1|58195_59176_+|tail	tail length tape measure protein	tail	A0A222YXZ0	Escherichia_phage	99.7	9.5e-187
AWA14463.1|59172_59826_+|plate	baseplate protein	plate	A0A222YWF1	Escherichia_phage	93.5	1.3e-94
AWA14464.1|59885_60791_+	recombination-associated protein RdgC	NA	A0A222YY21	Escherichia_phage	98.0	3.9e-163
AWA14465.1|60774_61455_+	hypothetical protein	NA	A0A222YXN3	Escherichia_phage	100.0	5.8e-135
AWA14466.1|61447_62353_+	DNA methylase	NA	A0A222YYM0	Escherichia_phage	95.3	5.9e-167
AWA14467.1|62497_62782_-	hypothetical protein	NA	A0A222YZA7	Escherichia_phage	76.8	5.6e-31
AWA14468.1|62774_63416_-	cobyrinic acid ac-diamide synthase	NA	A0A222YXS3	Escherichia_phage	93.0	4.0e-109
AWA14469.1|63694_64033_-	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	96.4	8.3e-50
AWA14470.1|64045_65002_-	recombinase	NA	A0A222YXF2	Escherichia_phage	99.7	1.7e-180
AWA14471.1|65268_65553_+	alanine racemase	NA	A0A222YXW1	Escherichia_phage	81.9	8.9e-37
AWA14472.1|65552_66356_+	hypothetical protein	NA	A0A222YXK1	Escherichia_phage	84.0	1.4e-100
AWA14473.1|66426_66885_+	hypothetical protein	NA	A0A222YWG1	Escherichia_phage	94.7	4.7e-64
AWA14474.1|67038_67497_-	hypothetical protein	NA	A0A222YWJ4	Escherichia_phage	98.7	2.3e-87
AWA14505.1|67515_67908_-	hypothetical protein	NA	A0A222YXX4	Escherichia_phage	97.7	5.6e-66
AWA14475.1|68066_69764_+|capsid	capsid protein	capsid	A0A222YWC7	Escherichia_phage	97.3	0.0e+00
67919:67937	attR	ATTTGTGTTAGAAAATTAA	NA	NA	NA	NA
AWA14476.1|69911_70190_+	hypothetical protein	NA	A0A222YWH8	Escherichia_phage	96.7	1.1e-39
AWA14477.1|70257_71916_+|tail	phage tail protein	tail	A0A222YWC8	Escherichia_phage	98.0	1.4e-304
AWA14478.1|71959_72694_+	hypothetical protein	NA	A0A222YXT7	Escherichia_phage	100.0	5.9e-125
AWA14479.1|72761_73334_+	hypothetical protein	NA	A0A222YY02	Escherichia_phage	98.9	6.7e-100
AWA14480.1|73342_73834_+|plate	baseplate protein	plate	A0A222YWE4	Escherichia_phage	100.0	3.5e-89
AWA14481.1|73888_74440_+	hypothetical protein	NA	A0A222YWE3	Escherichia_phage	98.9	1.3e-97
AWA14482.1|74455_75163_+|tail	phage tail protein	tail	A0A222YY05	Escherichia_phage	100.0	1.0e-126
AWA14483.1|75544_76300_-	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	100.0	3.7e-138
AWA14484.1|76688_77510_+	hypothetical protein	NA	A0A222YZ63	Escherichia_phage	98.9	8.5e-157
>prophage 2
CP028585	Escherichia coli strain WCHEC4533 plasmid p1_000533, complete sequence	92537	81966	90829	92537	plate,holin,tail,lysis	Escherichia_phage(75.0%)	12	NA	NA
AWA14485.1|81966_82341_+	hypothetical protein	NA	A0A222YXD0	Escherichia_phage	97.6	1.7e-64
AWA14486.1|82337_83768_+|plate	baseplate protein	plate	A0A222YWB2	Escherichia_phage	98.7	2.2e-269
AWA14487.1|83778_84624_+|tail	phage tail protein	tail	A0A222YWB7	Escherichia_phage	98.2	3.0e-157
AWA14506.1|85015_85165_+|tail	phage tail protein	tail	A0A222YXS1	Escherichia_phage	98.0	7.9e-21
AWA14488.1|85167_87054_+	hypothetical protein	NA	A0A222YWB9	Escherichia_phage	53.0	6.4e-107
AWA14489.1|87053_87668_+|tail	phage tail protein	tail	Q9MCR5	Enterobacteria_phage	61.5	1.7e-61
AWA14490.1|87674_88130_-|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	50.6	3.1e-31
AWA14491.1|88157_88598_-|tail	phage tail protein	tail	K7PH60	Enterobacterial_phage	54.9	3.5e-40
AWA14492.1|88657_89230_+	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
AWA14493.1|89446_89773_+|holin	holin	holin	A0A222YZ46	Escherichia_phage	99.1	9.5e-51
AWA14494.1|89772_90219_+|lysis	lysis protein	lysis	A0A222YXP5	Escherichia_phage	100.0	9.2e-81
AWA14495.1|90208_90829_+	hypothetical protein	NA	A0A222YXB2	Escherichia_phage	95.1	8.1e-75
>prophage 1
CP028587	Escherichia coli strain WCHEC4533 plasmid pCTXM15_000533, complete sequence	150853	9716	52485	150853	transposase,integrase	Escherichia_phage(53.85%)	51	NA	NA
AWA14519.1|9716_10499_-|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
AWA14520.1|10495_11518_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
AWA14521.1|12597_12972_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	9.8e-60
AWA14522.1|12996_13701_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWA14666.1|14327_14885_+	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AWA14523.1|15026_15608_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AWA14524.1|15612_15951_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AWA14525.1|15980_16310_-	thioredoxin	NA	V9SJ74	Achromobacter_phage	34.7	1.3e-10
AWA14526.1|16523_17630_+	alkene reductase	NA	NA	NA	NA	NA
AWA14527.1|17695_18064_+	hypothetical protein	NA	NA	NA	NA	NA
AWA14528.1|18009_18714_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWA14529.1|19596_19860_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AWA14530.1|19852_20239_+	amino acid-binding protein	NA	NA	NA	NA	NA
AWA14531.1|20246_20933_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AWA14532.1|20910_21537_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AWA14533.1|21615_22821_+	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
AWA14534.1|23811_23994_-	hypothetical protein	NA	NA	NA	NA	NA
AWA14535.1|23946_24174_+	scsC protein	NA	NA	NA	NA	NA
AWA14536.1|24163_24670_+	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
AWA14537.1|24852_25668_+	NADH:ubiquinone reductase (Na(+)-transporting) subunit C	NA	NA	NA	NA	NA
AWA14538.1|25826_26012_+	hypothetical protein	NA	NA	NA	NA	NA
AWA14539.1|25954_27901_+	iron permease	NA	NA	NA	NA	NA
AWA14540.1|27941_28469_+	iron transporter	NA	NA	NA	NA	NA
AWA14541.1|28572_29952_+	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
AWA14542.1|29954_31238_+	ABC transporter permease	NA	NA	NA	NA	NA
AWA14543.1|31197_32358_+	ABC transporter permease	NA	NA	NA	NA	NA
AWA14544.1|32362_33058_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
AWA14545.1|32975_33530_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
AWA14546.1|33554_34040_+	hypothetical protein	NA	NA	NA	NA	NA
AWA14547.1|34161_34905_+	histidine-type phosphatase	NA	NA	NA	NA	NA
AWA14548.1|35325_36330_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWA14549.1|36769_37522_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AWA14550.1|37763_38636_+	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AWA14551.1|38766_39990_+	aminotransferase	NA	NA	NA	NA	NA
AWA14552.1|40175_40949_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AWA14553.1|41525_42230_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWA14554.1|42708_43065_-	hypothetical protein	NA	NA	NA	NA	NA
AWA14555.1|43010_43595_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AWA14556.1|43594_44833_-	MFS transporter	NA	NA	NA	NA	NA
AWA14557.1|44829_45735_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AWA14558.1|45856_46561_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AWA14559.1|46537_46720_+	hypothetical protein	NA	NA	NA	NA	NA
AWA14560.1|46901_47174_-	hypothetical protein	NA	NA	NA	NA	NA
AWA14561.1|47192_47372_+	hypothetical protein	NA	NA	NA	NA	NA
AWA14562.1|47301_48141_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AWA14563.1|48134_48482_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AWA14564.1|48687_49476_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
AWA14667.1|49606_50080_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
AWA14565.1|50237_51251_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AWA14566.1|51189_51744_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AWA14567.1|51780_52485_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 2
CP028587	Escherichia coli strain WCHEC4533 plasmid pCTXM15_000533, complete sequence	150853	57338	88640	150853	transposase,protease	Escherichia_phage(37.5%)	35	NA	NA
AWA14570.1|57338_58043_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWA14571.1|59236_59779_-	tunicamycin resistance protein	NA	NA	NA	NA	NA
AWA14572.1|59791_60652_-	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
AWA14573.1|60758_61463_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWA14668.1|62094_62925_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
AWA14669.1|63055_63610_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
AWA14574.1|63753_64458_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWA14575.1|65059_65665_-	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
AWA14576.1|65759_68657_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
AWA14577.1|68692_68797_-	hypothetical protein	NA	NA	NA	NA	NA
AWA14578.1|68793_69258_-	mRNA interferase PemK	NA	NA	NA	NA	NA
AWA14579.1|69477_70131_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AWA14580.1|70320_70707_-	hypothetical protein	NA	NA	NA	NA	NA
AWA14581.1|71069_71927_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AWA14670.1|71919_71994_-	positive regulator of RepFIC repA1 expression	NA	NA	NA	NA	NA
AWA14582.1|72077_72188_+	replication protein RepA	NA	NA	NA	NA	NA
AWA14583.1|72228_72486_-	replication protein RepA	NA	NA	NA	NA	NA
AWA14584.1|72890_73913_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AWA14585.1|74384_74738_+	hypothetical protein	NA	NA	NA	NA	NA
AWA14586.1|75150_75729_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
AWA14587.1|76567_76930_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	88.5	9.0e-34
AWA14588.1|76926_77277_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
AWA14589.1|77307_77529_+	hypothetical protein	NA	NA	NA	NA	NA
AWA14590.1|77885_78365_-	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
AWA14591.1|78445_79849_-	YfcC family protein	NA	NA	NA	NA	NA
AWA14592.1|79896_80901_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
AWA14593.1|80985_81897_-	carbamate kinase	NA	NA	NA	NA	NA
AWA14594.1|81907_83128_-	arginine deiminase	NA	NA	NA	NA	NA
AWA14671.1|84887_84962_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
AWA14595.1|85045_85162_+	replication protein RepA	NA	NA	NA	NA	NA
AWA14596.1|85197_85455_-	transcriptional regulator	NA	NA	NA	NA	NA
AWA14672.1|85738_85888_-	Hok/Gef family protein	NA	NA	NA	NA	NA
AWA14597.1|85943_86186_+	hypothetical protein	NA	NA	NA	NA	NA
AWA14598.1|86131_86365_-	hypothetical protein	NA	NA	NA	NA	NA
AWA14599.1|87068_88640_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
>prophage 1
CP028588	Escherichia coli strain WCHEC4533 plasmid pNDM4_000533, complete sequence	42856	11804	19910	42856	transposase	Stx2-converting_phage(42.86%)	8	NA	NA
AWA14715.1|11804_12182_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	90.5	3.2e-58
AWA14685.1|12178_12526_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	96.5	1.8e-60
AWA14686.1|12576_14115_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	90.8	2.8e-270
AWA14687.1|14231_15440_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AWA14688.1|15473_16907_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	51.5	4.1e-106
AWA14689.1|17055_17752_+|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	93.5	1.5e-125
AWA14690.1|17990_18743_+	hypothetical protein	NA	NA	NA	NA	NA
AWA14691.1|18986_19910_+|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	6.6e-174
