The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP022229	Escherichia coli strain WCHEC96200 chromosome, complete genome	5051244	371373	434650	5051244	capsid,terminase,transposase,tail,portal,lysis,head	Enterobacteria_phage(42.59%)	84	NA	NA
AXN83592.1|371373_373800_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.7e-213
AXN83593.1|373998_374304_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AXN87872.1|374411_375122_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
AXN83594.1|375124_375685_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AXN83595.1|375719_376061_-	DUF1283 family protein	NA	NA	NA	NA	NA
AXN83596.1|376195_376522_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.2e-23
AXN83597.1|376558_376747_+	hypothetical protein	NA	NA	NA	NA	NA
AXN83598.1|376727_377942_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AXN83599.1|377953_378973_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
AXN83600.1|379030_379159_+	transporter	NA	NA	NA	NA	NA
AXN83601.1|379160_380456_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.6	5.1e-156
AXN83602.1|380496_382068_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	3.2e-168
AXN83603.1|382087_382435_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AXN83604.1|382434_383112_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AXN83605.1|383088_383190_+	copper resistance protein	NA	NA	NA	NA	NA
AXN83606.1|383182_383434_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AXN83607.1|383506_385978_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	1.2e-57
AXN83608.1|386071_386263_-	DUF1482 family protein	NA	NA	NA	NA	NA
AXN83609.1|386259_386448_-	division inhibition protein DicB	NA	NA	NA	NA	NA
AXN83610.1|386934_387552_-	hypothetical protein	NA	NA	NA	NA	NA
AXN83611.1|387511_387667_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
AXN83612.1|387835_388243_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
AXN83613.1|388323_388551_+	transcriptional regulator	NA	NA	NA	NA	NA
AXN83614.1|388534_389056_+	hypothetical protein	NA	NA	NA	NA	NA
AXN83615.1|388982_390002_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.8e-56
AXN83616.1|390042_390441_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.9	7.7e-63
AXN83617.1|390643_391309_+	hypothetical protein	NA	NA	NA	NA	NA
AXN83618.1|391517_392132_+	hypothetical protein	NA	NA	NA	NA	NA
AXN83619.1|392128_393157_+	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
AXN83620.1|393640_394954_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AXN83621.1|394998_395121_+	plasmid mobilization protein	NA	NA	NA	NA	NA
AXN83622.1|395390_395723_-	protein FlxA	NA	NA	NA	NA	NA
AXN83623.1|395925_396231_-	hypothetical protein	NA	NA	NA	NA	NA
AXN83624.1|396255_396495_+	antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
AXN83625.1|396494_396782_+	mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
AXN83626.1|396853_397009_+	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
AXN83627.1|397225_397477_+	hypothetical protein	NA	NA	NA	NA	NA
AXN83628.1|397543_397822_+	hypothetical protein	NA	NA	NA	NA	NA
AXN83629.1|397823_398873_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.0	2.8e-112
AXN83630.1|398886_399639_+	antitermination protein Q	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
AXN83631.1|400060_400273_-	cold-shock protein CspF	NA	NA	NA	NA	NA
AXN83632.1|400573_400789_+	cold-shock protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
AXN83633.1|401037_401283_+	hypothetical protein	NA	NA	NA	NA	NA
AXN83634.1|401188_401698_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
AXN83635.1|402254_402470_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
AXN83636.1|402474_402786_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
AXN83637.1|402782_403316_+	lysozyme from lambdoid prophage Qin	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
AXN83638.1|403312_403810_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
AXN83639.1|404172_404385_+	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AXN83640.1|404395_404584_+	cold-shock protein	NA	NA	NA	NA	NA
AXN83641.1|404614_404887_+	hypothetical protein	NA	NA	NA	NA	NA
AXN83642.1|405058_405232_+	protein GnsB	NA	NA	NA	NA	NA
AXN83643.1|405383_405794_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
AXN83644.1|405851_406085_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
AXN83645.1|406232_406334_+	hypothetical protein	NA	NA	NA	NA	NA
AXN83646.1|406473_407019_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
AXN83647.1|406993_408919_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
AXN83648.1|408915_409122_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AXN83649.1|409118_410720_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
AXN83650.1|410700_412020_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	2.2e-231
AXN83651.1|412029_412362_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
AXN83652.1|412416_413442_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	99.7	2.7e-192
AXN83653.1|413483_413882_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	2.3e-62
AXN83654.1|413893_414247_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
AXN83655.1|414258_414837_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
AXN83656.1|414833_415229_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
AXN87873.1|415236_415977_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
AXN83657.1|415992_416415_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
AXN83658.1|416396_416831_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AXN83659.1|416823_419385_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	96.0	0.0e+00
AXN83660.1|419381_419711_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
AXN83661.1|419710_420409_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	8.9e-131
AXN83662.1|420414_421158_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	9.5e-147
AXN83663.1|421055_421697_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.5	1.1e-95
AXN83664.1|421757_425237_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
AXN83665.1|425304_425904_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	91.5	9.8e-102
AXN83666.1|425968_428368_+|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	55.3	3.9e-133
AXN83667.1|428364_428646_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.2e-17
AXN83668.1|428655_429360_+|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	1.2e-58
AXN83669.1|429370_429664_+	hypothetical protein	NA	NA	NA	NA	NA
AXN83670.1|429891_430482_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AXN83671.1|430798_431032_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AXN83672.1|431817_433101_+	MFS transporter	NA	NA	NA	NA	NA
AXN83673.1|433189_434650_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.7	5.1e-43
>prophage 2
CP022229	Escherichia coli strain WCHEC96200 chromosome, complete genome	5051244	860398	918840	5051244	capsid,terminase,integrase,tRNA,tail,portal,lysis,holin,head	Escherichia_phage(35.85%)	76	868591:868605	918942:918956
AXN84045.1|860398_861505_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AXN87896.1|861540_862182_+	lysogenization protein HflD	NA	NA	NA	NA	NA
AXN84046.1|862185_863556_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
AXN84047.1|863725_864397_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AXN84048.1|864396_865857_+	sensor protein PhoQ	NA	NA	NA	NA	NA
AXN84049.1|865932_867054_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AXN84050.1|867102_868329_-	peptidase T	NA	NA	NA	NA	NA
AXN87897.1|868384_868600_+	hypothetical protein	NA	NA	NA	NA	NA
AXN84051.1|868578_869715_+	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
868591:868605	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
AXN84052.1|869698_870562_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
AXN84053.1|870793_871060_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.8	1.5e-17
AXN87898.1|871158_871785_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AXN84054.1|871729_871867_-|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AXN84055.1|871839_872424_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
AXN84056.1|872423_875450_-	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	54.6	1.4e-55
AXN84057.1|875601_876201_-	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
AXN84058.1|876268_879961_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	86.0	0.0e+00
AXN84059.1|880304_880985_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.9	3.7e-113
AXN84060.1|880882_881626_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
AXN84061.1|881636_882335_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	3.2e-128
AXN84062.1|882334_882664_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AXN84063.1|882660_885222_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.5	0.0e+00
AXN84064.1|885202_885616_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
AXN84065.1|885642_886074_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	1.8e-41
AXN84066.1|886087_886840_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	2.7e-133
AXN84067.1|886847_887243_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
AXN84068.1|887239_887815_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	56.8	1.6e-48
AXN84069.1|887830_888184_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
AXN84070.1|888176_888599_-	hypothetical protein	NA	NA	NA	NA	NA
AXN84071.1|888602_889631_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.9	4.1e-116
AXN84072.1|889688_890036_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	59.1	6.8e-23
AXN84073.1|890072_891578_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.1	1.0e-99
AXN84074.1|891567_893160_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	4.9e-185
AXN84075.1|893156_893363_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	55.4	3.0e-10
AXN84076.1|893346_895275_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	1.4e-261
AXN84077.1|895246_895756_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
AXN84078.1|895877_896057_-	DNA-packaging protein	NA	NA	NA	NA	NA
AXN84079.1|896030_896351_+	hypothetical protein	NA	NA	NA	NA	NA
AXN84080.1|896238_896592_+	hypothetical protein	NA	NA	NA	NA	NA
AXN84081.1|896714_897095_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	2.6e-39
AXN87899.1|897351_897819_-|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	84.4	6.7e-66
AXN84082.1|897967_898183_-	hypothetical protein	NA	NA	NA	NA	NA
AXN84083.1|898306_898840_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	6.7e-102
AXN84084.1|898876_899767_-	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	70.9	2.1e-108
AXN84085.1|899771_899987_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
AXN84086.1|900136_900298_-	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	89.1	1.6e-14
AXN84087.1|900294_900498_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	96.8	2.7e-27
AXN84088.1|900743_901079_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
AXN84089.1|901448_901781_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	93.4	7.0e-33
AXN84090.1|901858_902548_-	antiterminator	NA	I6PDF8	Cronobacter_phage	48.1	7.1e-56
AXN84091.1|902540_902909_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.8	2.4e-34
AXN84092.1|902909_903968_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.3	1.8e-90
AXN84093.1|903969_904248_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	45.3	6.3e-11
AXN84094.1|904314_904566_-	hypothetical protein	NA	NA	NA	NA	NA
AXN84095.1|904782_904938_-	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
AXN84096.1|905196_905376_-	hypothetical protein	NA	NA	NA	NA	NA
AXN84097.1|905496_906483_-	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	41.5	1.8e-44
AXN84098.1|906479_906845_-	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	99.2	1.9e-68
AXN84099.1|906846_907254_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	60.4	1.0e-22
AXN84100.1|907349_907706_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	1.1e-57
AXN84101.1|907683_908145_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	2.6e-38
AXN84102.1|908141_908438_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
AXN84103.1|908434_908842_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.6e-39
AXN84104.1|908842_909613_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.4	1.1e-86
AXN84105.1|909646_910312_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.4e-79
AXN84106.1|911112_911664_-	hypothetical protein	NA	NA	NA	NA	NA
AXN84107.1|911647_911875_-	transcriptional regulator	NA	NA	NA	NA	NA
AXN84108.1|911951_912359_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
AXN87900.1|912565_912718_+	DUF1391 domain-containing protein	NA	NA	NA	NA	NA
AXN87901.1|912729_913104_+	hypothetical protein	NA	NA	NA	NA	NA
AXN84109.1|913634_914489_+	transcriptional regulator	NA	A0A0P0ZE80	Stx2-converting_phage	63.2	3.6e-65
AXN84110.1|914499_914688_+	cell division inhibitor	NA	NA	NA	NA	NA
AXN84111.1|914684_914888_+	DUF1482 family protein	NA	NA	NA	NA	NA
AXN84112.1|914965_917422_+	exonuclease	NA	V5UQJ3	Shigella_phage	42.6	2.5e-103
AXN84113.1|917483_917753_+	excisionase	NA	NA	NA	NA	NA
AXN84114.1|917721_918840_+|integrase	integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
918942:918956	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 3
CP022229	Escherichia coli strain WCHEC96200 chromosome, complete genome	5051244	1279988	1336190	5051244	capsid,transposase,terminase,integrase,protease,tail,portal,holin,head	Enterobacteria_phage(37.93%)	79	1302716:1302732	1344065:1344081
AXN84444.1|1279988_1280498_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
AXN84445.1|1280403_1280619_-	hypothetical protein	NA	NA	NA	NA	NA
AXN84446.1|1280635_1281340_-	BAX inhibitor (BI)-1/YccA family protein	NA	NA	NA	NA	NA
AXN84447.1|1281476_1281929_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
AXN84448.1|1281930_1282176_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
AXN84449.1|1282168_1282654_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
AXN84450.1|1282656_1283169_-	molybdenum cofactor biosynthesis protein	NA	NA	NA	NA	NA
AXN84451.1|1283190_1284180_-	cyclic pyranopterin monophosphate synthase	NA	NA	NA	NA	NA
AXN84452.1|1284576_1285485_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	30.7	3.2e-27
AXN84453.1|1285522_1287544_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AXN84454.1|1288122_1288800_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
AXN84455.1|1288792_1289548_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
AXN84456.1|1289534_1290689_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
AXN84457.1|1290685_1291726_-	biotin synthase	NA	NA	NA	NA	NA
AXN84458.1|1291812_1293102_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
AXN84459.1|1293160_1293637_+	kinase inhibitor	NA	NA	NA	NA	NA
AXN84460.1|1293551_1293731_+	hypothetical protein	NA	NA	NA	NA	NA
AXN84461.1|1294382_1295714_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
AXN87918.1|1295926_1296220_-	hypothetical protein	NA	NA	NA	NA	NA
AXN84462.1|1296262_1297303_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.9	2.9e-125
AXN84463.1|1297312_1297594_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	1.4e-18
AXN84464.1|1297593_1299966_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.0	1.8e-167
AXN84465.1|1300117_1300717_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	97.0	9.1e-108
AXN84466.1|1300784_1304264_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.8	0.0e+00
1302716:1302732	attL	CGGAAGATGGCAGCGTG	NA	NA	NA	NA
AXN84467.1|1304324_1304972_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
AXN84468.1|1304869_1305613_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	5.0e-148
AXN84469.1|1305618_1306317_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	7.6e-130
AXN84470.1|1306316_1306673_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
AXN84471.1|1306650_1309878_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.6	0.0e+00
AXN87919.1|1309924_1310185_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	96.5	1.7e-39
AXN84472.1|1310226_1310613_-|tail	phage tail protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
AXN84473.1|1310612_1311317_-|tail	phage tail protein	tail	A0A1B5FP82	Escherichia_phage	93.6	1.7e-113
AXN84474.1|1311377_1311722_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	2.3e-55
AXN84475.1|1311718_1312168_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.5	1.0e-63
AXN84476.1|1312164_1312503_-|head,tail	head-tail adaptor protein	head,tail	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
AXN84477.1|1312511_1312829_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	6.2e-23
AXN84478.1|1312905_1314123_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.4	1.7e-161
AXN84479.1|1314137_1314737_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
AXN84480.1|1314729_1315956_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	82.8	3.1e-203
AXN84481.1|1316103_1317861_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
AXN84482.1|1317860_1318343_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	4.3e-84
AXN84483.1|1318490_1318841_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	1.4e-63
AXN84484.1|1318979_1319519_+	hypothetical protein	NA	NA	NA	NA	NA
AXN84485.1|1319524_1319791_-	hypothetical protein	NA	NA	NA	NA	NA
AXN84486.1|1320008_1320194_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
AXN84487.1|1320410_1320944_-	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	3.6e-100
AXN84488.1|1321007_1321358_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.9e-37
AXN84489.1|1321362_1321578_-|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
AXN84490.1|1321943_1322432_-	antiterminator	NA	M1FPN0	Enterobacteria_phage	100.0	5.3e-90
AXN84491.1|1322475_1323087_-	recombination protein NinG	NA	Q716C3	Shigella_phage	100.0	2.7e-99
AXN84492.1|1323079_1323250_-	protein ninF	NA	Q8H9Z5	Enterobacteria_phage	96.4	3.5e-25
AXN87920.1|1323246_1323429_-	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	4.3e-29
AXN84493.1|1323425_1323884_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.6e-80
AXN84494.1|1323939_1324230_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
AXN84495.1|1324226_1324928_-	Replication protein P	NA	A0A0K2FIT1	Enterobacteria_phage	99.1	6.4e-129
AXN84496.1|1324924_1325824_-	Replication protein O	NA	A0A0K2FJ31	Enterobacteria_phage	100.0	3.8e-174
AXN84497.1|1325856_1326153_-	hypothetical protein	NA	A0A1U9AJB5	Stx1_converting_phage	98.0	1.5e-47
AXN84498.1|1326291_1326519_-	DNA-binding protein	NA	G9L677	Escherichia_phage	98.7	1.7e-35
AXN84499.1|1326598_1327306_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	99.6	4.3e-133
AXN84500.1|1327429_1327750_+	hypothetical protein	NA	NA	NA	NA	NA
AXN84501.1|1327749_1328433_+	DUF1640 domain-containing protein	NA	NA	NA	NA	NA
AXN84502.1|1328883_1329156_+	antitermination protein N	NA	A0A0N7C217	Escherichia_phage	97.8	2.2e-40
AXN84503.1|1329284_1329485_+	restriction endonuclease	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	4.2e-33
AXN84504.1|1329606_1329882_+	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	100.0	1.6e-46
AXN84505.1|1329966_1330275_+	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	99.0	3.3e-53
AXN84506.1|1330271_1331183_+	DNA recombinase	NA	K7PKG9	Enterobacteria_phage	99.3	1.1e-168
AXN84507.1|1331166_1331649_+	hypothetical protein	NA	K7P6T5	Enterobacteria_phage	96.2	2.3e-77
AXN84508.1|1331660_1331975_+	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	100.0	1.2e-50
AXN84509.1|1331991_1332273_+	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	96.8	2.8e-43
AXN84510.1|1332269_1332437_+	DUF2737 family protein	NA	Q716F2	Shigella_phage	98.2	5.0e-24
AXN84511.1|1332433_1332688_+	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	95.2	3.2e-38
AXN84512.1|1332674_1333169_+	ead/Ea22-like family protein	NA	A0A0P0ZD75	Stx2-converting_phage	55.0	3.0e-24
AXN84513.1|1333341_1333530_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	93.5	2.9e-28
AXN87922.1|1333459_1333741_+	hypothetical protein	NA	Q9XJH3	Enterobacteria_phage	90.3	1.5e-44
AXN84514.1|1333737_1334616_+	DUF551 domain-containing protein	NA	A0A0H4IU61	Shigella_phage	53.4	6.7e-67
AXN87921.1|1334580_1334784_-	hypothetical protein	NA	NA	NA	NA	NA
AXN84515.1|1334716_1334884_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	4.9e-27
AXN84516.1|1334923_1335142_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
AXN84517.1|1335119_1336190_+|integrase	integrase	integrase	Q9MCR4	Enterobacteria_phage	99.4	9.6e-201
1344065:1344081	attR	CACGCTGCCATCTTCCG	NA	NA	NA	NA
>prophage 4
CP022229	Escherichia coli strain WCHEC96200 chromosome, complete genome	5051244	4174371	4181511	5051244		Escherichia_phage(83.33%)	6	NA	NA
AXN87048.1|4174371_4175010_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
AXN87049.1|4175006_4176269_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
AXN87050.1|4176265_4177174_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.1e-117
AXN87051.1|4177369_4178137_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
AXN87052.1|4178187_4178844_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	5.0e-51
AXN87053.1|4178949_4181511_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	9.2e-32
>prophage 5
CP022229	Escherichia coli strain WCHEC96200 chromosome, complete genome	5051244	4557282	4595263	5051244	capsid,terminase,portal,lysis,holin,head	Enterobacteria_phage(48.28%)	60	NA	NA
AXN87376.1|4557282_4557474_-	AlpA family transcriptional regulator	NA	E5E3Y1	Burkholderia_phage	49.0	4.2e-06
AXN88059.1|4557630_4558377_-	hypothetical protein	NA	NA	NA	NA	NA
AXN87377.1|4558378_4559665_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	37.3	1.1e-65
AXN87378.1|4559917_4560118_-	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
AXN87379.1|4560175_4560343_-	hypothetical protein	NA	K7P728	Enterobacteria_phage	92.7	9.2e-26
AXN87380.1|4560414_4560699_-	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	94.7	9.4e-47
AXN87381.1|4560691_4561483_-	DUF551 domain-containing protein	NA	A0A0H4IU61	Shigella_phage	51.8	1.0e-58
AXN87382.1|4561479_4561719_-	hypothetical protein	NA	Q9XJH3	Enterobacteria_phage	96.0	8.8e-38
AXN87383.1|4561690_4562383_-	ead/Ea22-like family protein	NA	A0A088CC42	Shigella_phage	55.4	1.2e-82
AXN87384.1|4562369_4562624_-	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	95.2	3.2e-38
AXN87385.1|4562620_4562788_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	98.2	5.0e-24
AXN87386.1|4562784_4563066_-	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	96.8	2.8e-43
AXN87387.1|4563082_4563397_-	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	100.0	1.2e-50
AXN87388.1|4563408_4563891_-	hypothetical protein	NA	K7P6T5	Enterobacteria_phage	97.5	6.1e-78
AXN87389.1|4563874_4564786_-	DNA recombinase	NA	K7PKG9	Enterobacteria_phage	98.7	2.4e-168
AXN87390.1|4564782_4565091_-	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	100.0	1.1e-53
AXN87391.1|4565175_4565328_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
AXN87392.1|4565312_4565447_-	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
AXN87393.1|4565673_4565874_-	restriction endonuclease	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
AXN87394.1|4565952_4566333_-	antitermination protein	NA	A4KWR0	Enterobacteria_phage	99.1	5.3e-53
AXN87395.1|4566582_4566987_-	hypothetical protein	NA	Q716D7	Shigella_phage	96.2	2.1e-68
AXN87396.1|4566983_4567616_-	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	99.5	1.6e-118
AXN87397.1|4567719_4567935_+	XRE family transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
AXN87398.1|4568054_4568348_+	hypothetical protein	NA	A5VW96	Enterobacteria_phage	100.0	1.7e-46
AXN87399.1|4568370_4568643_+	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
AXN87400.1|4568645_4569593_+	replication protein	NA	A5VW95	Enterobacteria_phage	98.4	5.1e-153
AXN87401.1|4569589_4570966_+	replicative DNA helicase	NA	A0A0P0ZC27	Stx2-converting_phage	99.8	1.6e-253
AXN87402.1|4571021_4571480_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.6e-80
AXN87403.1|4571476_4572004_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	1.2e-100
AXN87404.1|4572000_4572183_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	98.3	1.3e-28
AXN87405.1|4572179_4572350_+	protein ninF	NA	K7PLU6	Enterobacteria_phage	100.0	2.5e-26
AXN87406.1|4572342_4573065_+	DNA-binding protein	NA	K7P7L0	Enterobacteria_phage	97.5	1.1e-128
AXN87407.1|4573064_4573355_+	DUF1364 domain-containing protein	NA	Q9MCN9	Enterobacteria_phage	100.0	3.4e-52
AXN87408.1|4573351_4573876_+	HNH endonuclease	NA	K4F9R1	Cronobacter_phage	42.9	7.1e-32
AXN87409.1|4573876_4574239_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PJW5	Enterobacteria_phage	97.5	6.6e-61
AXN87410.1|4574235_4574424_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
AXN87411.1|4574420_4574939_+	DUF1133 family protein	NA	Q716B8	Shigella_phage	99.4	5.9e-95
AXN87412.1|4575056_4575287_-	hypothetical protein	NA	NA	NA	NA	NA
AXN87413.1|4575534_4575858_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
AXN87414.1|4575841_4576318_+	lysozyme	NA	A5VW81	Enterobacteria_phage	100.0	7.5e-89
AXN87415.1|4576314_4576782_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	95.5	1.5e-73
AXN87416.1|4576769_4576922_+	hypothetical protein	NA	Q716B2	Shigella_phage	94.0	3.1e-20
AXN88060.1|4577127_4577613_+	GIY-YIG nuclease family protein	NA	C6ZR70	Salmonella_phage	100.0	8.5e-88
AXN87417.1|4577861_4578104_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	3.7e-36
AXN87418.1|4578107_4578395_+	hypothetical protein	NA	I1TQD4	Pseudomonas_phage	33.3	1.3e-06
AXN87419.1|4578404_4578584_+	hypothetical protein	NA	Q9AZ02	Salmonella_phage	93.2	1.2e-23
AXN88061.1|4578607_4579030_+	ubiquitin carboxyl-hydrolase	NA	Q716H4	Shigella_phage	100.0	7.2e-75
AXN87420.1|4579026_4580439_+|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	99.8	5.8e-278
AXN87421.1|4580441_4582568_+|portal	portal protein	portal	Q9AYZ9	Salmonella_phage	99.6	0.0e+00
AXN87422.1|4582581_4583466_+|capsid	phage capsid protein	capsid	Q716H1	Shigella_phage	99.7	8.1e-145
AXN87423.1|4583477_4584749_+|head	head protein	head	Q9AYZ7	Salmonella_phage	99.5	7.3e-240
AXN87424.1|4584791_4584977_+	hypothetical protein	NA	Q716G9	Shigella_phage	100.0	2.7e-26
AXN87425.1|4584951_4585434_+	packaged DNA stabilization protein p27	NA	Q716G8	Shigella_phage	100.0	3.8e-88
AXN87426.1|4585442_4586861_+	hypothetical protein	NA	Q9AYZ4	Salmonella_phage	98.7	2.3e-274
AXN87427.1|4586860_4587814_+	hypothetical protein	NA	Q716G6	Shigella_phage	84.9	5.4e-94
AXN87428.1|4587813_4588269_+	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	97.4	2.8e-85
AXN87429.1|4588271_4588964_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	99.6	2.7e-111
AXN87430.1|4588973_4590305_+	acyltransferase	NA	A0A2D1GLX5	Escherichia_phage	98.2	5.5e-214
AXN87431.1|4590305_4592699_+	lytic transglycosylase domain-containing protein	NA	Q716G2	Shigella_phage	96.8	0.0e+00
AXN87432.1|4592863_4595263_+|head	phage head protein	head	A5VW57	Enterobacteria_phage	90.6	8.0e-78
>prophage 6
CP022229	Escherichia coli strain WCHEC96200 chromosome, complete genome	5051244	4842832	4852275	5051244		Enterobacteria_phage(85.71%)	10	NA	NA
AXN87655.1|4842832_4843759_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
AXN87656.1|4843763_4844495_+	ABC transporter permease	NA	NA	NA	NA	NA
AXN87657.1|4844475_4844583_-	protein YohO	NA	NA	NA	NA	NA
AXN87658.1|4844642_4845374_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
AXN87659.1|4845595_4847281_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
AXN87660.1|4847277_4847997_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AXN87661.1|4848043_4848514_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AXN87662.1|4848555_4849017_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AXN87663.1|4849141_4851142_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
AXN87664.1|4851138_4852275_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	2.5e-162
>prophage 7
CP022229	Escherichia coli strain WCHEC96200 chromosome, complete genome	5051244	4863714	4928801	5051244	capsid,transposase,terminase,integrase,tRNA,plate,tail,portal,lysis,holin,head	Escherichia_phage(41.3%)	75	4891608:4891634	4924487:4924513
AXN87667.1|4863714_4865748_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.3	2.3e-54
AXN87668.1|4865879_4866989_+	protein mrp	NA	NA	NA	NA	NA
AXN87669.1|4867251_4867533_+	DUF2574 family protein	NA	NA	NA	NA	NA
AXN87670.1|4867586_4867790_+	hypothetical protein	NA	NA	NA	NA	NA
AXN87671.1|4867695_4868205_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
AXN87672.1|4868539_4869082_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AXN87673.1|4869162_4869837_+	fimbrial assembly protein	NA	NA	NA	NA	NA
AXN87674.1|4869852_4872333_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AXN87675.1|4872348_4873383_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
AXN87676.1|4873464_4873803_-	nickel/cobalt homeostasis protein RcnB	NA	NA	NA	NA	NA
AXN87677.1|4874021_4874846_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
AXN87678.1|4874966_4875239_+	transcriptional regulator	NA	NA	NA	NA	NA
AXN87679.1|4875461_4876250_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
AXN87680.1|4876246_4877047_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AXN87681.1|4877111_4877930_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.1e-23
AXN87682.1|4877981_4878728_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AXN87683.1|4878701_4879667_-	sugar kinase	NA	NA	NA	NA	NA
AXN87684.1|4879663_4880668_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.7	4.4e-14
AXN87685.1|4880664_4881942_-	MFS transporter	NA	NA	NA	NA	NA
AXN87686.1|4882198_4883251_+	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
AXN87687.1|4883480_4884335_+	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
AXN87688.1|4885630_4886083_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
AXN87689.1|4886113_4886398_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
AXN87690.1|4886401_4887757_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
AXN87691.1|4887804_4888845_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
AXN87692.1|4888944_4889724_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AXN87693.1|4889805_4890705_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	4.8e-12
AXN87694.1|4891119_4891437_+	hypothetical protein	NA	NA	NA	NA	NA
AXN87695.1|4891424_4891616_+	hypothetical protein	NA	NA	NA	NA	NA
4891608:4891634	attL	AAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
AXN87696.1|4891713_4892727_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	98.8	2.7e-192
AXN87697.1|4892842_4893142_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
AXN87698.1|4893263_4893539_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	98.9	2.2e-48
AXN87699.1|4893716_4894217_+	replication protein B	NA	S4TTB7	Salmonella_phage	98.8	1.9e-90
AXN87700.1|4894280_4894505_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
AXN87701.1|4894504_4894807_+	hypothetical protein	NA	A0A0F7LCL4	Escherichia_phage	100.0	3.5e-47
AXN87702.1|4894806_4895031_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	98.6	3.8e-35
AXN87703.1|4895027_4895303_+	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	1.5e-44
AXN87704.1|4897638_4898790_+	DNA (cytosine-5-)-methyltransferase	NA	M1PSQ0	Streptococcus_phage	31.2	1.4e-32
AXN87705.1|4898740_4899733_-	hypothetical protein	NA	NA	NA	NA	NA
AXN87706.1|4899729_4901154_-	ATP-binding protein	NA	NA	NA	NA	NA
AXN87707.1|4901277_4901502_+	hypothetical protein	NA	M1TAP7	Escherichia_phage	94.3	8.6e-19
AXN87708.1|4901540_4902575_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	2.7e-200
AXN87709.1|4902574_4904347_-	oxidoreductase	NA	A0A0F7LCM8	Escherichia_phage	100.0	0.0e+00
AXN87710.1|4904520_4905375_+|capsid	capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	98.2	8.1e-134
AXN87711.1|4905433_4906507_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.2	2.5e-201
AXN87712.1|4906510_4907254_+|terminase	terminase	terminase	A0A0F7LDU4	Escherichia_phage	99.2	3.0e-124
AXN87713.1|4907353_4907863_+|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	100.0	8.6e-91
AXN87714.1|4907862_4908066_+|tail	phage tail protein	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
AXN87715.1|4908069_4908351_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
AXN87716.1|4908350_4908848_+	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
AXN87717.1|4908862_4909288_+	protein lysA	NA	U5N096	Enterobacteria_phage	95.7	2.3e-57
AXN87718.1|4909275_4909701_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	98.6	1.9e-67
AXN87719.1|4909672_4909846_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	91.2	9.8e-23
AXN87720.1|4909808_4910276_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	2.5e-81
AXN87721.1|4910268_4910721_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	98.0	1.5e-75
AXN87722.1|4910792_4911578_-	hypothetical protein	NA	NA	NA	NA	NA
AXN87723.1|4911661_4912297_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.5	1.2e-113
AXN87724.1|4912293_4912641_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
AXN87725.1|4912645_4913554_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	4.4e-162
AXN87726.1|4913546_4914077_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
AXN87727.1|4914087_4916109_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	64.5	2.7e-260
AXN87728.1|4916110_4916638_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	92.6	4.9e-89
AXN87729.1|4916859_4917453_+	lysogenic conversion protein	NA	Q858S7	Enterobacteria_phage	99.0	1.0e-106
AXN87730.1|4917782_4918973_+|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	9.0e-224
AXN87731.1|4918985_4919504_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	3.2e-93
AXN87732.1|4919560_4919836_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
AXN87733.1|4919868_4919988_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AXN87734.1|4919980_4922428_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.7	0.0e+00
AXN87735.1|4922442_4922922_+|tail	phage tail protein	tail	O64315	Escherichia_phage	98.1	9.6e-84
AXN87736.1|4922921_4924085_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	1.8e-205
AXN87737.1|4924130_4924385_+	DNA-binding transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	6.1e-45
AXN87738.1|4924657_4926019_-	U32 family peptidase	NA	Q6DW11	Phage_TP	99.2	1.6e-216
4924487:4924513	attR	AAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
AXN87739.1|4926166_4926499_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AXN87740.1|4926678_4927401_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
AXN87741.1|4927397_4928801_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	2.7e-33
>prophage 8
CP022229	Escherichia coli strain WCHEC96200 chromosome, complete genome	5051244	4976206	4983724	5051244		Escherichia_phage(42.86%)	8	NA	NA
AXN87776.1|4976206_4977601_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	7.5e-20
AXN87777.1|4977758_4978754_+	N-acetyl-alpha-D-glucosaminyl-diphospho-ditrans, octacis-undecaprenol 4-epimerase	NA	A0A1V0QG29	Shearwaterpox_virus	26.0	2.5e-09
AXN87778.1|4978985_4979879_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
AXN87779.1|4979915_4980179_-	hypothetical protein	NA	NA	NA	NA	NA
AXN87780.1|4980250_4981336_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	2.3e-101
AXN87781.1|4981335_4982235_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.1	1.7e-28
AXN87782.1|4982292_4983171_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	64.5	1.9e-106
AXN87783.1|4983175_4983724_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.4	4.4e-48
>prophage 1
CP022228	Escherichia coli strain WCHEC96200 plasmid p1_000200, complete sequence	92388	0	77439	92388	portal,transposase,head,tail,capsid,plate,integrase,terminase	Escherichia_phage(88.3%)	103	7314:7332	67848:67866
AXN83111.1|150_525_+	hypothetical protein	NA	A0A222YWB0	Escherichia_phage	93.5	2.8e-38
AXN83112.1|641_1850_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	92.8	8.6e-214
AXN83113.1|1956_3342_+	hypothetical protein	NA	A0A222YY44	Escherichia_phage	96.7	5.4e-236
AXN83114.1|3856_5089_+|portal	phage portal protein	portal	A0A222YXQ7	Escherichia_phage	100.0	9.6e-237
AXN83115.1|5102_6101_+|head	head processing protein	head	A0A222YWA7	Escherichia_phage	98.5	1.9e-179
AXN83116.1|6301_7264_+	lytic replication protein	NA	A0A222YXV1	Escherichia_phage	98.8	5.6e-176
7314:7332	attL	ATTTGTGTTAGAAAATTAA	NA	NA	NA	NA
AXN83117.1|7678_7903_+	host cell division inhibitor Icd-like protein	NA	A0A222YWB3	Escherichia_phage	100.0	8.8e-40
AXN83118.1|7902_8610_+	DNA-binding protein	NA	A0A222YXY0	Escherichia_phage	90.6	1.1e-115
AXN83119.1|8609_8807_+	hypothetical protein	NA	A0A222YWF5	Escherichia_phage	100.0	3.1e-33
AXN83120.1|8839_9325_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	100.0	3.3e-92
AXN83121.1|9476_16313_+	helicase SNF2	NA	A0A222YYH3	Escherichia_phage	98.9	0.0e+00
AXN83122.1|16349_16784_+	olxA	NA	A0A222YZ35	Escherichia_phage	93.8	2.1e-74
AXN83123.1|16786_17047_+	hypothetical protein	NA	A0A222YXI8	Escherichia_phage	98.8	3.1e-44
AXN83124.1|17381_17678_+	VRR-NUC domain-containing protein	NA	A0A222YXP1	Escherichia_phage	100.0	5.4e-53
AXN83125.1|17692_17893_+	hypothetical protein	NA	A0A222YWF9	Escherichia_phage	98.5	3.3e-30
AXN83215.1|17907_18189_+	hypothetical protein	NA	A0A222YW96	Escherichia_phage	95.7	3.2e-39
AXN83126.1|18302_19511_+	hypothetical protein	NA	A0A222YW83	Escherichia_phage	99.5	4.5e-231
AXN83127.1|20869_21055_-	hypothetical protein	NA	Q71T99	Escherichia_phage	100.0	1.5e-16
AXN83128.1|21870_22305_+	tellurite resistance protein	NA	A0A222YXQ0	Escherichia_phage	100.0	3.7e-74
AXN83129.1|22304_22469_+	DUF3927 domain-containing protein	NA	A0A222YXW5	Escherichia_phage	100.0	1.8e-18
AXN83216.1|23502_23694_+	hypothetical protein	NA	A0A222YWJ0	Escherichia_phage	100.0	3.2e-30
AXN83217.1|23900_24086_+	hypothetical protein	NA	Q5QBF3	Escherichia_phage	98.4	6.4e-28
AXN83130.1|24194_24587_+	late promoter activating protein	NA	NA	NA	NA	NA
AXN83218.1|24967_25948_+	DNA pacase A subunit	NA	NA	NA	NA	NA
AXN83131.1|25947_27456_+|terminase	terminase	terminase	Q5QBP2	Enterobacteria_phage	56.8	1.2e-161
AXN83219.1|27483_27723_-	hypothetical protein	NA	Q5QBE5	Escherichia_phage	96.4	1.4e-06
AXN83132.1|28915_29944_+|integrase	integrase	integrase	Q5XLQ5	Enterobacteria_phage	41.9	1.2e-59
AXN83133.1|30018_30363_+	hypothetical protein	NA	A0A222YYS6	Escherichia_phage	94.7	3.9e-55
AXN83134.1|30359_30836_+	hypothetical protein	NA	NA	NA	NA	NA
AXN83135.1|30832_31327_+	dUTP diphosphatase	NA	A0A222YYP1	Escherichia_phage	94.5	8.1e-86
AXN83136.1|31341_32004_+	DUF2829 domain-containing protein	NA	A0A1B0VBT1	Salmonella_phage	81.0	5.0e-99
AXN83137.1|32010_32778_+	hypothetical protein	NA	A0A222YXM9	Escherichia_phage	98.4	8.6e-135
AXN83138.1|32767_33862_+	hypothetical protein	NA	Q71T61	Escherichia_phage	32.7	1.3e-40
AXN83139.1|33897_34278_-	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	91.1	6.1e-57
AXN83140.1|34277_34499_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
AXN83141.1|34571_34961_-	DNA repair protein	NA	A0A077SK24	Escherichia_phage	95.3	3.5e-68
AXN83142.1|35084_35336_-	DNA polymerase III subunit theta	NA	A0A077SLL5	Escherichia_phage	97.6	1.6e-37
AXN83220.1|35338_35539_-	hypothetical protein	NA	NA	NA	NA	NA
AXN83143.1|35650_36421_-	hypothetical protein	NA	A0A1B0VDS6	Salmonella_phage	73.0	3.1e-116
AXN83144.1|36417_36726_-	hypothetical protein	NA	NA	NA	NA	NA
AXN83145.1|36725_37019_-	hypothetical protein	NA	A0A077SK23	Escherichia_phage	93.8	9.7e-47
AXN83221.1|37031_37448_-	hypothetical protein	NA	A0A076G6X8	Escherichia_phage	61.2	1.8e-25
AXN83146.1|37733_37994_-	eaa protein	NA	A0A077SLR0	Escherichia_phage	98.8	8.4e-42
AXN83147.1|37990_38680_-	DUF551 domain-containing protein	NA	A0A2D1GLX9	Escherichia_phage	89.9	2.9e-113
AXN83148.1|38676_38958_-	hypothetical protein	NA	Q9XJH3	Enterobacteria_phage	90.3	2.5e-44
AXN83149.1|38887_39076_-	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	98.4	1.4e-30
AXN83150.1|39421_39868_-	ead/Ea22-like family protein	NA	A0A222YWN7	Escherichia_phage	82.4	7.4e-38
AXN83151.1|39864_40485_-	ead/Ea22-like family protein	NA	A0A222YY85	Escherichia_phage	79.7	2.6e-25
AXN83152.1|40481_40673_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	81.4	3.1e-17
AXN83153.1|40669_40756_-	DUF4752 family protein	NA	NA	NA	NA	NA
AXN83154.1|40769_41765_-	DUF968 domain-containing protein	NA	A0A222YWL6	Escherichia_phage	97.6	6.2e-194
AXN83155.1|41861_42530_-	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	87.7	8.6e-115
AXN83156.1|42566_43775_-|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	94.0	3.4e-210
AXN83157.1|43886_44198_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	99.0	1.8e-59
AXN83158.1|44194_44419_-	hypothetical protein	NA	A0A222YYR6	Escherichia_phage	94.6	2.5e-34
AXN83159.1|44396_44690_-	DUF4752 family protein	NA	A0A222YWQ2	Escherichia_phage	86.5	1.0e-35
AXN83160.1|44686_44935_-	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	84.8	3.5e-29
AXN83161.1|44931_45573_-	hypothetical protein	NA	A0A222YWM9	Escherichia_phage	90.0	8.6e-104
AXN83162.1|45569_46079_-	hypothetical protein	NA	E7C9P6	Salmonella_phage	66.0	1.7e-38
AXN83222.1|46068_46353_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	96.8	5.2e-45
AXN83163.1|46382_47006_-	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	82.8	5.8e-89
AXN83164.1|47278_47857_+	recombinase	NA	A0A222YXV2	Escherichia_phage	96.9	6.4e-74
AXN83165.1|48529_48649_+	hypothetical protein	NA	NA	NA	NA	NA
AXN83166.1|48667_48883_+	host cell division inhibitor Icd-like protein	NA	A0A222YWG3	Escherichia_phage	98.6	7.4e-36
AXN83167.1|48882_49809_+	Rha family transcriptional regulator	NA	A0A222YWG0	Escherichia_phage	84.3	3.7e-148
AXN83168.1|49868_50180_+	transcriptional regulator	NA	A0A222YY28	Escherichia_phage	83.0	1.0e-33
AXN83223.1|50176_50404_-	hypothetical protein	NA	NA	NA	NA	NA
AXN83169.1|50589_51198_-	hypothetical protein	NA	NA	NA	NA	NA
AXN83170.1|51481_52135_+	maturation control protein	NA	A0A222YZ79	Escherichia_phage	99.5	4.9e-115
AXN83171.1|52471_52753_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2L1IV28	Escherichia_phage	45.2	7.5e-20
AXN83172.1|52761_53043_+	addiction module antidote protein, HigA family	NA	I6ZVM3	Aeromonas_phage	44.7	1.3e-08
AXN83173.1|53135_53465_+|plate	baseplate protein	plate	A0A222YYR0	Escherichia_phage	100.0	3.6e-58
AXN83174.1|53457_54651_+|tail	phage tail protein	tail	A0A222YXT1	Escherichia_phage	96.5	1.3e-198
AXN83175.1|54684_55413_-	hypothetical protein	NA	A0A222YY57	Escherichia_phage	58.3	1.2e-72
AXN83176.1|55434_55635_-	hypothetical protein	NA	A0A222YXG1	Escherichia_phage	90.8	8.1e-29
AXN83177.1|55691_56030_-	addiction module antidote protein, HigA family	NA	A0A222YWD7	Escherichia_phage	100.0	1.3e-55
AXN83178.1|56100_56403_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	100.0	5.9e-55
AXN83179.1|56565_57357_+|tail	phage tail protein	tail	A0A222YXU3	Escherichia_phage	98.5	2.8e-149
AXN83180.1|57353_58121_+|plate	baseplate	plate	A0A222YWF4	Escherichia_phage	100.0	4.4e-139
AXN83181.1|58124_59105_+|tail	tail length tape measure protein	tail	A0A222YXZ0	Escherichia_phage	99.7	9.5e-187
AXN83182.1|59101_59755_+|plate	baseplate protein	plate	A0A222YWF1	Escherichia_phage	93.5	1.3e-94
AXN83183.1|59814_60720_+	recombination-associated protein RdgC	NA	A0A222YY21	Escherichia_phage	98.0	3.9e-163
AXN83184.1|60703_61384_+	hypothetical protein	NA	A0A222YXN3	Escherichia_phage	100.0	5.8e-135
AXN83185.1|61376_62282_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A222YYM0	Escherichia_phage	95.3	5.9e-167
AXN83186.1|62426_62711_-	hypothetical protein	NA	A0A222YZA7	Escherichia_phage	76.8	5.6e-31
AXN83187.1|62703_63345_-	cobyrinic acid ac-diamide synthase	NA	A0A222YXS3	Escherichia_phage	93.0	4.0e-109
AXN83188.1|63623_63962_-	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	96.4	8.3e-50
AXN83189.1|63974_64931_-	recombinase	NA	A0A222YXF2	Escherichia_phage	99.7	1.7e-180
AXN83190.1|65197_65482_+	alanine racemase	NA	A0A222YXW1	Escherichia_phage	81.9	8.9e-37
AXN83191.1|65481_66285_+	hypothetical protein	NA	A0A222YXK1	Escherichia_phage	84.0	1.4e-100
AXN83192.1|66355_66814_+	hypothetical protein	NA	A0A222YWG1	Escherichia_phage	94.7	4.7e-64
AXN83193.1|66967_67426_-	hypothetical protein	NA	A0A222YWJ4	Escherichia_phage	98.7	2.3e-87
AXN83224.1|67444_67837_-	hypothetical protein	NA	A0A222YXX4	Escherichia_phage	97.7	5.6e-66
AXN83194.1|67995_69693_+|capsid	capsid protein	capsid	A0A222YWC7	Escherichia_phage	97.3	0.0e+00
67848:67866	attR	ATTTGTGTTAGAAAATTAA	NA	NA	NA	NA
AXN83195.1|69840_70119_+	hypothetical protein	NA	A0A222YWH8	Escherichia_phage	96.7	1.1e-39
AXN83196.1|70186_71845_+|tail	phage tail protein	tail	A0A222YWC8	Escherichia_phage	98.0	1.4e-304
AXN83197.1|71888_72623_+	hypothetical protein	NA	A0A222YXT7	Escherichia_phage	100.0	5.9e-125
AXN83198.1|72690_73263_+	hypothetical protein	NA	A0A222YY02	Escherichia_phage	98.9	6.7e-100
AXN83199.1|73271_73763_+|plate	baseplate protein	plate	A0A222YWE4	Escherichia_phage	100.0	3.5e-89
AXN83200.1|73817_74369_+	hypothetical protein	NA	A0A222YWE3	Escherichia_phage	98.9	1.3e-97
AXN83201.1|74384_75092_+|tail	phage tail protein	tail	A0A222YY05	Escherichia_phage	100.0	1.0e-126
AXN83202.1|75473_76229_-	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	100.0	3.7e-138
AXN83203.1|76617_77439_+	hypothetical protein	NA	A0A222YZ63	Escherichia_phage	98.9	8.5e-157
>prophage 2
CP022228	Escherichia coli strain WCHEC96200 plasmid p1_000200, complete sequence	92388	81745	90609	92388	plate,tail,lysis,holin	Escherichia_phage(75.0%)	12	NA	NA
AXN83204.1|81745_82120_+	hypothetical protein	NA	A0A222YXD0	Escherichia_phage	97.6	1.7e-64
AXN83205.1|82116_83547_+|plate	baseplate protein	plate	A0A222YWB2	Escherichia_phage	98.7	2.2e-269
AXN83206.1|83557_84403_+|tail	phage tail protein	tail	A0A222YWB7	Escherichia_phage	98.2	3.0e-157
AXN83225.1|84794_84944_+|tail	phage tail protein	tail	A0A222YXS1	Escherichia_phage	98.0	7.9e-21
AXN83207.1|84946_86833_+	hypothetical protein	NA	A0A222YWB9	Escherichia_phage	53.0	6.4e-107
AXN83208.1|86832_87447_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.5	1.7e-61
AXN83209.1|87453_87927_-|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	52.4	8.1e-35
AXN83210.1|87937_88378_-	hypothetical protein	NA	K7PH60	Enterobacterial_phage	54.9	3.5e-40
AXN83211.1|88437_89010_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
AXN83212.1|89226_89553_+|holin	holin	holin	A0A222YZ46	Escherichia_phage	99.1	9.5e-51
AXN83213.1|89552_89999_+|lysis	lysis protein	lysis	A0A222YXP5	Escherichia_phage	100.0	9.2e-81
AXN83214.1|89988_90609_+	hypothetical protein	NA	A0A222YXB2	Escherichia_phage	95.1	8.1e-75
>prophage 1
CP022226	Escherichia coli strain WCHEC96200 plasmid pNDM4_WCHEC96200, complete sequence	45476	11277	19383	45476	transposase	Stx2-converting_phage(42.86%)	8	NA	NA
AXN82944.1|11277_11655_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	90.5	3.2e-58
AXN82912.1|11651_11999_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	96.5	1.8e-60
AXN82913.1|12049_13588_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	90.8	2.8e-270
AXN82914.1|13704_14913_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AXN82915.1|14946_16380_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	51.5	4.1e-106
AXN82916.1|16528_17225_+|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	93.5	1.5e-125
AXN82917.1|17463_18216_+	hypothetical protein	NA	NA	NA	NA	NA
AXN82918.1|18459_19383_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	6.6e-174
>prophage 1
CP022227	Escherichia coli strain WCHEC96200 plasmid pOXA1_WCHEC96200, complete sequence	150853	10495	52485	150853	transposase,integrase	Escherichia_phage(50.0%)	50	NA	NA
AXN82953.1|10495_11518_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
AXN82954.1|12597_12972_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	9.8e-60
AXN82955.1|12996_13701_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXN83099.1|14327_14885_+	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AXN82956.1|15026_15608_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXN82957.1|15612_15951_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AXN82958.1|15980_16310_-	thioredoxin	NA	V9SJ74	Achromobacter_phage	34.7	1.3e-10
AXN82959.1|16523_17630_+	alkene reductase	NA	NA	NA	NA	NA
AXN82960.1|17695_18064_+	hypothetical protein	NA	NA	NA	NA	NA
AXN82961.1|18009_18714_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXN82962.1|19596_19860_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AXN82963.1|19852_20239_+	amino acid-binding protein	NA	NA	NA	NA	NA
AXN82964.1|20246_20933_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AXN82965.1|20910_21537_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AXN82966.1|21615_22821_+	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
AXN82967.1|23811_23994_-	hypothetical protein	NA	NA	NA	NA	NA
AXN82968.1|23946_24174_+	scsC protein	NA	NA	NA	NA	NA
AXN82969.1|24163_24670_+	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
AXN82970.1|24852_25668_+	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
AXN82971.1|25826_26012_+	hypothetical protein	NA	NA	NA	NA	NA
AXN82972.1|25954_27901_+	FTR1 family iron permease	NA	NA	NA	NA	NA
AXN82973.1|27941_28469_+	iron transporter	NA	NA	NA	NA	NA
AXN82974.1|28572_29952_+	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
AXN82975.1|29954_31238_+	ABC transporter permease	NA	NA	NA	NA	NA
AXN82976.1|31197_32358_+	ABC transporter permease	NA	NA	NA	NA	NA
AXN82977.1|32362_33058_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
AXN82978.1|32975_33530_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
AXN82979.1|33554_34040_+	hypothetical protein	NA	NA	NA	NA	NA
AXN82980.1|34161_34905_+	histidine-type phosphatase	NA	NA	NA	NA	NA
AXN82981.1|35325_36330_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AXN82982.1|36769_37522_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXN82983.1|37763_38636_+	DMT family transporter	NA	NA	NA	NA	NA
AXN82984.1|38766_39990_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AXN82985.1|40175_40949_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
AXN82986.1|41525_42230_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXN82987.1|42708_43065_-	hypothetical protein	NA	NA	NA	NA	NA
AXN82988.1|43010_43595_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AXN82989.1|43594_44833_-	MFS transporter	NA	NA	NA	NA	NA
AXN82990.1|44829_45735_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AXN82991.1|45856_46561_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AXN82992.1|46537_46720_+	hypothetical protein	NA	NA	NA	NA	NA
AXN82993.1|46901_47174_-	hypothetical protein	NA	NA	NA	NA	NA
AXN82994.1|47192_47372_+	hypothetical protein	NA	NA	NA	NA	NA
AXN82995.1|47301_48141_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AXN82996.1|48134_48482_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AXN82997.1|48687_49476_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
AXN83100.1|49606_50080_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
AXN82998.1|50237_51251_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AXN82999.1|51189_51744_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AXN83000.1|51780_52485_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 2
CP022227	Escherichia coli strain WCHEC96200 plasmid pOXA1_WCHEC96200, complete sequence	150853	57338	88640	150853	protease,transposase	Escherichia_phage(37.5%)	35	NA	NA
AXN83003.1|57338_58043_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXN83004.1|59236_59779_-	tunicamycin resistance protein	NA	NA	NA	NA	NA
AXN83005.1|59791_60652_-	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
AXN83006.1|60758_61463_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXN83101.1|62094_62925_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
AXN83102.1|63055_63610_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
AXN83007.1|63753_64458_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXN83008.1|65059_65665_-	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
AXN83009.1|65759_68657_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
AXN83010.1|68692_68797_-	hypothetical protein	NA	NA	NA	NA	NA
AXN83011.1|68793_69258_-	mRNA interferase PemK	NA	NA	NA	NA	NA
AXN83012.1|69477_70131_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AXN83013.1|70320_70707_-	hypothetical protein	NA	NA	NA	NA	NA
AXN83014.1|71069_71927_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AXN83103.1|71919_71994_-	positive regulator of RepFIC repA1 expression	NA	NA	NA	NA	NA
AXN83015.1|72077_72188_+	replication protein RepA	NA	NA	NA	NA	NA
AXN83016.1|72228_72486_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
AXN83017.1|72890_73913_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AXN83018.1|74384_74738_+	hypothetical protein	NA	NA	NA	NA	NA
AXN83019.1|75150_75729_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
AXN83020.1|76567_76930_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	88.5	9.0e-34
AXN83021.1|76926_77277_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
AXN83022.1|77307_77529_+	hypothetical protein	NA	NA	NA	NA	NA
AXN83023.1|77885_78365_-	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
AXN83024.1|78445_79849_-	YfcC family protein	NA	NA	NA	NA	NA
AXN83025.1|79896_80901_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
AXN83026.1|80985_81897_-	carbamate kinase	NA	NA	NA	NA	NA
AXN83027.1|81907_83128_-	arginine deiminase	NA	NA	NA	NA	NA
AXN83104.1|84887_84962_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
AXN83028.1|85045_85162_+	replication protein RepA	NA	NA	NA	NA	NA
AXN83029.1|85197_85455_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
AXN83105.1|85738_85888_-	Hok/Gef family protein	NA	NA	NA	NA	NA
AXN83030.1|85943_86186_+	hypothetical protein	NA	NA	NA	NA	NA
AXN83031.1|86131_86365_-	hypothetical protein	NA	NA	NA	NA	NA
AXN83032.1|87068_88640_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
