The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032879	Escherichia coli strain WCHEC000837 chromosome, complete genome	5094619	351671	414948	5094619	tail,head,capsid,portal,transposase,terminase,lysis	Enterobacteria_phage(42.59%)	81	NA	NA
AYL08686.1|351671_353132_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.7	5.1e-43
AYL08687.1|353220_354504_-	MFS transporter	NA	NA	NA	NA	NA
AYL08688.1|355289_355523_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AYL08689.1|355839_356430_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AYL08690.1|356657_356951_-	hypothetical protein	NA	NA	NA	NA	NA
AYL08691.1|356961_357666_-|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	1.2e-58
AYL08692.1|357675_357957_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.2e-17
AYL08693.1|357953_360353_-|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	55.3	3.9e-133
AYL08694.1|360417_361017_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	91.5	9.8e-102
AYL08695.1|361084_364564_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
AYL08696.1|364624_365266_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.5	1.1e-95
AYL08697.1|365163_365907_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	9.5e-147
AYL08698.1|365912_366611_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	8.9e-131
AYL08699.1|366610_366940_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
AYL08700.1|366936_369498_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	95.9	0.0e+00
AYL08701.1|369490_369925_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AYL08702.1|369906_370329_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
AYL12967.1|370344_371085_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
AYL08703.1|371092_371488_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
AYL08704.1|371484_372063_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
AYL08705.1|372074_372428_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
AYL08706.1|372439_372838_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	2.3e-62
AYL08707.1|372879_373905_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	99.7	2.7e-192
AYL08708.1|373959_374292_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
AYL08709.1|374301_375621_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	2.2e-231
AYL08710.1|375601_377203_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
AYL08711.1|377199_377406_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AYL08712.1|377402_379328_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
AYL08713.1|379302_379848_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
AYL08714.1|380236_380470_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
AYL08715.1|380527_380938_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
AYL08716.1|381089_381263_-	protein GnsB	NA	NA	NA	NA	NA
AYL08717.1|381434_381707_-	hypothetical protein	NA	NA	NA	NA	NA
AYL08718.1|381737_381926_-	cold-shock protein	NA	NA	NA	NA	NA
AYL08719.1|381936_382149_-	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AYL08720.1|382511_383009_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
AYL08721.1|383005_383539_-	lysozyme from lambdoid prophage Qin	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
AYL08722.1|383535_383847_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
AYL08723.1|383851_384067_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
AYL08724.1|384623_385133_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
AYL08725.1|385038_385284_-	hypothetical protein	NA	NA	NA	NA	NA
AYL08726.1|385532_385748_-	cold-shock protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
AYL08727.1|386048_386261_+	cold-shock protein CspF	NA	NA	NA	NA	NA
AYL08728.1|386682_387435_-	antitermination protein Q	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
AYL08729.1|387448_388498_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.0	2.8e-112
AYL08730.1|388499_388778_-	hypothetical protein	NA	NA	NA	NA	NA
AYL08731.1|388844_389096_-	hypothetical protein	NA	NA	NA	NA	NA
AYL08732.1|389312_389468_-	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
AYL08733.1|389539_389827_-	mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
AYL08734.1|389826_390066_-	antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
AYL08735.1|390090_390396_+	hypothetical protein	NA	NA	NA	NA	NA
AYL08736.1|390598_390931_+	protein FlxA	NA	NA	NA	NA	NA
AYL08737.1|391367_392681_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AYL08738.1|393164_394193_-	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
AYL08739.1|394189_394804_-	hypothetical protein	NA	NA	NA	NA	NA
AYL08740.1|395012_395678_-	hypothetical protein	NA	NA	NA	NA	NA
AYL08741.1|395880_396279_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.9	7.7e-63
AYL08742.1|396319_397339_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.8e-56
AYL08743.1|397265_397787_-	hypothetical protein	NA	NA	NA	NA	NA
AYL08744.1|397770_397998_-	transcriptional regulator	NA	NA	NA	NA	NA
AYL08745.1|398078_398486_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
AYL08746.1|398654_398810_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
AYL08747.1|398769_399387_+	hypothetical protein	NA	NA	NA	NA	NA
AYL08748.1|399873_400062_+	division inhibition protein DicB	NA	NA	NA	NA	NA
AYL08749.1|400058_400250_+	DUF1482 family protein	NA	NA	NA	NA	NA
AYL08750.1|400343_402815_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	1.2e-57
AYL08751.1|402887_403139_+	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AYL08752.1|403131_403233_-	copper resistance protein	NA	NA	NA	NA	NA
AYL08753.1|403209_403887_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AYL08754.1|403886_404234_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AYL08755.1|404253_405825_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	3.2e-168
AYL08756.1|405865_407161_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.6	5.1e-156
AYL08757.1|407162_407291_-	transporter	NA	NA	NA	NA	NA
AYL08758.1|407348_408368_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
AYL08759.1|408379_409594_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AYL08760.1|409799_410126_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.2e-23
AYL08761.1|410260_410602_+	DUF1283 family protein	NA	NA	NA	NA	NA
AYL08762.1|410636_411197_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AYL12968.1|411199_411910_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
AYL08763.1|412017_412323_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AYL08764.1|412521_414948_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.7e-213
>prophage 2
CP032879	Escherichia coli strain WCHEC000837 chromosome, complete genome	5094619	901625	909143	5094619		Escherichia_phage(42.86%)	8	NA	NA
AYL09218.1|901625_902174_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.4	4.4e-48
AYL09219.1|902178_903057_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	64.5	1.9e-106
AYL09220.1|903114_904014_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.1	1.7e-28
AYL09221.1|904013_905099_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	2.3e-101
AYL09222.1|905170_905434_+	hypothetical protein	NA	NA	NA	NA	NA
AYL09223.1|905470_906364_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
AYL09224.1|906595_907591_-	N-acetyl-alpha-D-glucosaminyl-diphospho-ditrans, octacis-undecaprenol 4-epimerase	NA	A0A1V0QG29	Shearwaterpox_virus	26.0	2.5e-09
AYL09225.1|907748_909143_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	7.5e-20
>prophage 3
CP032879	Escherichia coli strain WCHEC000837 chromosome, complete genome	5094619	956548	1017654	5094619	tail,integrase,holin,plate,head,capsid,portal,transposase,terminase,lysis	Escherichia_phage(42.22%)	71	960837:960863	993716:993742
AYL09261.1|956548_957952_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	2.7e-33
AYL09262.1|957948_958671_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
AYL09263.1|958850_959183_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AYL09264.1|959330_960692_+	U32 family peptidase	NA	Q6DW11	Phage_TP	99.2	1.6e-216
960837:960863	attL	AATCTCCCTTACACGGGCTTATTTTTT	NA	NA	NA	NA
AYL09265.1|960964_961219_-	DNA-binding transcriptional regulator	NA	A0A0F7LDQ9	Escherichia_phage	100.0	6.1e-45
AYL09266.1|961264_962428_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	1.8e-205
AYL09267.1|962427_962907_-|tail	phage tail protein	tail	O64315	Escherichia_phage	98.1	9.6e-84
AYL09268.1|962921_965369_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.7	0.0e+00
AYL09269.1|965361_965481_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AYL09270.1|965513_965789_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
AYL09271.1|965845_966364_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	3.2e-93
AYL09272.1|966376_967567_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	9.0e-224
AYL09273.1|967896_968490_-	lysogenic conversion protein	NA	Q858S7	Enterobacteria_phage	99.0	1.0e-106
AYL09274.1|968711_969239_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	92.6	4.9e-89
AYL09275.1|969240_971262_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	64.5	2.7e-260
AYL09276.1|971272_971803_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
AYL09277.1|971795_972704_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	4.4e-162
AYL09278.1|972708_973056_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
AYL09279.1|973052_973688_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.5	1.2e-113
AYL09280.1|973771_974557_+	hypothetical protein	NA	NA	NA	NA	NA
AYL09281.1|974628_975081_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	98.0	1.5e-75
AYL09282.1|975073_975541_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	2.5e-81
AYL09283.1|975503_975677_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	91.2	9.8e-23
AYL09284.1|975648_976074_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	98.6	1.9e-67
AYL09285.1|976061_976487_-	protein lysA	NA	U5N096	Enterobacteria_phage	95.7	2.3e-57
AYL09286.1|976501_976999_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
AYL09287.1|976998_977280_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
AYL09288.1|977283_977487_-|tail	phage tail protein	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
AYL09289.1|977486_977996_-|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	100.0	8.6e-91
AYL09290.1|978095_978839_-|terminase	terminase	terminase	A0A0F7LDU4	Escherichia_phage	99.2	3.0e-124
AYL09291.1|978842_979916_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.2	2.5e-201
AYL09292.1|979974_980829_-|capsid	capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	98.2	8.1e-134
AYL09293.1|981002_982775_+	oxidoreductase	NA	A0A0F7LCM8	Escherichia_phage	100.0	0.0e+00
AYL09294.1|982774_983809_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	2.7e-200
AYL09295.1|983847_984072_-	hypothetical protein	NA	M1TAP7	Escherichia_phage	94.3	8.6e-19
AYL09296.1|984195_985620_+	ATP-binding protein	NA	NA	NA	NA	NA
AYL09297.1|985616_986609_+	hypothetical protein	NA	NA	NA	NA	NA
AYL09298.1|986559_987711_-	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	31.2	1.4e-32
AYL09299.1|990046_990322_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	1.5e-44
AYL09300.1|990318_990543_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	98.6	3.8e-35
AYL09301.1|990542_990845_-	hypothetical protein	NA	A0A0F7LCL4	Escherichia_phage	100.0	3.5e-47
AYL09302.1|990844_991069_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
AYL09303.1|991132_991633_-	replication protein B	NA	S4TTB7	Salmonella_phage	98.8	1.9e-90
AYL09304.1|991810_992086_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	98.9	2.2e-48
AYL09305.1|992207_992507_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
AYL09306.1|992622_993636_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	98.8	2.7e-192
AYL09307.1|993733_993925_-	hypothetical protein	NA	NA	NA	NA	NA
993716:993742	attR	AATCTCCCTTACACGGGCTTATTTTTT	NA	NA	NA	NA
AYL09308.1|993912_994230_-	hypothetical protein	NA	NA	NA	NA	NA
AYL09309.1|994644_995544_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	4.8e-12
AYL09310.1|995625_996405_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AYL09311.1|996504_997545_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
AYL09312.1|997592_998948_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
AYL09313.1|998951_999236_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
AYL09314.1|999266_999719_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
AYL09315.1|1001014_1001869_-	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
AYL09316.1|1002098_1003151_-	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
AYL09317.1|1003407_1004685_+	MFS transporter	NA	NA	NA	NA	NA
AYL09318.1|1004681_1005686_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.7	4.4e-14
AYL09319.1|1005682_1006648_+	sugar kinase	NA	NA	NA	NA	NA
AYL09320.1|1006621_1007368_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYL09321.1|1007419_1008238_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.1e-23
AYL09322.1|1008302_1009103_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AYL09323.1|1009099_1009888_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
AYL09324.1|1010110_1010383_-	transcriptional regulator	NA	NA	NA	NA	NA
AYL09325.1|1010503_1011328_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
AYL09326.1|1011546_1011885_+	nickel/cobalt homeostasis protein RcnB	NA	NA	NA	NA	NA
AYL09327.1|1011966_1013001_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
AYL09328.1|1013016_1015497_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AYL09329.1|1015512_1016187_-	fimbrial assembly protein	NA	NA	NA	NA	NA
AYL09330.1|1016267_1016810_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AYL09331.1|1017144_1017654_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
>prophage 4
CP032879	Escherichia coli strain WCHEC000837 chromosome, complete genome	5094619	1033074	1042517	5094619		Enterobacteria_phage(85.71%)	10	NA	NA
AYL09338.1|1033074_1034211_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	2.5e-162
AYL09339.1|1034207_1036208_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
AYL09340.1|1036332_1036794_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AYL09341.1|1036835_1037306_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AYL09342.1|1037352_1038072_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AYL09343.1|1038068_1039754_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
AYL09344.1|1039975_1040707_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
AYL09345.1|1040766_1040874_+	protein YohO	NA	NA	NA	NA	NA
AYL09346.1|1040854_1041586_-	ABC transporter permease	NA	NA	NA	NA	NA
AYL09347.1|1041590_1042517_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 5
CP032879	Escherichia coli strain WCHEC000837 chromosome, complete genome	5094619	1243266	1328067	5094619	terminase,holin,head,capsid,portal,lysis,tRNA,transposase	Enterobacteria_phage(46.15%)	106	NA	NA
AYL09517.1|1243266_1244169_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	44.2	2.4e-67
AYL09518.1|1244365_1245139_-	histidine transport ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
AYL09519.1|1245146_1245863_-	histidine ABC transporter permease	NA	NA	NA	NA	NA
AYL09520.1|1245859_1246546_-	histidine ABC transporter permease HisQ	NA	NA	NA	NA	NA
AYL09521.1|1246635_1247418_-	histidine ABC transporter substrate-binding protein HisJ	NA	NA	NA	NA	NA
AYL09522.1|1247638_1248421_-	lysine/arginine/ornithine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYL09523.1|1248686_1249256_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
AYL09524.1|1249350_1250868_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.5e-87
AYL09525.1|1250904_1251393_-	colicin V production protein	NA	NA	NA	NA	NA
AYL09526.1|1251651_1252302_-	cell division protein DedD	NA	NA	NA	NA	NA
AYL09527.1|1252291_1253560_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AYL09528.1|1253629_1254544_-	acetyl-CoA carboxylase carboxyl transferase subunit beta	NA	NA	NA	NA	NA
AYL09529.1|1254699_1255359_-	DedA family protein	NA	NA	NA	NA	NA
AYL09530.1|1255441_1256254_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AYL09531.1|1256253_1257267_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AYL09532.1|1257332_1258469_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	2.0e-23
AYL09533.1|1258567_1259563_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
AYL09534.1|1259559_1260738_-	arabinose transporter	NA	NA	NA	NA	NA
AYL09535.1|1261013_1262234_-	3-oxoacyl-ACP synthase I	NA	NA	NA	NA	NA
AYL09536.1|1262392_1264399_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AYL09537.1|1264454_1264733_-	YfcL family protein	NA	NA	NA	NA	NA
AYL09538.1|1264766_1265315_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AYL09539.1|1265314_1266124_-	hypothetical protein	NA	NA	NA	NA	NA
AYL09540.1|1266123_1266948_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AYL09541.1|1266951_1268037_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
AYL09542.1|1268071_1269004_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AYL09543.1|1269169_1269721_+	endonuclease SmrB	NA	NA	NA	NA	NA
AYL09544.1|1269790_1270654_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
AYL09545.1|1270655_1271201_-	fimbrial protein	NA	NA	NA	NA	NA
AYL09546.1|1271197_1271677_-	fimbrial protein	NA	NA	NA	NA	NA
AYL09547.1|1271673_1272165_-	hypothetical protein	NA	NA	NA	NA	NA
AYL09548.1|1272180_1272930_-	fimbrial protein	NA	NA	NA	NA	NA
AYL09549.1|1272949_1275589_-	outer membrane usher protein	NA	NA	NA	NA	NA
AYL09550.1|1275672_1276239_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AYL09551.1|1276900_1277386_-	phosphohistidine phosphatase	NA	NA	NA	NA	NA
AYL09552.1|1277588_1279733_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AYL09553.1|1279732_1281043_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AYL09554.1|1281223_1281508_-	DUF406 family protein	NA	NA	NA	NA	NA
AYL09555.1|1281879_1283220_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
AYL09556.1|1283585_1284833_+	hypothetical protein	NA	NA	NA	NA	NA
AYL09557.1|1285011_1285767_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AYL09558.1|1285792_1285963_-	hypothetical protein	NA	NA	NA	NA	NA
AYL09559.1|1286060_1286993_+	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
AYL09560.1|1287304_1288462_+	DUF4102 domain-containing protein	NA	A5VW56	Enterobacteria_phage	99.2	3.7e-222
AYL09561.1|1288578_1289271_-	hypothetical protein	NA	NA	NA	NA	NA
AYL09562.1|1289235_1289967_+	hypothetical protein	NA	NA	NA	NA	NA
AYL09563.1|1290086_1292486_-|head	phage head protein	head	A5VW57	Enterobacteria_phage	90.6	8.0e-78
AYL09564.1|1292650_1295044_-	lytic transglycosylase domain-containing protein	NA	Q716G2	Shigella_phage	96.8	0.0e+00
AYL09565.1|1295044_1296376_-	acyltransferase	NA	A0A2D1GLX5	Escherichia_phage	98.2	5.5e-214
AYL09566.1|1296385_1297078_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	99.6	2.7e-111
AYL09567.1|1297080_1297536_-	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	97.4	2.8e-85
AYL09568.1|1297535_1298489_-	hypothetical protein	NA	Q716G6	Shigella_phage	84.9	5.4e-94
AYL09569.1|1298488_1299907_-	hypothetical protein	NA	Q9AYZ4	Salmonella_phage	98.7	2.3e-274
AYL09570.1|1299915_1300398_-	packaged DNA stabilization protein p27	NA	Q716G8	Shigella_phage	100.0	3.8e-88
AYL09571.1|1300372_1300558_-	hypothetical protein	NA	Q716G9	Shigella_phage	100.0	2.7e-26
AYL09572.1|1300600_1301872_-|head	head protein	head	Q9AYZ7	Salmonella_phage	99.5	7.3e-240
AYL09573.1|1301883_1302768_-|capsid	phage capsid protein	capsid	Q716H1	Shigella_phage	99.7	8.1e-145
AYL09574.1|1302781_1304908_-|portal	portal protein	portal	Q9AYZ9	Salmonella_phage	99.6	0.0e+00
AYL09575.1|1304910_1306323_-|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	99.8	5.8e-278
AYL13003.1|1306319_1306742_-	ubiquitin carboxyl-hydrolase	NA	Q716H4	Shigella_phage	100.0	7.2e-75
AYL09576.1|1306765_1306945_-	hypothetical protein	NA	Q9AZ02	Salmonella_phage	93.2	1.2e-23
AYL09577.1|1306954_1307242_-	hypothetical protein	NA	I1TQD4	Pseudomonas_phage	33.3	1.3e-06
AYL09578.1|1307245_1307488_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	3.7e-36
AYL13004.1|1307736_1308222_-	GIY-YIG nuclease family protein	NA	C6ZR70	Salmonella_phage	100.0	8.5e-88
AYL09579.1|1308427_1308580_-	hypothetical protein	NA	Q716B2	Shigella_phage	94.0	3.1e-20
AYL09580.1|1308567_1309035_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	95.5	1.5e-73
AYL09581.1|1309031_1309508_-	lysozyme	NA	A5VW81	Enterobacteria_phage	100.0	7.5e-89
AYL09582.1|1309491_1309815_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
AYL09583.1|1310062_1310293_+	hypothetical protein	NA	NA	NA	NA	NA
AYL09584.1|1310410_1310929_-	DUF1133 family protein	NA	Q716B8	Shigella_phage	99.4	5.9e-95
AYL09585.1|1310925_1311114_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
AYL09586.1|1311110_1311473_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PJW5	Enterobacteria_phage	97.5	6.6e-61
AYL09587.1|1311473_1311998_-	HNH endonuclease	NA	K4F9R1	Cronobacter_phage	42.9	7.1e-32
AYL09588.1|1311994_1312285_-	DUF1364 domain-containing protein	NA	Q9MCN9	Enterobacteria_phage	100.0	3.4e-52
AYL09589.1|1312284_1313007_-	DNA-binding protein	NA	K7P7L0	Enterobacteria_phage	97.5	1.1e-128
AYL09590.1|1312999_1313170_-	protein ninF	NA	K7PLU6	Enterobacteria_phage	100.0	2.5e-26
AYL09591.1|1313166_1313349_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	98.3	1.3e-28
AYL09592.1|1313345_1313873_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	1.2e-100
AYL09593.1|1313869_1314328_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.6e-80
AYL09594.1|1314383_1315760_-	replicative DNA helicase	NA	A0A0P0ZC27	Stx2-converting_phage	99.8	1.6e-253
AYL09595.1|1315756_1316704_-	replication protein	NA	A5VW95	Enterobacteria_phage	98.4	5.1e-153
AYL09596.1|1316706_1316979_-	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
AYL09597.1|1317001_1317295_-	hypothetical protein	NA	A5VW96	Enterobacteria_phage	100.0	1.7e-46
AYL09598.1|1317414_1317630_-	XRE family transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
AYL09599.1|1317733_1318366_+	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	99.5	1.6e-118
AYL09600.1|1318362_1318767_+	hypothetical protein	NA	Q716D7	Shigella_phage	96.2	2.1e-68
AYL09601.1|1319016_1319397_+	antitermination protein	NA	A4KWR0	Enterobacteria_phage	99.1	5.3e-53
AYL09602.1|1319475_1319676_+	restriction endonuclease	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
AYL09603.1|1319902_1320037_+	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
AYL09604.1|1320021_1320174_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
AYL09605.1|1320258_1320567_+	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	100.0	1.1e-53
AYL09606.1|1320563_1321475_+	DNA recombinase	NA	K7PKG9	Enterobacteria_phage	98.7	2.4e-168
AYL09607.1|1321458_1321941_+	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	97.5	6.1e-78
AYL09608.1|1321952_1322267_+	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	100.0	1.2e-50
AYL09609.1|1322283_1322565_+	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	96.8	2.8e-43
AYL09610.1|1322561_1322729_+	DUF2737 family protein	NA	Q716F2	Shigella_phage	98.2	5.0e-24
AYL09611.1|1322725_1322980_+	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	95.2	3.2e-38
AYL09612.1|1322966_1323659_+	ead/Ea22-like family protein	NA	A0A088CC42	Shigella_phage	55.4	1.2e-82
AYL09613.1|1323630_1323870_+	hypothetical protein	NA	Q9XJH3	Enterobacteria_phage	96.0	8.8e-38
AYL09614.1|1323866_1324658_+	DUF551 domain-containing protein	NA	A0A0H4IU61	Shigella_phage	51.8	1.0e-58
AYL09615.1|1324650_1324935_+	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	94.7	9.4e-47
AYL09616.1|1325006_1325174_+	hypothetical protein	NA	K7P728	Enterobacteria_phage	92.7	9.2e-26
AYL09617.1|1325231_1325432_+	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
AYL09618.1|1325684_1326971_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	37.3	1.1e-65
AYL09619.1|1326972_1327719_+	hypothetical protein	NA	NA	NA	NA	NA
AYL09620.1|1327875_1328067_+	AlpA family transcriptional regulator	NA	E5E3Y1	Burkholderia_phage	49.0	4.2e-06
>prophage 6
CP032879	Escherichia coli strain WCHEC000837 chromosome, complete genome	5094619	1703838	1710978	5094619		Escherichia_phage(83.33%)	6	NA	NA
AYL09940.1|1703838_1706400_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	9.2e-32
AYL09941.1|1706505_1707162_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	5.0e-51
AYL09942.1|1707212_1707980_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
AYL09943.1|1708175_1709084_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.1e-117
AYL09944.1|1709080_1710343_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
AYL09945.1|1710339_1710978_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 7
CP032879	Escherichia coli strain WCHEC000837 chromosome, complete genome	5094619	4543974	4600176	5094619	tail,integrase,holin,head,capsid,portal,terminase,protease,transposase	Enterobacteria_phage(37.93%)	78	4536084:4536100	4577433:4577449
4536084:4536100	attL	CGGAAGATGGCAGCGTG	NA	NA	NA	NA
AYL12417.1|4543974_4545045_-|integrase	integrase	integrase	Q9MCR4	Enterobacteria_phage	99.4	9.6e-201
AYL12418.1|4545022_4545241_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
AYL12419.1|4545280_4545448_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	4.9e-27
AYL13113.1|4545380_4545584_+	hypothetical protein	NA	NA	NA	NA	NA
AYL12420.1|4545548_4546427_-	DUF551 domain-containing protein	NA	A0A0H4IU61	Shigella_phage	53.4	6.7e-67
AYL12421.1|4546423_4546705_-	hypothetical protein	NA	Q9XJH3	Enterobacteria_phage	90.3	1.5e-44
AYL12422.1|4546634_4546823_-	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	93.5	2.9e-28
AYL12423.1|4546995_4547490_-	ead/Ea22-like family protein	NA	A0A0P0ZD75	Stx2-converting_phage	55.0	3.0e-24
AYL12424.1|4547476_4547731_-	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	95.2	3.2e-38
AYL12425.1|4547727_4547895_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	98.2	5.0e-24
AYL12426.1|4547891_4548173_-	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	96.8	2.8e-43
AYL12427.1|4548189_4548504_-	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	100.0	1.2e-50
AYL12428.1|4548515_4548998_-	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	96.2	2.3e-77
AYL12429.1|4548981_4549893_-	DNA recombinase	NA	K7PKG9	Enterobacteria_phage	99.3	1.1e-168
AYL12430.1|4549889_4550198_-	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	99.0	3.3e-53
AYL12431.1|4550282_4550558_-	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	100.0	1.6e-46
AYL12432.1|4550679_4550880_-	restriction endonuclease	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	4.2e-33
AYL12433.1|4551008_4551281_-	antitermination protein N	NA	A0A0N7C217	Escherichia_phage	97.8	2.2e-40
AYL12434.1|4551731_4552415_-	DUF1640 domain-containing protein	NA	NA	NA	NA	NA
AYL12435.1|4552414_4552735_-	hypothetical protein	NA	NA	NA	NA	NA
AYL12436.1|4552858_4553566_-	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	99.6	4.3e-133
AYL12437.1|4553645_4553873_+	DNA-binding protein	NA	G9L677	Escherichia_phage	98.7	1.7e-35
AYL12438.1|4554011_4554308_+	hypothetical protein	NA	A0A1U9AJB5	Stx1_converting_phage	98.0	1.5e-47
AYL12439.1|4554340_4555240_+	Replication protein O	NA	A0A0K2FJ31	Enterobacteria_phage	100.0	3.8e-174
AYL12440.1|4555236_4555938_+	Replication protein P	NA	A0A0K2FIT1	Enterobacteria_phage	99.1	6.4e-129
AYL12441.1|4555934_4556225_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
AYL12442.1|4556280_4556739_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.6e-80
AYL13114.1|4556735_4556918_+	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	4.3e-29
AYL12443.1|4556914_4557085_+	protein ninF	NA	Q8H9Z5	Enterobacteria_phage	96.4	3.5e-25
AYL12444.1|4557077_4557689_+	recombination protein NinG	NA	Q716C3	Shigella_phage	100.0	2.7e-99
AYL12445.1|4557732_4558221_+	antiterminator	NA	M1FPN0	Enterobacteria_phage	100.0	5.3e-90
AYL12446.1|4558586_4558802_+|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
AYL12447.1|4558806_4559157_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.9e-37
AYL12448.1|4559220_4559754_+	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	3.6e-100
AYL12449.1|4559970_4560156_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
AYL12450.1|4560373_4560640_+	hypothetical protein	NA	NA	NA	NA	NA
AYL12451.1|4560645_4561185_-	hypothetical protein	NA	NA	NA	NA	NA
AYL12452.1|4561323_4561674_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	1.4e-63
AYL12453.1|4561821_4562304_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	4.3e-84
AYL12454.1|4562303_4564061_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
AYL12455.1|4564208_4565435_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	82.8	3.1e-203
AYL12456.1|4565427_4566027_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
AYL12457.1|4566041_4567259_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.4	1.7e-161
AYL12458.1|4567335_4567653_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	6.2e-23
AYL12459.1|4567661_4568000_+|head,tail	head-tail adaptor protein	head,tail	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
AYL12460.1|4567996_4568446_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.5	1.0e-63
AYL12461.1|4568442_4568787_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	2.3e-55
AYL12462.1|4568847_4569552_+|tail	phage tail protein	tail	A0A1B5FP82	Escherichia_phage	93.6	1.7e-113
AYL12463.1|4569551_4569938_+|tail	phage tail protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
AYL13115.1|4569979_4570240_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	96.5	1.7e-39
AYL12464.1|4570286_4573514_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.6	0.0e+00
AYL12465.1|4573491_4573848_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
AYL12466.1|4573847_4574546_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	7.6e-130
AYL12467.1|4574551_4575295_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	5.0e-148
AYL12468.1|4575192_4575840_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
AYL12469.1|4575900_4579380_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.8	0.0e+00
4577433:4577449	attR	CACGCTGCCATCTTCCG	NA	NA	NA	NA
AYL12470.1|4579447_4580047_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	97.0	9.1e-108
AYL12471.1|4580198_4582571_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.0	1.8e-167
AYL12472.1|4582570_4582852_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	1.4e-18
AYL12473.1|4582861_4583902_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.9	2.9e-125
AYL13116.1|4583944_4584238_+	hypothetical protein	NA	NA	NA	NA	NA
AYL12474.1|4584450_4585782_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
AYL12475.1|4586527_4587004_-	kinase inhibitor	NA	NA	NA	NA	NA
AYL12476.1|4587062_4588352_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
AYL12477.1|4588438_4589479_+	biotin synthase	NA	NA	NA	NA	NA
AYL12478.1|4589475_4590630_+	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
AYL12479.1|4590616_4591372_+	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
AYL12480.1|4591364_4592042_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
AYL12481.1|4592620_4594642_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AYL12482.1|4594679_4595588_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	30.7	3.2e-27
AYL12483.1|4595984_4596974_+	cyclic pyranopterin monophosphate synthase	NA	NA	NA	NA	NA
AYL12484.1|4596995_4597508_+	molybdenum cofactor biosynthesis protein	NA	NA	NA	NA	NA
AYL12485.1|4597510_4597996_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
AYL12486.1|4597988_4598234_+	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
AYL12487.1|4598235_4598688_+	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
AYL12488.1|4598824_4599529_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
AYL12489.1|4599545_4599761_+	hypothetical protein	NA	NA	NA	NA	NA
AYL12490.1|4599666_4600176_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
>prophage 8
CP032879	Escherichia coli strain WCHEC000837 chromosome, complete genome	5094619	4947099	5020542	5094619	tail,integrase,holin,tRNA,head,capsid,portal,lysis,terminase,transposase	Escherichia_phage(34.55%)	87	4948278:4948293	4992986:4993001
AYL12801.1|4947099_4947609_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
AYL12802.1|4947730_4948693_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
4948278:4948293	attL	GTCAGCGTGTCACCAC	NA	NA	NA	NA
AYL12803.1|4948836_4952283_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
AYL12804.1|4952410_4953484_-	acyltransferase family protein	NA	NA	NA	NA	NA
AYL12805.1|4953744_4954944_+	lipoprotein-releasing system protein LolC	NA	NA	NA	NA	NA
AYL12806.1|4954936_4955638_+	lipoprotein-releasing system ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	39.8	5.4e-35
AYL12807.1|4955637_4956882_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
AYL12808.1|4956910_4957822_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AYL12809.1|4957837_4958659_+	NAD-dependent deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
AYL12810.1|4958795_4959581_-	TPM domain-containing protein	NA	NA	NA	NA	NA
AYL12811.1|4959577_4960039_-	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
AYL12812.1|4960096_4961143_-	spermidine/putrescine-binding periplasmic protein	NA	NA	NA	NA	NA
AYL12813.1|4961139_4961934_-	spermidine/putrescine ABC transporter permease	NA	NA	NA	NA	NA
AYL12814.1|4962100_4963219_-|integrase	integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
AYL12815.1|4963187_4963457_-	excisionase	NA	NA	NA	NA	NA
AYL12816.1|4963518_4965975_-	exonuclease	NA	V5UQJ3	Shigella_phage	42.6	2.5e-103
AYL12817.1|4966052_4966256_-	DUF1482 family protein	NA	NA	NA	NA	NA
AYL12818.1|4966252_4966441_-	cell division inhibitor	NA	NA	NA	NA	NA
AYL12819.1|4966451_4967306_-	transcriptional regulator	NA	A0A0P0ZE80	Stx2-converting_phage	63.2	3.6e-65
AYL13131.1|4967836_4968211_-	hypothetical protein	NA	NA	NA	NA	NA
AYL12820.1|4968222_4968375_-	DUF1391 domain-containing protein	NA	NA	NA	NA	NA
AYL12821.1|4968581_4968989_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
AYL12822.1|4969065_4969293_+	transcriptional regulator	NA	NA	NA	NA	NA
AYL12823.1|4969276_4969828_+	hypothetical protein	NA	NA	NA	NA	NA
AYL12824.1|4970628_4971294_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.4e-79
AYL12825.1|4971327_4972098_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.4	1.1e-86
AYL12826.1|4972098_4972506_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.6e-39
AYL12827.1|4972502_4972799_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
AYL12828.1|4972795_4973257_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	2.6e-38
AYL12829.1|4973234_4973591_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	1.1e-57
AYL12830.1|4973686_4974094_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	60.4	1.0e-22
AYL12831.1|4974095_4974461_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	99.2	1.9e-68
AYL12832.1|4974457_4975444_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	41.5	1.8e-44
AYL12833.1|4975564_4975744_+	hypothetical protein	NA	NA	NA	NA	NA
AYL12834.1|4976002_4976158_+	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
AYL12835.1|4976374_4976626_+	hypothetical protein	NA	NA	NA	NA	NA
AYL12836.1|4976692_4976971_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	45.3	6.3e-11
AYL12837.1|4976972_4978031_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.3	1.8e-90
AYL12838.1|4978031_4978400_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.8	2.4e-34
AYL12839.1|4978392_4979082_+	antiterminator	NA	I6PDF8	Cronobacter_phage	48.1	7.1e-56
AYL12840.1|4979159_4979492_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	93.4	7.0e-33
AYL12841.1|4979861_4980197_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
AYL12842.1|4980442_4980646_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	96.8	2.7e-27
AYL12843.1|4980642_4980804_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	89.1	1.6e-14
AYL12844.1|4980953_4981169_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
AYL12845.1|4981173_4982064_+	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	70.9	2.1e-108
AYL12846.1|4982100_4982634_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	6.7e-102
AYL12847.1|4982757_4982973_+	hypothetical protein	NA	NA	NA	NA	NA
AYL13132.1|4983121_4983589_+|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	84.4	6.7e-66
AYL12848.1|4983845_4984226_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	2.6e-39
AYL12849.1|4984348_4984702_-	hypothetical protein	NA	NA	NA	NA	NA
AYL12850.1|4984589_4984910_-	hypothetical protein	NA	NA	NA	NA	NA
AYL12851.1|4985184_4985694_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
AYL12852.1|4985665_4987594_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	1.4e-261
AYL12853.1|4987577_4987784_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	55.4	3.0e-10
AYL12854.1|4987780_4989373_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	4.9e-185
AYL12855.1|4989362_4990868_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.1	1.0e-99
AYL12856.1|4990904_4991252_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	59.1	6.8e-23
AYL12857.1|4991309_4992338_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.9	4.1e-116
AYL12858.1|4992341_4992764_+	hypothetical protein	NA	NA	NA	NA	NA
AYL12859.1|4992756_4993110_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
4992986:4993001	attR	GTGGTGACACGCTGAC	NA	NA	NA	NA
AYL12860.1|4993125_4993701_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	56.8	1.6e-48
AYL12861.1|4993697_4994093_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
AYL12862.1|4994100_4994853_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	2.7e-133
AYL12863.1|4994866_4995298_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	1.8e-41
AYL12864.1|4995324_4995738_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
AYL12865.1|4995718_4998280_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.4	0.0e+00
AYL12866.1|4998276_4998606_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AYL12867.1|4998605_4999304_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	3.2e-128
AYL12868.1|4999314_5000058_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
AYL12869.1|4999955_5000636_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.9	3.7e-113
AYL12870.1|5000979_5004672_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	86.0	0.0e+00
AYL12871.1|5004739_5005339_+	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
AYL12872.1|5005490_5008517_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	54.6	1.4e-55
AYL12873.1|5008516_5009101_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
AYL12874.1|5009073_5009211_+|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AYL13133.1|5009155_5009782_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AYL12875.1|5009880_5010147_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.8	1.5e-17
AYL12876.1|5010378_5011242_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
AYL12877.1|5011225_5012362_-	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
AYL12878.1|5012611_5013838_+	peptidase T	NA	NA	NA	NA	NA
AYL12879.1|5013886_5015008_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AYL12880.1|5015083_5016544_-	sensor protein PhoQ	NA	NA	NA	NA	NA
AYL12881.1|5016543_5017215_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AYL12882.1|5017384_5018755_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
AYL13134.1|5018758_5019400_-	lysogenization protein HflD	NA	NA	NA	NA	NA
AYL12883.1|5019435_5020542_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 1
CP032875	Escherichia coli strain WCHEC000837 plasmid p1_000837, complete sequence	92538	0	92322	92538	plate,head,capsid,portal,transposase,lysis,tail,integrase,holin,terminase	Escherichia_phage(86.79%)	115	20006:20024	80540:80558
AYL08073.1|306_921_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.5	1.7e-61
AYL08074.1|927_2775_-|tail	phage tail protein	tail	A0A222YWB9	Escherichia_phage	53.0	6.3e-107
AYL08176.1|2777_2927_-|tail	phage tail protein	tail	A0A222YXS1	Escherichia_phage	98.0	7.9e-21
AYL08075.1|3318_4164_-|tail	phage tail protein	tail	A0A222YWB7	Escherichia_phage	98.2	3.0e-157
AYL08076.1|4174_5605_-|plate	baseplate protein	plate	A0A222YWB2	Escherichia_phage	98.7	2.2e-269
AYL08077.1|5601_5976_-	hypothetical protein	NA	A0A222YXD0	Escherichia_phage	97.6	1.7e-64
AYL08078.1|10432_11254_-	hypothetical protein	NA	A0A222YZ63	Escherichia_phage	98.9	8.5e-157
AYL08079.1|11642_12398_+	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	100.0	3.7e-138
AYL08080.1|12779_13487_-|tail	phage tail protein	tail	A0A222YY05	Escherichia_phage	100.0	1.0e-126
AYL08081.1|13502_14054_-	hypothetical protein	NA	A0A222YWE3	Escherichia_phage	98.9	1.3e-97
AYL08082.1|14108_14600_-|plate	baseplate protein	plate	A0A222YWE4	Escherichia_phage	100.0	3.5e-89
AYL08083.1|14608_15181_-	hypothetical protein	NA	A0A222YY02	Escherichia_phage	98.9	6.7e-100
AYL08084.1|15248_15983_-	hypothetical protein	NA	A0A222YXT7	Escherichia_phage	100.0	5.9e-125
AYL08085.1|16026_17685_-|tail	phage tail protein	tail	A0A222YWC8	Escherichia_phage	98.0	1.4e-304
AYL08086.1|17752_18031_-	hypothetical protein	NA	A0A222YWH8	Escherichia_phage	96.7	1.1e-39
AYL08087.1|18178_19876_-|capsid	capsid protein	capsid	A0A222YWC7	Escherichia_phage	97.3	0.0e+00
20006:20024	attL	TTAATTTTCTAACACAAAT	NA	NA	NA	NA
AYL08177.1|20034_20427_+	hypothetical protein	NA	A0A222YXX4	Escherichia_phage	97.7	5.6e-66
AYL08088.1|20445_20904_+	hypothetical protein	NA	A0A222YWJ4	Escherichia_phage	98.7	2.3e-87
AYL08089.1|21057_21516_-	hypothetical protein	NA	A0A222YWG1	Escherichia_phage	94.7	4.7e-64
AYL08090.1|21586_22390_-	hypothetical protein	NA	A0A222YXK1	Escherichia_phage	84.0	1.4e-100
AYL08091.1|22389_22674_-	alanine racemase	NA	A0A222YXW1	Escherichia_phage	81.9	8.9e-37
AYL08092.1|22940_23897_+	recombinase	NA	A0A222YXF2	Escherichia_phage	99.7	1.7e-180
AYL08093.1|23909_24248_+	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	96.4	8.3e-50
AYL08094.1|24526_25168_+	cobyrinic acid ac-diamide synthase	NA	A0A222YXS3	Escherichia_phage	93.0	4.0e-109
AYL08095.1|25160_25445_+	hypothetical protein	NA	A0A222YZA7	Escherichia_phage	76.8	5.6e-31
AYL08096.1|25589_26495_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A222YYM0	Escherichia_phage	95.3	5.9e-167
AYL08097.1|26487_27168_-	hypothetical protein	NA	A0A222YXN3	Escherichia_phage	100.0	5.8e-135
AYL08098.1|27151_28057_-	recombination-associated protein RdgC	NA	A0A222YY21	Escherichia_phage	98.0	3.9e-163
AYL08099.1|28116_28770_-|plate	baseplate protein	plate	A0A222YWF1	Escherichia_phage	93.5	1.3e-94
AYL08100.1|28766_29747_-|tail	tail length tape measure protein	tail	A0A222YXZ0	Escherichia_phage	99.7	9.5e-187
AYL08101.1|29750_30518_-|plate	baseplate	plate	A0A222YWF4	Escherichia_phage	100.0	4.4e-139
AYL08102.1|30514_31306_-|tail	phage tail protein	tail	A0A222YXU3	Escherichia_phage	98.5	2.8e-149
AYL08103.1|31468_31771_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	100.0	5.9e-55
AYL08104.1|31841_32180_+	addiction module antidote protein, HigA family	NA	A0A222YWD7	Escherichia_phage	100.0	1.3e-55
AYL08105.1|32236_32437_+	hypothetical protein	NA	A0A222YXG1	Escherichia_phage	90.8	8.1e-29
AYL08106.1|32458_33187_+	hypothetical protein	NA	A0A222YY57	Escherichia_phage	58.3	1.2e-72
AYL08107.1|33220_34414_-|tail	phage tail protein	tail	A0A222YXT1	Escherichia_phage	96.5	1.3e-198
AYL08108.1|34406_34736_-|plate	baseplate protein	plate	A0A222YYR0	Escherichia_phage	100.0	3.6e-58
AYL08109.1|34828_35110_-	addiction module antidote protein, HigA family	NA	I6ZVM3	Aeromonas_phage	44.7	1.3e-08
AYL08110.1|35118_35400_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2L1IV28	Escherichia_phage	45.2	7.5e-20
AYL08111.1|35736_36390_-	maturation control protein	NA	A0A222YZ79	Escherichia_phage	99.5	4.9e-115
AYL08112.1|36673_37282_+	hypothetical protein	NA	NA	NA	NA	NA
AYL08178.1|37467_37695_+	hypothetical protein	NA	NA	NA	NA	NA
AYL08113.1|37691_38003_-	transcriptional regulator	NA	A0A222YY28	Escherichia_phage	83.0	1.0e-33
AYL08114.1|38062_38989_-	Rha family transcriptional regulator	NA	A0A222YWG0	Escherichia_phage	84.3	3.7e-148
AYL08115.1|38988_39204_-	host cell division inhibitor Icd-like protein	NA	A0A222YWG3	Escherichia_phage	98.6	7.4e-36
AYL08116.1|39222_39342_-	hypothetical protein	NA	NA	NA	NA	NA
AYL08117.1|40014_40593_-	recombinase	NA	A0A222YXV2	Escherichia_phage	96.9	6.4e-74
AYL08118.1|40865_41489_+	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	82.8	5.8e-89
AYL08179.1|41518_41803_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	96.8	5.2e-45
AYL08119.1|41792_42302_+	hypothetical protein	NA	E7C9P6	Salmonella_phage	66.0	1.7e-38
AYL08120.1|42298_42940_+	hypothetical protein	NA	A0A222YWM9	Escherichia_phage	90.0	8.6e-104
AYL08121.1|42936_43185_+	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	84.8	3.5e-29
AYL08122.1|43181_43475_+	DUF4752 family protein	NA	A0A222YWQ2	Escherichia_phage	86.5	1.0e-35
AYL08123.1|43452_43677_+	hypothetical protein	NA	A0A222YYR6	Escherichia_phage	94.6	2.5e-34
AYL08124.1|43673_43985_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	99.0	1.8e-59
AYL08125.1|44096_45305_+|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	94.0	3.4e-210
AYL08126.1|45341_46010_+	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	87.7	8.6e-115
AYL08127.1|46106_47102_+	DUF968 domain-containing protein	NA	A0A222YWL6	Escherichia_phage	97.6	6.2e-194
AYL08128.1|47115_47202_+	DUF4752 family protein	NA	NA	NA	NA	NA
AYL08129.1|47198_47390_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	81.4	3.1e-17
AYL08130.1|47386_48007_+	ead/Ea22-like family protein	NA	A0A222YY85	Escherichia_phage	79.7	2.6e-25
AYL08131.1|48003_48450_+	ead/Ea22-like family protein	NA	A0A222YWN7	Escherichia_phage	82.4	7.4e-38
AYL08132.1|48795_48984_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	98.4	1.4e-30
AYL08180.1|48913_49195_+	hypothetical protein	NA	Q9XJH3	Enterobacteria_phage	90.3	2.5e-44
AYL08133.1|49191_49881_+	DUF551 domain-containing protein	NA	A0A2D1GLX9	Escherichia_phage	89.9	2.9e-113
AYL08134.1|49877_50138_+	eaa protein	NA	A0A077SLR0	Escherichia_phage	98.8	8.4e-42
AYL08181.1|50423_50840_+	hypothetical protein	NA	A0A076G6X8	Escherichia_phage	61.2	1.8e-25
AYL08135.1|50852_51146_+	hypothetical protein	NA	A0A077SK23	Escherichia_phage	93.8	9.7e-47
AYL08136.1|51145_51454_+	hypothetical protein	NA	NA	NA	NA	NA
AYL08137.1|51450_52221_+	hypothetical protein	NA	A0A1B0VDS6	Salmonella_phage	73.0	3.1e-116
AYL08182.1|52332_52533_+	hypothetical protein	NA	NA	NA	NA	NA
AYL08138.1|52535_52787_+	DNA polymerase III subunit theta	NA	A0A077SLL5	Escherichia_phage	97.6	1.6e-37
AYL08139.1|52910_53300_+	DNA repair protein	NA	A0A077SK24	Escherichia_phage	95.3	3.5e-68
AYL08140.1|53372_53594_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
AYL08141.1|53593_53974_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	91.1	6.1e-57
AYL08142.1|54009_55104_-	hypothetical protein	NA	Q71T61	Escherichia_phage	32.7	1.3e-40
AYL08143.1|55093_55861_-	hypothetical protein	NA	A0A222YXM9	Escherichia_phage	98.4	8.6e-135
AYL08144.1|55867_56530_-	DUF2829 domain-containing protein	NA	A0A1B0VBT1	Salmonella_phage	81.0	5.0e-99
AYL08145.1|56544_57039_-	dUTP diphosphatase	NA	A0A222YYP1	Escherichia_phage	94.5	8.1e-86
AYL08146.1|57035_57512_-	hypothetical protein	NA	NA	NA	NA	NA
AYL08147.1|57508_57853_-	hypothetical protein	NA	A0A222YYS6	Escherichia_phage	94.7	3.9e-55
AYL08148.1|57927_58956_-|integrase	integrase	integrase	Q5XLQ5	Enterobacteria_phage	41.9	1.2e-59
AYL08183.1|60148_60388_+	hypothetical protein	NA	Q5QBE5	Escherichia_phage	96.4	1.4e-06
AYL08149.1|60415_61924_-|terminase	terminase	terminase	Q5QBP2	Enterobacteria_phage	56.8	1.2e-161
AYL08184.1|61923_62904_-	DNA pacase A subunit	NA	NA	NA	NA	NA
AYL08150.1|63284_63677_-	late promoter activating protein	NA	NA	NA	NA	NA
AYL08185.1|63785_63971_-	hypothetical protein	NA	Q5QBF3	Escherichia_phage	98.4	6.4e-28
AYL08186.1|64177_64369_-	hypothetical protein	NA	A0A222YWJ0	Escherichia_phage	100.0	3.2e-30
AYL08151.1|65402_65567_-	DUF3927 domain-containing protein	NA	A0A222YXW5	Escherichia_phage	100.0	1.8e-18
AYL08152.1|65566_66001_-	tellurite resistance protein	NA	A0A222YXQ0	Escherichia_phage	100.0	3.7e-74
AYL08153.1|66816_67002_+	hypothetical protein	NA	Q71T99	Escherichia_phage	100.0	1.5e-16
AYL08154.1|68360_69569_-	hypothetical protein	NA	A0A222YW83	Escherichia_phage	99.5	4.5e-231
AYL08187.1|69682_69964_-	hypothetical protein	NA	A0A222YW96	Escherichia_phage	95.7	3.2e-39
AYL08155.1|69978_70179_-	hypothetical protein	NA	A0A222YWF9	Escherichia_phage	98.5	3.3e-30
AYL08156.1|70193_70490_-	VRR-NUC domain-containing protein	NA	A0A222YXP1	Escherichia_phage	100.0	5.4e-53
AYL08157.1|70824_71085_-	hypothetical protein	NA	A0A222YXI8	Escherichia_phage	98.8	3.1e-44
AYL08158.1|71087_71522_-	olxA	NA	A0A222YZ35	Escherichia_phage	93.8	2.1e-74
AYL08159.1|71558_78395_-	helicase SNF2	NA	A0A222YYH3	Escherichia_phage	98.9	0.0e+00
AYL08160.1|78546_79032_+	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	100.0	3.3e-92
AYL08161.1|79064_79262_-	hypothetical protein	NA	A0A222YWF5	Escherichia_phage	100.0	3.1e-33
AYL08162.1|79261_79969_-	DNA-binding protein	NA	A0A222YXY0	Escherichia_phage	90.6	1.1e-115
AYL08163.1|79968_80193_-	host cell division inhibitor Icd-like protein	NA	A0A222YWB3	Escherichia_phage	100.0	8.8e-40
AYL08164.1|80607_81570_-	lytic replication protein	NA	A0A222YXV1	Escherichia_phage	98.8	5.6e-176
80540:80558	attR	TTAATTTTCTAACACAAAT	NA	NA	NA	NA
AYL08165.1|81770_82769_-|head	head processing protein	head	A0A222YWA7	Escherichia_phage	98.5	1.9e-179
AYL08166.1|82782_84051_-|portal	phage portal protein	portal	A0A222YXQ7	Escherichia_phage	100.0	1.7e-244
AYL08167.1|84529_85915_-	hypothetical protein	NA	A0A222YY44	Escherichia_phage	96.7	5.4e-236
AYL08168.1|86021_87230_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	92.8	8.6e-214
AYL08169.1|87346_87721_-	hypothetical protein	NA	A0A222YWB0	Escherichia_phage	93.5	2.8e-38
AYL08170.1|87720_89658_-|head	head protein	head	A0A222YWA3	Escherichia_phage	98.3	0.0e+00
AYL08171.1|89650_90271_-	hypothetical protein	NA	A0A222YXB2	Escherichia_phage	95.1	8.1e-75
AYL08172.1|90260_90707_-|lysis	lysis protein	lysis	A0A222YXP5	Escherichia_phage	100.0	9.2e-81
AYL08173.1|90706_91033_-|holin	holin	holin	A0A222YZ46	Escherichia_phage	99.1	9.5e-51
AYL08174.1|91249_91822_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
AYL08175.1|91881_92322_+	hypothetical protein	NA	K7PH60	Enterobacterial_phage	54.9	3.5e-40
>prophage 1
CP032877	Escherichia coli strain WCHEC000837 plasmid pCTXM15_000837, complete sequence	150853	44277	122422	150853	protease,integrase,transposase	Escherichia_phage(42.86%)	86	80381:80440	87054:87874
AYL08240.1|44277_45849_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
AYL08241.1|46552_46786_+	hypothetical protein	NA	NA	NA	NA	NA
AYL08242.1|46731_46974_-	hypothetical protein	NA	NA	NA	NA	NA
AYL08345.1|47029_47179_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
AYL08243.1|47462_47720_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
AYL08347.1|47755_47872_-	replication protein RepA	NA	NA	NA	NA	NA
AYL08346.1|47955_48030_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
AYL08244.1|49789_51010_+	arginine deiminase	NA	NA	NA	NA	NA
AYL08245.1|51020_51932_+	carbamate kinase	NA	NA	NA	NA	NA
AYL08246.1|52016_53021_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
AYL08247.1|53068_54472_+	YfcC family protein	NA	NA	NA	NA	NA
AYL08248.1|54552_55032_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
AYL08249.1|55388_55610_-	hypothetical protein	NA	NA	NA	NA	NA
AYL08250.1|55640_55991_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
AYL08251.1|55987_56350_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	88.5	9.0e-34
AYL08252.1|57188_57767_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
AYL08253.1|58179_58533_-	hypothetical protein	NA	NA	NA	NA	NA
AYL08254.1|59004_60027_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AYL08255.1|60213_60465_-	hypothetical protein	NA	NA	NA	NA	NA
AYL08256.1|60431_60689_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
AYL08349.1|60729_60840_-	replication protein RepA	NA	NA	NA	NA	NA
AYL08348.1|60923_60998_+	positive regulator of RepFIC repA1 expression	NA	NA	NA	NA	NA
AYL08257.1|60990_61848_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AYL08258.1|62210_62597_+	hypothetical protein	NA	NA	NA	NA	NA
AYL08259.1|62786_63440_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYL08260.1|63659_64124_+	mRNA interferase PemK	NA	NA	NA	NA	NA
AYL08261.1|64120_64225_+	hypothetical protein	NA	NA	NA	NA	NA
AYL08262.1|64260_67158_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
AYL08263.1|67252_67858_+	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
AYL08264.1|68459_69164_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYL08350.1|69307_69862_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
AYL08351.1|69992_70823_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
AYL08265.1|71454_72159_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYL08266.1|72265_73126_+	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
AYL08267.1|73138_73681_+	tunicamycin resistance protein	NA	NA	NA	NA	NA
AYL08268.1|74874_75579_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYL08269.1|77900_78233_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AYL08270.1|78279_79155_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
80381:80440	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
AYL08271.1|80432_81137_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AYL08272.1|81173_81728_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AYL08273.1|81666_82680_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYL08352.1|82837_83311_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
AYL08274.1|83441_84230_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
AYL08275.1|84435_84783_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AYL08276.1|84776_85616_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AYL08277.1|85545_85725_-	hypothetical protein	NA	NA	NA	NA	NA
AYL08278.1|85743_86016_+	hypothetical protein	NA	NA	NA	NA	NA
AYL08279.1|86144_86366_-	hypothetical protein	NA	NA	NA	NA	NA
AYL08280.1|86356_87061_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AYL08281.1|87182_88088_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
87054:87874	attR	AAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCGGATTGAATATAACCGACGTGACTGTTACATTTAGGTGGCTAAACCCGTCAAGCCCTCAGGAGTGAATCATGACCGTAGTCACGACCGCCGATACCTCCCAACTGTACGCACTTGCAGCCCGACATGGGCTCAAGCTCCATGGCCCGCTGACTGTCAATGAGCTTGGGCTCGACTATAGGATCGTGATCGCCACCGTCGACGATGGACGTCGGTGGGTGCTGCGCATCCCGCGCCGAGCCGAGGTAAGCGCGAAGGTCGAACCAGAGGCGCGGGTGCTGGCAATGCTCAAGAATCGCCTGCCGTTCGCGGTGCCGGACTGGCGCGTGGCCAACGCCGAGCTCGTTGCCTATCCCATGCTCGAAGACTCGACTGCGATGGTCATCCAGCCTGGTTCGTCCACGCCCGACTGGGTCGTGCCGCAGGACTCGGAGGTCTTCGCGGAGAGCTTCGCGACCGCGCTCGCCGCCCTGCATGCCGTCCCCATTTCCGCCGCCGTGGATGCGGGGATGCTCATCCGTACACCGACGCAGGCCCGTCAGAAGGTGGCCGACGACGTTGACCGCGTCCGACGCGAGTTCGTGGTGAACGACAAGCGCCTCCACCGGTGGCAGCGCTGGCTCGACGACGATTCGTCGTGGCCAGATTTCTCCGTGGTGGTGCATGGCGATCTCTACGTGGGCCATGTGCTCATCGACAACACGGAGCGCGTCAGCGGGATGATCGACTGGAGCGAGGCCCGCGTTGATGACCCTGCCATCGA	NA	NA	NA	NA
AYL08282.1|88084_89323_+	MFS transporter	NA	NA	NA	NA	NA
AYL08283.1|89322_89907_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYL08284.1|89852_90209_+	hypothetical protein	NA	NA	NA	NA	NA
AYL08285.1|90687_91392_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYL08286.1|91968_92742_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AYL08287.1|92927_94151_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AYL08288.1|94281_95154_-	DMT family transporter	NA	NA	NA	NA	NA
AYL08289.1|95395_96148_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AYL08290.1|96587_97592_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AYL08291.1|98877_99363_-	hypothetical protein	NA	NA	NA	NA	NA
AYL08292.1|99387_99942_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
AYL08293.1|99859_100555_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
AYL08294.1|100559_101720_-	ABC transporter permease	NA	NA	NA	NA	NA
AYL08295.1|101679_102963_-	ABC transporter permease	NA	NA	NA	NA	NA
AYL08296.1|102965_104345_-	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
AYL08297.1|104448_104976_-	iron transporter	NA	NA	NA	NA	NA
AYL08298.1|105016_106963_-	FTR1 family iron permease	NA	NA	NA	NA	NA
AYL08353.1|106905_107091_-	hypothetical protein	NA	NA	NA	NA	NA
AYL08299.1|107249_108065_-	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
AYL08300.1|108247_108754_-	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
AYL08301.1|108743_108971_-	scsC protein	NA	NA	NA	NA	NA
AYL08302.1|110096_111302_-	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
AYL08303.1|111380_112007_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AYL08304.1|111984_112671_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AYL08305.1|112678_113065_-	amino acid-binding protein	NA	NA	NA	NA	NA
AYL08306.1|113057_113321_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AYL08307.1|114203_114908_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYL08308.1|114853_115222_-	hypothetical protein	NA	NA	NA	NA	NA
AYL08309.1|115287_116394_-	alkene reductase	NA	NA	NA	NA	NA
AYL08310.1|116607_116937_+	thioredoxin	NA	V9SJ74	Achromobacter_phage	34.7	1.3e-10
AYL08311.1|116966_117305_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AYL08312.1|117309_117891_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYL08354.1|118032_118590_-	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AYL08313.1|119216_119921_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYL08355.1|119945_120320_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	9.8e-60
AYL08314.1|121399_122422_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
>prophage 1
CP032878	Escherichia coli strain WCHEC000837 plasmid pNDM4_000837, complete sequence	45484	11285	19391	45484	transposase	Stx2-converting_phage(42.86%)	8	NA	NA
AYL08397.1|11285_11663_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	90.5	3.2e-58
AYL08365.1|11659_12007_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	96.5	1.8e-60
AYL08366.1|12057_13596_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	90.8	2.8e-270
AYL08367.1|13712_14921_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AYL08368.1|14954_16388_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	51.5	4.1e-106
AYL08369.1|16536_17233_+|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	93.5	1.5e-125
AYL08370.1|17471_18224_+	hypothetical protein	NA	NA	NA	NA	NA
AYL08371.1|18467_19391_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	6.6e-174
