The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP020451	Streptococcus salivarius strain FDAARGOS_259 chromosome, complete genome	2259318	238775	282744	2259318	protease,bacteriocin	Streptococcus_phage(40.0%)	51	NA	NA
ARC49814.1|238775_240062_-|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	32.2	1.6e-40
ARC48108.1|240157_241087_-	U32 family peptidase	NA	NA	NA	NA	NA
ARC48109.1|241325_241622_+	DUF3270 domain-containing protein	NA	NA	NA	NA	NA
ARC48110.1|241677_242118_-	hypothetical protein	NA	NA	NA	NA	NA
ARC48111.1|242130_242529_-	DUF948 domain-containing protein	NA	NA	NA	NA	NA
ARC48112.1|242653_243445_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
ARC48113.1|243444_244374_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
ARC48114.1|244500_244764_-	PspC domain-containing protein	NA	NA	NA	NA	NA
ARC48115.1|244829_245270_-	SprT family protein	NA	NA	NA	NA	NA
ARC48116.1|245256_247389_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
ARC48117.1|247806_248709_+	permease	NA	NA	NA	NA	NA
ARC48118.1|248708_249524_+	TIGR03943 family protein	NA	NA	NA	NA	NA
ARC48119.1|249576_251238_-	STAS domain-containing protein	NA	NA	NA	NA	NA
ARC48120.1|251477_252092_-	DUF2140 domain-containing protein	NA	NA	NA	NA	NA
ARC48121.1|252187_252829_-	lipase	NA	NA	NA	NA	NA
ARC48122.1|252855_253467_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
ARC48123.1|253570_253933_-	hypothetical protein	NA	NA	NA	NA	NA
ARC48124.1|253937_254315_-	hypothetical protein	NA	NA	NA	NA	NA
ARC48125.1|254327_254690_-	hypothetical protein	NA	NA	NA	NA	NA
ARC48126.1|254686_255079_-	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
ARC48127.1|255254_255674_+	hypothetical protein	NA	NA	NA	NA	NA
ARC48128.1|255773_255971_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AVH84095.1|256022_256334_-	hypothetical protein	NA	NA	NA	NA	NA
ARC48129.1|257029_257233_-	CsbD family protein	NA	NA	NA	NA	NA
ARC48130.1|257489_257729_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
ARC48131.1|258432_259458_+	TIGR00341 family protein	NA	NA	NA	NA	NA
ARC48132.1|259561_260443_+	diacylglycerol kinase family lipid kinase	NA	NA	NA	NA	NA
ARC48133.2|260735_261419_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
ARC48134.1|261405_262422_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
ARC48135.1|262442_263198_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.6	1.1e-12
ARC48136.1|263202_264246_-	iron ABC transporter permease	NA	NA	NA	NA	NA
ARC48137.1|264367_265120_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
ARC48138.1|265168_266008_-	DUF4300 domain-containing protein	NA	NA	NA	NA	NA
ARC48139.1|266322_266865_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AVH84096.1|267036_268803_+	MFS transporter	NA	NA	NA	NA	NA
ARC48140.1|268962_270210_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
ARC48141.1|270328_270601_-	hypothetical protein	NA	NA	NA	NA	NA
ARC48142.1|270728_271364_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
ARC48143.1|271404_272229_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
ARC48144.1|272278_272851_-	HD domain-containing protein	NA	A0A1D6Y7U0	Golden_Marseillevirus	30.1	1.1e-09
ARC48145.1|272950_273520_-	TetR/AcrR family transcriptional regulator	NA	A0A1X9I6A2	Streptococcus_phage	47.8	2.7e-16
ARC48146.1|273645_274488_+	DegV domain-containing protein	NA	A0A1X9I5J4	Streptococcus_phage	69.9	1.3e-107
ARC48147.1|274708_275881_+	MFS transporter	NA	NA	NA	NA	NA
ARC48148.1|276024_276762_-	DUF4336 domain-containing protein	NA	NA	NA	NA	NA
ARC48149.1|276794_277571_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
ARC48150.1|277702_278581_-	phosphotransferase family protein	NA	NA	NA	NA	NA
ARC48151.1|278687_279296_-	peptidase S51	NA	NA	NA	NA	NA
ARC48152.1|279472_280516_-	EamA family transporter	NA	NA	NA	NA	NA
ARC48153.1|280821_281142_-	competence protein TfoX	NA	NA	NA	NA	NA
ARC48154.1|281411_281903_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
AVH84097.1|281991_282744_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
CP020451	Streptococcus salivarius strain FDAARGOS_259 chromosome, complete genome	2259318	290022	297959	2259318		Streptococcus_phage(87.5%)	9	NA	NA
AVH84098.1|290022_290211_+	type VI secretion protein ImpB	NA	Q6DMX4	Streptococcus_phage	90.7	1.5e-13
ARC48163.1|290207_290453_+	hypothetical protein	NA	A0A1B0RXA7	Streptococcus_phage	98.8	2.6e-37
ARC48164.1|290449_290785_+	imsC-like protein	NA	NA	NA	NA	NA
ARC48165.1|290797_291166_+	hypothetical protein	NA	A0A1B0RXA8	Streptococcus_phage	97.5	1.1e-58
ARC48166.1|291152_291452_+	hypothetical protein	NA	A0A1B0RX98	Streptococcus_phage	96.0	1.8e-48
ARC48167.1|291569_293033_-	Msr family ABC-F type ribosomal protection protein	NA	A0A1B0RXA0	Streptococcus_phage	96.9	2.8e-251
AVH84099.1|293152_294370_-	macrolide efflux MFS transporter Mef(A)	NA	A0A2K5B2B5	Erysipelothrix_phage	90.6	5.1e-198
ARC48168.1|294755_294926_-	DNA recombinase	NA	A0A1X9I6E4	Streptococcus_phage	98.2	3.7e-22
ARC48169.1|295871_297959_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.2	1.2e-114
>prophage 3
CP020451	Streptococcus salivarius strain FDAARGOS_259 chromosome, complete genome	2259318	310572	321476	2259318		Streptococcus_phage(87.5%)	10	NA	NA
ARC48184.1|310572_311739_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	34.9	9.3e-40
ARC48185.1|311739_312807_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
ARC48186.1|312819_313677_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
ARC48187.1|313666_314344_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	92.4	7.4e-114
ARC48188.1|314340_315504_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	94.6	8.5e-211
ARC48189.1|315665_317852_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	95.0	0.0e+00
ARC48190.1|318026_318212_+	hypothetical protein	NA	W6LMT3	Streptococcus_phage	93.4	1.9e-24
ARC48191.1|318364_319669_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	99.5	1.4e-246
ARC48192.1|319874_320330_+	DUF1694 domain-containing protein	NA	W6LLD2	Streptococcus_phage	83.4	2.3e-66
ARC48193.1|320360_321476_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	86.6	9.2e-138
>prophage 4
CP020451	Streptococcus salivarius strain FDAARGOS_259 chromosome, complete genome	2259318	608997	614444	2259318		Streptococcus_phage(66.67%)	6	NA	NA
ARC48448.1|608997_610317_-	DNA/RNA helicase	NA	A0A1X9I5S6	Streptococcus_phage	52.8	2.0e-123
ARC48449.1|610371_610998_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	62.3	3.5e-70
ARC48450.1|611099_612026_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	81.8	9.4e-144
ARC48451.1|612175_612835_-	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	59.2	1.5e-66
ARC48452.1|612969_613680_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	6.3e-15
ARC48453.1|613679_614444_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.8	8.9e-15
>prophage 5
CP020451	Streptococcus salivarius strain FDAARGOS_259 chromosome, complete genome	2259318	1070701	1108468	2259318	capsid,tRNA,terminase	Streptococcus_phage(56.67%)	35	NA	NA
ARC48870.1|1070701_1071958_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1S6UA79	Serratia_phage	41.6	3.3e-75
ARC48871.1|1072059_1074483_+	penicillin-binding protein	NA	NA	NA	NA	NA
ARC48872.1|1074842_1078424_+	DNA-directed RNA polymerase subunit beta	NA	A0A2P0VMZ3	Tetraselmis_virus	25.7	1.7e-39
ARC48873.1|1078524_1082163_+	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	25.6	5.8e-64
ARC48874.1|1082325_1082688_+	DUF1033 domain-containing protein	NA	NA	NA	NA	NA
ARC48875.1|1082769_1083711_+	competence protein CglA	NA	NA	NA	NA	NA
ARC49823.1|1083604_1084693_+	competence protein CglB	NA	NA	NA	NA	NA
ARC49824.1|1084769_1086206_-	recombinase family protein	NA	A0A2H4J6X5	uncultured_Caudovirales_phage	95.6	1.0e-261
ARC49825.1|1086356_1086941_-	hypothetical protein	NA	A0A2H4J009	uncultured_Caudovirales_phage	95.9	6.4e-74
ARC48876.1|1086955_1087333_-	ImmA/IrrE family metallo-endopeptidase	NA	F8HGP6	Streptococcus_phage	90.8	4.2e-58
ARC48877.1|1087339_1087705_-	helix-turn-helix domain-containing protein	NA	O48389	Streptococcus_phage	87.6	3.7e-51
ARC48878.1|1087873_1088077_+	XRE family transcriptional regulator	NA	A0A191KC33	Streptococcus_virus	89.6	5.9e-27
ARC48879.1|1088137_1088881_+	phage antirepressor Ant	NA	A0A2P0VK28	Streptococcus_phage	75.1	1.2e-101
ARC48880.1|1089278_1089605_+	transcriptional regulator	NA	K4JW96	Streptococcus_phage	59.8	1.1e-25
ARC48881.1|1089873_1090056_+	hypothetical protein	NA	NA	NA	NA	NA
ARC48882.1|1090468_1091881_+	hypothetical protein	NA	F8HGQ4	Streptococcus_phage	50.1	5.9e-89
ARC48883.1|1091886_1092207_+	hypothetical protein	NA	A0A2H4J2X0	uncultured_Caudovirales_phage	71.7	2.5e-35
ARC48884.1|1092242_1092425_+	hypothetical protein	NA	Q708Q3	Streptococcus_phage	61.5	1.3e-09
ARC48886.1|1093494_1094466_+	DUF1351 domain-containing protein	NA	A0A2I6QQU5	Streptococcus_phage	81.1	1.1e-131
ARC48887.1|1094462_1094966_+	single-stranded DNA-binding protein	NA	A0A2H4J1H8	uncultured_Caudovirales_phage	90.4	2.1e-81
ARC48888.1|1094974_1095436_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A2H4J7B7	uncultured_Caudovirales_phage	92.8	5.2e-79
ARC48889.1|1095432_1095669_+	hypothetical protein	NA	A0A2H4J4H9	uncultured_Caudovirales_phage	82.1	5.5e-32
ARC49826.1|1095986_1096493_+	DUF1642 domain-containing protein	NA	A0A1S5PS22	Streptococcus_phage	49.7	1.7e-43
ARC48890.1|1096768_1097077_+	DUF1372 domain-containing protein	NA	A0A286QMU5	Streptococcus_phage	88.0	6.0e-39
ARC49827.1|1097079_1097784_+	hypothetical protein	NA	A0A2H4IZZ3	uncultured_Caudovirales_phage	72.1	4.4e-93
ARC48891.1|1098523_1098940_+	autolysin	NA	C5IUI9	Streptococcus_phage	92.0	3.8e-68
ARC49828.1|1099075_1099564_+|terminase	terminase small subunit	terminase	L0P3M6	Streptococcus_phage	74.0	1.1e-53
AVH84117.1|1099550_1100855_+|terminase	PBSX family phage terminase large subunit	terminase	A0A286QNX6	Streptococcus_phage	91.0	1.0e-236
ARC48892.2|1102382_1103603_+|capsid	capsid protein	capsid	A0A286QMS2	Streptococcus_phage	78.4	2.4e-187
ARC48893.1|1103692_1104268_+	scaffolding protein	NA	A0A2H4JBH4	uncultured_Caudovirales_phage	69.9	1.0e-63
ARC48894.1|1104290_1105112_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2H4JBI0	uncultured_Caudovirales_phage	76.3	1.7e-117
ARC49829.1|1105685_1106027_+|capsid	minor capsid protein	capsid	A0A286QMS6	Streptococcus_phage	93.7	6.0e-56
ARC48895.1|1106026_1106461_+|capsid	capsid protein	capsid	A0A286QMS1	Streptococcus_phage	89.0	2.2e-55
ARC48897.1|1107441_1107837_+	hypothetical protein	NA	A0A286QNZ4	Streptococcus_phage	70.1	3.5e-39
ARC48898.1|1107805_1108468_+	hypothetical protein	NA	A0A286QMS7	Streptococcus_phage	84.1	8.3e-102
>prophage 6
CP020451	Streptococcus salivarius strain FDAARGOS_259 chromosome, complete genome	2259318	1113085	1165512	2259318	capsid,protease,tail,terminase,holin	Streptococcus_phage(71.11%)	57	NA	NA
ARC48899.1|1113085_1113814_+	hypothetical protein	NA	A0A286QMT6	Streptococcus_phage	80.2	9.7e-112
ARC48900.1|1113810_1115646_+	hypothetical protein	NA	A0A1L2JXU3	Streptococcus_phage	58.6	1.6e-171
ARC48901.1|1115648_1118141_+	hypothetical protein	NA	A0A286QMM0	Streptococcus_phage	55.9	4.7e-41
ARC48902.1|1118184_1118619_+|holin	holin	holin	F8HGP0	Streptococcus_phage	87.5	3.2e-62
ARC48903.1|1118611_1118842_+|holin	phage holin	holin	A0A2I6QR05	Streptococcus_phage	90.8	2.2e-30
ARC48904.1|1118846_1119299_+	hypothetical protein	NA	A0A2I6QR28	Streptococcus_phage	89.3	1.1e-70
ARC48905.1|1119312_1119642_+	hypothetical protein	NA	A0A2H4J011	uncultured_Caudovirales_phage	84.3	1.4e-41
ARC48906.1|1119646_1119919_+	hypothetical protein	NA	A0A2H4J827	uncultured_Caudovirales_phage	71.6	4.5e-22
ARC48907.1|1119937_1121323_+	CHAP domain-containing protein	NA	A0A286QS50	Streptococcus_phage	89.6	9.4e-249
ARC49830.1|1121999_1123436_-	recombinase family protein	NA	A0A2H4J6X5	uncultured_Caudovirales_phage	95.6	1.0e-261
ARC49831.1|1123586_1124171_-	hypothetical protein	NA	A0A2H4J009	uncultured_Caudovirales_phage	95.9	6.4e-74
ARC48908.1|1124185_1124563_-	ImmA/IrrE family metallo-endopeptidase	NA	F8HGP6	Streptococcus_phage	90.8	4.2e-58
ARC48909.1|1124569_1124935_-	helix-turn-helix domain-containing protein	NA	O48389	Streptococcus_phage	87.6	3.7e-51
ARC48910.1|1125103_1125307_+	XRE family transcriptional regulator	NA	A0A191KC33	Streptococcus_virus	89.6	5.9e-27
ARC48911.1|1125367_1126111_+	phage antirepressor Ant	NA	A0A2P0VK28	Streptococcus_phage	75.1	1.2e-101
ARC48912.1|1126508_1126835_+	transcriptional regulator	NA	K4JW96	Streptococcus_phage	59.8	1.1e-25
ARC48913.1|1127103_1127286_+	hypothetical protein	NA	NA	NA	NA	NA
ARC48914.1|1127698_1129111_+	hypothetical protein	NA	F8HGQ4	Streptococcus_phage	50.1	5.9e-89
ARC48915.1|1129116_1129437_+	hypothetical protein	NA	A0A2H4J2X0	uncultured_Caudovirales_phage	71.7	2.5e-35
ARC48916.1|1129472_1129655_+	hypothetical protein	NA	Q708Q3	Streptococcus_phage	61.5	1.3e-09
ARC48918.1|1130724_1131696_+	DUF1351 domain-containing protein	NA	A0A2I6QQU5	Streptococcus_phage	81.1	1.1e-131
ARC48919.1|1131692_1132196_+	single-stranded DNA-binding protein	NA	A0A2H4J1H8	uncultured_Caudovirales_phage	90.4	2.1e-81
ARC48920.1|1132204_1132666_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A2H4J7B7	uncultured_Caudovirales_phage	92.8	5.2e-79
ARC48921.1|1132662_1132899_+	hypothetical protein	NA	A0A2H4J4H9	uncultured_Caudovirales_phage	82.1	5.5e-32
ARC49832.1|1133216_1133723_+	DUF1642 domain-containing protein	NA	A0A1S5PS22	Streptococcus_phage	49.7	1.7e-43
ARC48922.1|1133998_1134307_+	DUF1372 domain-containing protein	NA	A0A286QMU5	Streptococcus_phage	88.0	6.0e-39
ARC49833.1|1134309_1135014_+	hypothetical protein	NA	A0A2H4IZZ3	uncultured_Caudovirales_phage	72.1	4.4e-93
ARC48923.1|1135752_1136169_+	autolysin	NA	C5IUI9	Streptococcus_phage	92.0	3.8e-68
ARC49834.1|1136304_1136793_+|terminase	terminase small subunit	terminase	L0P3M6	Streptococcus_phage	74.0	1.1e-53
ARC48924.1|1141514_1142336_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2H4JBI0	uncultured_Caudovirales_phage	76.3	1.7e-117
ARC48925.1|1142516_1142924_+	hypothetical protein	NA	C5IUJ7	Streptococcus_phage	58.1	1.8e-35
ARC49835.1|1142910_1143252_+|capsid	minor capsid protein	capsid	A0A286QMS6	Streptococcus_phage	93.7	6.0e-56
AVH84118.1|1143251_1143611_+|capsid	capsid protein	capsid	A0A286QMS1	Streptococcus_phage	89.8	8.3e-56
ARC48926.1|1143610_1144015_+|capsid	capsid protein	capsid	A0A286QML6	Streptococcus_phage	94.8	3.1e-67
ARC48928.1|1144668_1145031_+	hypothetical protein	NA	A0A286QNZ4	Streptococcus_phage	70.3	1.1e-39
ARC48929.1|1145033_1145696_+	hypothetical protein	NA	A0A286QMS7	Streptococcus_phage	84.1	8.3e-102
ARC48930.1|1145712_1150320_+|tail	phage tail protein	tail	C5IUK3	Streptococcus_phage	91.3	2.0e-263
ARC48931.1|1150316_1151045_+	hypothetical protein	NA	A0A286QMT6	Streptococcus_phage	80.2	9.7e-112
ARC48932.1|1151041_1152877_+	hypothetical protein	NA	A0A1L2JXU3	Streptococcus_phage	58.6	1.6e-171
ARC48933.1|1152879_1155372_+	hypothetical protein	NA	A0A286QMM0	Streptococcus_phage	55.9	4.7e-41
ARC48934.1|1155415_1155850_+|holin	holin	holin	F8HGP0	Streptococcus_phage	87.5	3.2e-62
ARC48935.1|1155842_1156073_+|holin	phage holin	holin	A0A2I6QR05	Streptococcus_phage	90.8	2.2e-30
ARC48936.1|1156077_1156530_+	hypothetical protein	NA	A0A2I6QR28	Streptococcus_phage	89.3	1.1e-70
ARC48937.1|1156543_1156873_+	hypothetical protein	NA	A0A2H4J011	uncultured_Caudovirales_phage	84.3	1.4e-41
ARC48938.1|1156877_1157150_+	hypothetical protein	NA	A0A2H4J827	uncultured_Caudovirales_phage	71.6	4.5e-22
ARC48939.1|1157168_1158554_+	CHAP domain-containing protein	NA	A0A286QS50	Streptococcus_phage	89.6	9.4e-249
ARC48940.1|1159174_1159477_+	competence protein ComGC	NA	NA	NA	NA	NA
ARC48941.1|1159502_1159865_+	competence protein	NA	NA	NA	NA	NA
ARC48942.1|1159836_1160127_+	competence protein ComGE	NA	NA	NA	NA	NA
ARC48943.1|1160113_1160551_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
ARC48944.1|1160528_1160846_+	competence protein ComG	NA	NA	NA	NA	NA
ARC48945.1|1160890_1161847_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
ARC48946.1|1161903_1163097_+	acetate kinase	NA	NA	NA	NA	NA
ARC48947.1|1163347_1163545_+	transcriptional regulator	NA	NA	NA	NA	NA
ARC48948.1|1163556_1164213_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
ARC48949.1|1164290_1164737_+|protease	CAAX protease	protease	NA	NA	NA	NA
ARC48950.1|1164849_1165512_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 7
CP020451	Streptococcus salivarius strain FDAARGOS_259 chromosome, complete genome	2259318	1522571	1532814	2259318		Streptococcus_phage(71.43%)	12	NA	NA
ARC49264.1|1522571_1523471_+	SPFH domain-containing protein	NA	A0A1V0SL90	Klosneuvirus	32.8	1.8e-35
ARC49265.1|1523514_1523910_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
ARC49266.1|1524025_1524919_+	ROK family protein	NA	NA	NA	NA	NA
ARC49267.1|1525073_1526168_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	81.5	1.9e-172
ARC49268.1|1526180_1526738_+	GNAT family N-acetyltransferase	NA	M1PSC3	Streptococcus_phage	56.7	5.4e-54
ARC49269.1|1526756_1527935_+	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	79.8	3.0e-179
ARC49270.1|1527989_1528484_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	45.1	1.3e-35
ARC49271.1|1528518_1528872_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	65.8	4.1e-39
ARC49272.1|1529152_1529527_+	murein hydrolase regulator LrgA	NA	NA	NA	NA	NA
ARC49273.1|1529519_1530215_+	LrgB family protein	NA	NA	NA	NA	NA
ARC49274.1|1530300_1530861_+	DNA gyrase subunit B	NA	NA	NA	NA	NA
ARC49275.1|1530861_1532814_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	45.4	7.5e-143
>prophage 8
CP020451	Streptococcus salivarius strain FDAARGOS_259 chromosome, complete genome	2259318	1792338	1815132	2259318	integrase,transposase	Streptococcus_phage(90.48%)	26	1785636:1785655	1816753:1816772
1785636:1785655	attL	AACCGCACACCGACTAACCA	NA	NA	NA	NA
ARC49406.1|1792338_1792653_+	DUF961 domain-containing protein	NA	A0A1S5SF38	Streptococcus_phage	100.0	5.2e-54
ARC49407.1|1792668_1793055_+	DUF961 domain-containing protein	NA	A0A1S5SF96	Streptococcus_phage	100.0	3.0e-64
ARC49408.1|1793083_1794469_+	DNA translocase FtsK	NA	A0A1S5SFB5	Streptococcus_phage	100.0	1.1e-265
ARC49409.1|1794471_1794624_+	conjugal transfer protein	NA	NA	NA	NA	NA
ARC49410.1|1794646_1795852_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	100.0	2.8e-233
ARC49411.1|1795894_1796116_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	100.0	4.3e-31
ARC49412.1|1796232_1796730_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	100.0	1.7e-91
ARC49413.1|1796704_1797211_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	100.0	8.6e-91
ARC49414.1|1797194_1799642_+	ATP/GTP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	100.0	0.0e+00
ARC49415.1|1799644_1801822_+	hypothetical protein	NA	A0A1S5SF30	Streptococcus_phage	100.0	0.0e+00
ARC49416.1|1801818_1802820_+	peptidase P60	NA	A0A1S5SEZ8	Streptococcus_phage	100.0	5.0e-191
ARC49417.1|1802816_1803749_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	100.0	1.1e-171
ARC49418.2|1804023_1804110_+	tetracycline resistance protein	NA	NA	NA	NA	NA
ARC49419.1|1804125_1806045_+	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	100.0	0.0e+00
ARC49420.2|1806145_1806331_+	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	67.9	3.9e-17
ARC49421.1|1806943_1807027_+	23S rRNA methyltransferase attenuator leader peptide ErmL	NA	NA	NA	NA	NA
ARC49422.1|1807151_1807889_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	1.4e-134
AVH84132.1|1807893_1808025_+	hypothetical protein	NA	E4ZFP9	Streptococcus_phage	90.7	8.2e-14
ARC49423.1|1808243_1808798_+	resolvase	NA	A0A0F7LA37	Escherichia_phage	52.1	2.3e-36
ARC49424.1|1808801_1811720_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	36.1	1.1e-169
AVH84146.1|1812219_1812291_+	hypothetical protein	NA	NA	NA	NA	NA
ARC49425.1|1812519_1812942_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	100.0	2.5e-72
ARC49426.1|1812938_1813169_+	helix-turn-helix domain-containing protein	NA	A0A1S5SEX1	Streptococcus_phage	100.0	2.7e-36
ARC49427.1|1813394_1813646_-	hypothetical protein	NA	NA	NA	NA	NA
ARC49428.1|1813629_1813833_+	excisionase	NA	A0A1S5SF07	Streptococcus_phage	100.0	4.0e-31
ARC49429.1|1813914_1815132_+|integrase	site-specific integrase	integrase	A0A1S5SEW7	Streptococcus_phage	100.0	3.7e-233
1816753:1816772	attR	AACCGCACACCGACTAACCA	NA	NA	NA	NA
>prophage 9
CP020451	Streptococcus salivarius strain FDAARGOS_259 chromosome, complete genome	2259318	2047027	2057690	2259318		Streptococcus_phage(42.86%)	11	NA	NA
ARC49630.1|2047027_2048836_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	39.4	2.5e-100
ARC49631.1|2048950_2049283_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
ARC49632.1|2049483_2050125_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
ARC49633.1|2050133_2050763_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.2	3.8e-32
ARC49634.1|2050775_2051627_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
ARC49635.1|2051740_2053156_+	DNA polymerase	NA	M1Q231	Streptococcus_phage	70.7	6.1e-195
ARC49636.1|2053152_2053530_+	hypothetical protein	NA	A0A1B0RXA8	Streptococcus_phage	45.8	9.1e-21
ARC49637.1|2053507_2053789_+	hypothetical protein	NA	M1PG86	Streptococcus_phage	58.4	1.6e-22
ARC49638.1|2053950_2054970_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.2	1.3e-26
ARC49639.1|2055253_2055838_+	N-acetyltransferase	NA	NA	NA	NA	NA
ARC49640.1|2056127_2057690_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	30.3	2.4e-19
