The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP020432	Streptococcus sp. 'group B' strain FDAARGOS_229 chromosome, complete genome	2178261	141561	157912	2178261	integrase	Streptococcus_phage(73.33%)	24	140915:140938	155221:155244
140915:140938	attL	AAAGTTAGCAAAAAAGTAAGCAAA	NA	NA	NA	NA
ARC23909.1|141561_141939_-	DUF1492 domain-containing protein	NA	Q7Y4J3	Streptococcus_phage	36.6	7.2e-10
ARC23910.1|141913_142276_-	DUF1492 domain-containing protein	NA	NA	NA	NA	NA
ARC23911.1|142299_142479_-	hypothetical protein	NA	NA	NA	NA	NA
ARC23912.1|142674_143163_-	hypothetical protein	NA	A0A1X9I5V2	Streptococcus_phage	56.2	7.3e-47
ARC23913.1|143236_143794_-	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	59.8	1.4e-30
ARC23914.1|143974_144148_-	DUF2758 domain-containing protein	NA	A0A1X9I5U0	Streptococcus_phage	57.9	3.3e-10
ARC23915.2|144432_145926_-	DNA primase	NA	A0A1X9I717	Streptococcus_phage	84.0	2.3e-245
ARC23916.1|146089_146947_-	hypothetical protein	NA	A0A1X9I6L2	Streptococcus_phage	73.8	6.0e-121
ARC23917.1|146947_147220_-	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	60.0	1.4e-18
ARC23918.1|147222_147552_-	hypothetical protein	NA	NA	NA	NA	NA
ARC23919.2|147563_147755_-	hypothetical protein	NA	NA	NA	NA	NA
ARC23920.1|147878_148211_-	hypothetical protein	NA	NA	NA	NA	NA
ARC23921.2|148465_148735_-	phage antirepressor protein	NA	NA	NA	NA	NA
ARC23922.1|148734_149358_-	phage repressor protein	NA	A0A1W6JPC3	Staphylococcus_phage	42.8	2.2e-40
ARC23923.2|149367_150120_-	BRO-like protein	NA	A0A0A7RW33	Clostridium_phage	54.1	3.3e-22
ARC23924.1|150145_150763_-	hypothetical protein	NA	A0A249XSL1	Mycobacterium_phage	37.3	1.6e-11
ARC23925.1|150779_151187_-	hypothetical protein	NA	A0A1X9I5V7	Streptococcus_phage	57.5	1.4e-35
ARC23926.1|151201_151405_-	transcriptional regulator	NA	NA	NA	NA	NA
ARC23927.1|151602_152166_+	XRE family transcriptional regulator	NA	A0A1X9I723	Streptococcus_phage	34.8	2.2e-18
ARC23928.1|152942_153797_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	52.9	8.0e-57
ARC23929.1|154037_155210_+|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	69.6	1.6e-153
ARC23930.1|155316_155928_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
155221:155244	attR	AAAGTTAGCAAAAAAGTAAGCAAA	NA	NA	NA	NA
AVH83385.1|156257_156545_-	hypothetical protein	NA	NA	NA	NA	NA
ARC23931.1|156556_157912_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	62.6	1.2e-152
>prophage 2
CP020432	Streptococcus sp. 'group B' strain FDAARGOS_229 chromosome, complete genome	2178261	237402	245507	2178261		Mollivirus(16.67%)	7	NA	NA
ARC23985.1|237402_238857_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	3.7e-54
ARC23986.1|238884_239907_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	42.7	2.0e-62
ARC23987.1|240073_240622_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.6	4.0e-25
ARC23988.1|240644_241397_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
ARC23989.1|241416_242964_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase PurH	NA	Q58MG4	Prochlorococcus_phage	48.9	2.5e-77
ARC23990.1|243156_244056_+	zoocin A	NA	A0A221J6U0	Arthrobacter_phage	45.9	4.1e-19
ARC23991.1|244202_245507_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A2D1GNZ3	Streptomyces_phage	40.5	1.7e-05
>prophage 3
CP020432	Streptococcus sp. 'group B' strain FDAARGOS_229 chromosome, complete genome	2178261	392655	463060	2178261	holin,tRNA,protease,transposase,integrase	Streptococcus_phage(70.0%)	79	418776:418791	463831:463846
ARC24120.2|392655_393321_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
ARC24121.1|393341_394112_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	34.2	2.9e-29
ARC24122.1|394181_395249_-	glutamyl aminopeptidase	NA	NA	NA	NA	NA
ARC24123.1|395433_395673_-	hypothetical protein	NA	NA	NA	NA	NA
ARC24124.1|395833_396118_+	DUF4651 domain-containing protein	NA	NA	NA	NA	NA
ARC24125.1|396114_396438_+	thioredoxin	NA	NA	NA	NA	NA
ARC24126.1|396470_397097_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
ARC24127.1|397150_397867_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
ARC24128.1|397947_398343_+	Single-stranded DNA-binding protein 2	NA	A1EAD1	Streptococcus_phage	50.0	1.9e-29
ARC24129.1|398466_399111_+	haloacid dehalogenase	NA	A0A1D8KNV9	Synechococcus_phage	29.2	1.0e-11
ARC24130.1|399137_400883_+	sensor protein LytS	NA	Q9EYF3	Enterobacteria_phage	28.6	1.5e-57
ARC24131.1|400863_401604_+	DNA-binding response regulator	NA	NA	NA	NA	NA
ARC24132.1|401773_402229_+	murein hydrolase transporter LrgA	NA	NA	NA	NA	NA
ARC24133.1|402230_402959_+|holin	antiholin LrgB	holin	NA	NA	NA	NA
ARC24134.1|403070_403181_-	hypothetical protein	NA	NA	NA	NA	NA
ARC24135.1|403201_404830_+	nickel ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
ARC24136.1|404942_405920_+	ABC transporter permease	NA	NA	NA	NA	NA
ARC24137.1|405916_406738_+	ABC transporter permease	NA	NA	NA	NA	NA
ARC24138.1|406749_407553_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.9	4.2e-07
ARC24139.1|407536_408163_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.5	6.6e-16
ARC24140.1|408444_410475_+	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
ARC24141.1|410696_412322_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
ARC24142.1|412537_414574_+	PRD domain-containing protein	NA	NA	NA	NA	NA
ARC24143.1|414576_414861_+	PTS lactose transporter subunit IIB	NA	NA	NA	NA	NA
ARC24144.1|414873_416229_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
ARC24145.1|416231_417089_+	transketolase	NA	NA	NA	NA	NA
AVH83394.1|417085_418015_+	transketolase	NA	NA	NA	NA	NA
ARC24146.1|418123_419383_+	oxidoreductase	NA	NA	NA	NA	NA
418776:418791	attL	TTTTAAAAATTTATCA	NA	NA	NA	NA
ARC24147.1|419470_419740_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
ARC24148.1|420119_422249_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
ARC24149.1|422250_423003_+	hypothetical protein	NA	NA	NA	NA	NA
ARC24150.1|423011_423596_+	serine O-acetyltransferase	NA	NA	NA	NA	NA
ARC24151.1|423605_423788_+	hypothetical protein	NA	NA	NA	NA	NA
ARC24152.1|423784_425128_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	31.7	1.0e-53
ARC24153.1|425120_425507_+	Mini-ribonuclease 3	NA	NA	NA	NA	NA
ARC24154.1|425609_426365_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
ARC24155.1|426361_426880_+	DNA-binding protein	NA	NA	NA	NA	NA
ARC24156.1|426972_427833_+	DegV family protein	NA	NA	NA	NA	NA
ARC24157.1|428369_428492_+	transcriptional regulator	NA	NA	NA	NA	NA
ARC24158.1|428713_429160_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
ARC24159.1|429180_429573_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
ARC24160.1|429706_430861_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	33.2	6.0e-47
ARC24161.1|430914_431433_-	XRE family transcriptional regulator	NA	W6LMS6	Streptococcus_phage	37.8	7.3e-05
ARC24162.1|431580_431865_+	DNA-binding protein	NA	NA	NA	NA	NA
ARC25687.1|432410_432698_+	DnaD domain protein	NA	NA	NA	NA	NA
ARC24163.1|432712_433003_+	hypothetical protein	NA	NA	NA	NA	NA
ARC24164.1|432995_433358_+|transposase	transposase	transposase	NA	NA	NA	NA
ARC24165.1|433357_433714_+|transposase	transposase	transposase	NA	NA	NA	NA
ARC24166.1|434059_434752_+	methylase	NA	A0A1D8KUI1	Synechococcus_phage	33.3	5.2e-06
ARC24167.1|434754_439158_+	restriction endonuclease	NA	A0A1V0SEE0	Indivirus	22.6	2.8e-20
ARC24168.1|439220_439709_+	hypothetical protein	NA	NA	NA	NA	NA
AVH83395.1|439760_440642_+	abortive phage resistance protein	NA	NA	NA	NA	NA
ARC24169.1|440641_441844_+	hypothetical protein	NA	NA	NA	NA	NA
ARC25688.1|441899_443348_+	ATP-dependent DNA helicase	NA	A0A1B3AYT3	Gordonia_phage	35.6	6.5e-67
ARC24170.1|444166_444457_+	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
ARC24171.1|444527_444935_+	hypothetical protein	NA	NA	NA	NA	NA
ARC24172.1|445020_445413_+	hypothetical protein	NA	NA	NA	NA	NA
ARC24173.1|445534_446752_-|integrase	site-specific integrase	integrase	A0A1S5SEW7	Streptococcus_phage	100.0	3.7e-233
ARC24174.1|446833_447037_-	excisionase	NA	A0A1S5SF07	Streptococcus_phage	100.0	4.0e-31
ARC24175.1|447020_447272_+	hypothetical protein	NA	NA	NA	NA	NA
ARC24176.1|447497_447728_-	helix-turn-helix domain-containing protein	NA	A0A1S5SEX1	Streptococcus_phage	100.0	2.7e-36
ARC24177.1|447724_448147_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	100.0	2.5e-72
ARC25689.1|448375_448447_-	hypothetical protein	NA	NA	NA	NA	NA
ARC24178.1|448651_449005_+	XRE family transcriptional regulator	NA	A0A1S5SFA6	Streptococcus_phage	100.0	1.3e-58
ARC24179.1|449064_449250_-	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	67.9	3.9e-17
ARC24180.1|449350_451270_-	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A2K5B2A5	Erysipelothrix_phage	99.7	0.0e+00
ARC24181.1|451285_451372_-	tetracycline resistance protein	NA	NA	NA	NA	NA
ARC24182.1|451646_452582_-	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	99.0	7.7e-170
ARC24183.1|452578_453580_-	peptidase P60	NA	A0A1S5SEZ8	Streptococcus_phage	100.0	5.0e-191
ARC24184.1|453576_455754_-	hypothetical protein	NA	A0A1S5SF30	Streptococcus_phage	100.0	0.0e+00
AVH83396.1|455756_458204_-	ATP/GTP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	100.0	0.0e+00
ARC24185.1|458187_458694_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	100.0	8.6e-91
ARC24186.1|458668_459166_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	100.0	1.7e-91
ARC24187.1|459282_459504_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	100.0	4.3e-31
ARC24188.1|459546_460752_-	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	100.0	2.8e-233
ARC24189.1|460774_460927_-	conjugal transfer protein	NA	NA	NA	NA	NA
ARC24190.1|460929_462315_-	DNA translocase FtsK	NA	A0A1S5SFB5	Streptococcus_phage	100.0	1.1e-265
ARC24191.1|462343_462730_-	DUF961 domain-containing protein	NA	A0A1S5SF96	Streptococcus_phage	100.0	3.0e-64
ARC24192.1|462745_463060_-	DUF961 domain-containing protein	NA	A0A1S5SF38	Streptococcus_phage	100.0	5.2e-54
463831:463846	attR	TGATAAATTTTTAAAA	NA	NA	NA	NA
>prophage 4
CP020432	Streptococcus sp. 'group B' strain FDAARGOS_229 chromosome, complete genome	2178261	719375	820492	2178261	portal,holin,capsid,head,tRNA,protease,terminase,tail,transposase,integrase	Streptococcus_phage(58.46%)	110	736789:736803	820964:820978
ARC24415.1|719375_722168_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	27.7	2.4e-86
ARC24416.1|722237_722540_-	DUF1827 domain-containing protein	NA	NA	NA	NA	NA
AVH83406.1|722603_723059_-	NUDIX hydrolase	NA	NA	NA	NA	NA
ARC24417.1|723244_725506_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2C9CYX3	Yersinia_phage	39.4	5.7e-126
AVH83407.1|725661_725766_+	hypothetical protein	NA	NA	NA	NA	NA
ARC24418.1|725803_726034_+	DUF1797 domain-containing protein	NA	NA	NA	NA	NA
ARC24419.1|726174_726867_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
ARC24420.1|726859_727594_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.8	1.1e-35
ARC24421.1|727880_729575_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	43.3	7.7e-128
ARC24422.1|729713_730568_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	40.2	1.5e-39
ARC24423.1|730564_731401_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
ARC24424.1|731526_732867_+	exodeoxyribonuclease VII large subunit	NA	L7RDW5	Acanthamoeba_polyphaga_moumouvirus	32.0	2.0e-38
ARC24425.1|732844_733060_+	exodeoxyribonuclease 7 small subunit	NA	NA	NA	NA	NA
ARC24426.1|733059_733932_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
ARC24427.1|733924_734752_+	TlyA family rRNA (cytidine-2'-O)-methyltransferase	NA	NA	NA	NA	NA
ARC24428.1|734738_735212_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
ARC24429.1|735223_736882_+	DNA repair protein RecN	NA	NA	NA	NA	NA
736789:736803	attL	TGAAGAACGTGTAGA	NA	NA	NA	NA
ARC24430.1|736994_737831_+	DegV family protein	NA	NA	NA	NA	NA
ARC24431.2|737823_738663_+	GDSL family lipase	NA	NA	NA	NA	NA
ARC24432.1|738637_739240_+	DUF2140 domain-containing protein	NA	NA	NA	NA	NA
ARC24433.1|739342_739618_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	71.9	1.2e-25
ARC24434.1|739705_740848_-|integrase	site-specific integrase	integrase	A1EAB7	Streptococcus_phage	81.6	1.1e-181
ARC24435.1|740962_741514_-	hypothetical protein	NA	A7J267	Streptococcus_phage	63.7	6.5e-60
ARC24436.1|741531_741918_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1S5SFH2	Streptococcus_phage	57.6	2.3e-35
ARC24437.1|741921_742269_-	XRE family transcriptional regulator	NA	A0A126GGQ7	Streptococcus_phage	76.1	1.3e-42
ARC24438.1|742564_742810_+	hypothetical protein	NA	X2L066	Streptococcus_phage	55.8	7.4e-08
ARC24439.1|742760_743549_-	hypothetical protein	NA	NA	NA	NA	NA
ARC24440.1|743599_743791_+	DNA-binding protein	NA	A0A141DZR9	Streptococcus_phage	69.8	4.7e-18
ARC24441.1|743870_744182_+	excisionase	NA	M1Q0Y6	Streptococcus_phage	87.3	2.9e-49
AVH83408.1|744329_744557_+	hypothetical protein	NA	NA	NA	NA	NA
ARC24442.1|744549_744780_+	hypothetical protein	NA	NA	NA	NA	NA
ARC24443.1|744763_746083_+	chromosome segregation protein SMC	NA	A0A097BY67	Enterococcus_phage	57.1	3.1e-132
ARC24444.1|746097_747171_+	hypothetical protein	NA	A0A0K2CZH1	Paenibacillus_phage	54.2	9.6e-100
ARC24445.1|747266_747872_+	hypothetical protein	NA	A0A097BY29	Enterococcus_phage	48.5	1.5e-36
ARC24446.1|747871_748480_+	hypothetical protein	NA	D2XPY9	Bacillus_virus	45.5	7.2e-44
ARC25701.1|748485_750069_+	DEAD/DEAH box helicase	NA	A0A097BY72	Enterococcus_phage	77.8	1.7e-233
ARC24447.1|750077_750275_+	hypothetical protein	NA	NA	NA	NA	NA
ARC24448.1|750267_750519_-	hypothetical protein	NA	A0A097BY83	Enterococcus_phage	52.8	1.3e-20
ARC24449.1|750589_752869_+	DNA primase	NA	Q5YA88	Bacillus_phage	62.7	4.6e-277
ARC24450.1|753238_753436_+	hypothetical protein	NA	NA	NA	NA	NA
ARC24451.1|753462_753861_+	RusA family crossover junction endodeoxyribonuclease	NA	Q5YA86	Bacillus_phage	61.2	1.7e-41
ARC24452.1|753857_754073_+	hypothetical protein	NA	NA	NA	NA	NA
ARC24453.1|754069_754306_+	DUF3310 domain-containing protein	NA	A0A097PAQ7	Streptococcus_pyogenes_phage	93.6	2.3e-38
ARC24454.1|754302_754533_+	hypothetical protein	NA	J7KK64	Streptococcus_phage	100.0	3.1e-32
ARC24455.1|754535_754868_+	hypothetical protein	NA	J7KDM7	Streptococcus_phage	55.8	2.6e-27
AVH83409.1|754945_755359_+	transcriptional regulator	NA	A7J289	Streptococcus_phage	60.6	1.2e-42
ARC24456.1|755479_755911_+|terminase	terminase small subunit	terminase	A7J290	Streptococcus_phage	93.7	3.9e-68
ARC24457.1|755900_757181_+|terminase	PBSX family phage terminase large subunit	terminase	A7J291	Streptococcus_phage	94.1	1.3e-233
ARC24458.1|757195_758725_+|portal	phage portal protein	portal	A7J292	Streptococcus_phage	83.8	6.7e-248
ARC24459.1|758690_760133_+|head	phage head morphogenesis protein	head	A7J293	Streptococcus_phage	77.5	4.9e-224
ARC24460.1|760160_760349_+	hypothetical protein	NA	A7J294	Streptococcus_phage	77.4	3.7e-15
ARC24461.1|760353_760557_+	hypothetical protein	NA	A0A097PAR8	Streptococcus_pyogenes_phage	53.4	1.3e-13
ARC24462.1|760699_761269_+	DUF4355 domain-containing protein	NA	A7J296	Streptococcus_phage	89.9	1.5e-72
ARC24463.1|761287_762184_+|capsid	phage capsid protein	capsid	A7J297	Streptococcus_phage	94.6	2.4e-152
ARC24464.1|762189_762546_+	hypothetical protein	NA	A7J298	Streptococcus_phage	62.7	6.7e-34
ARC24465.1|762556_762835_+	hypothetical protein	NA	A7J299	Streptococcus_phage	98.9	4.2e-47
ARC24466.1|762831_763176_+	hypothetical protein	NA	A7J2A0	Streptococcus_phage	93.0	6.9e-52
ARC24467.1|763179_763539_+	hypothetical protein	NA	A7J2A1	Streptococcus_phage	74.6	5.6e-44
ARC24468.1|763550_764183_+|tail	phage major tail protein, TP901-1 family	tail	A7J2A2	Streptococcus_phage	68.6	2.6e-60
ARC24469.1|764233_764689_+	hypothetical protein	NA	A7J2A3	Streptococcus_phage	70.9	3.1e-55
ARC24470.1|764763_764994_+	hypothetical protein	NA	A7J2A4	Streptococcus_phage	59.2	2.2e-14
ARC24471.1|765022_769249_+|tail	phage tail protein	tail	A7J2A5	Streptococcus_phage	46.6	1.1e-21
ARC24472.1|769261_770104_+|tail	phage tail protein	tail	A7J2A6	Streptococcus_phage	48.6	3.4e-76
ARC24473.1|770116_773944_+	N-acetylmuramoyl-L-alanine amidase	NA	A7J2A7	Streptococcus_phage	49.2	2.9e-162
ARC24474.1|774115_774532_+	DUF1366 domain-containing protein	NA	NA	NA	NA	NA
ARC24475.1|774765_775062_+	hypothetical protein	NA	Q938J6	Temperate_phage	84.7	1.2e-39
ARC24476.1|775063_775402_+|holin	phage holin	holin	A0A1P8VVK6	Streptococcus_phage	71.4	6.8e-36
ARC24477.1|775403_776123_+	CHAP domain-containing protein	NA	A0A1U9WRD0	Streptococcus_virus	70.3	7.2e-59
ARC24478.1|776461_777421_+	abortive phage resistance protein	NA	A0A059NT88	Lactococcus_phage	38.7	1.3e-58
ARC24479.1|777575_777776_+	CsbD family protein	NA	J7KJ36	Streptococcus_phage	87.9	7.4e-22
ARC24480.1|777816_777987_-	hypothetical protein	NA	A0A286QNA2	Streptococcus_phage	63.8	1.1e-07
ARC24481.1|778406_778586_+	Paratox	NA	J7KIW4	Streptococcus_phage	86.4	2.1e-20
ARC24482.1|778991_779189_+	hypothetical protein	NA	NA	NA	NA	NA
ARC24483.1|779232_780165_-	dihydroorotate oxidase	NA	A0A1V0SH91	Hokovirus	43.4	3.9e-65
ARC24484.1|780352_781588_-	aminoacyltransferase	NA	NA	NA	NA	NA
AVH83410.1|781606_782818_-	aminoacyltransferase	NA	NA	NA	NA	NA
ARC25702.1|782830_784051_-	aminoacyltransferase	NA	NA	NA	NA	NA
ARC24485.1|784050_784863_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
ARC24486.1|784934_786251_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	29.6	8.1e-24
ARC25703.1|786326_786713_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
ARC24487.1|787056_789741_+	calcium-translocating P-type ATPase, PMCA-type	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	29.3	1.1e-70
ARC24488.1|790797_792729_+	fructose-bisphosphatase class III	NA	NA	NA	NA	NA
ARC24489.1|792818_793943_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
ARC24490.2|794011_795109_+	peptide chain release factor 2	NA	NA	NA	NA	NA
ARC24491.1|795128_795821_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	35.1	1.3e-28
ARC24492.1|795804_796734_+	ABC transporter permease	NA	NA	NA	NA	NA
AVH83500.1|796918_798152_+|transposase	IS3-like element IS861 family transposase	transposase	A0A1B1P773	Bacillus_phage	50.4	6.8e-65
ARC24493.1|798222_798933_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
ARC24494.1|798929_799628_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	64.9	1.5e-82
ARC24495.1|799795_800560_+	3-oxoacyl-ACP reductase	NA	V5L4T3	Hirudovirus	31.8	9.8e-06
ARC24496.1|800667_803175_+	bifunctional DnaQ family exonuclease/ATP-dependent helicase	NA	A0A1X9I5C8	Streptococcus_phage	50.5	1.4e-218
ARC24497.1|803260_804454_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
ARC24498.1|804474_805821_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	31.2	3.7e-56
ARC24499.1|805860_806418_-	ECF transporter S component	NA	NA	NA	NA	NA
ARC24500.1|806414_807398_-	nucleoside hydrolase	NA	NA	NA	NA	NA
AVH83411.1|807430_807547_-	hypothetical protein	NA	NA	NA	NA	NA
ARC24501.1|807643_808057_-	osmotically inducible protein OsmC	NA	NA	NA	NA	NA
ARC24502.1|808210_809101_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.1	7.4e-05
ARC24503.1|809097_810072_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	78.8	9.8e-144
ARC24504.1|810068_810980_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	65.7	1.4e-107
ARC24505.1|810994_812392_+	dipeptidase	NA	NA	NA	NA	NA
ARC24506.1|812533_814054_+	zinc ABC transporter substrate-binding protein AdcA	NA	NA	NA	NA	NA
ARC24507.1|814166_814427_-	50S ribosomal protein L31 type B	NA	NA	NA	NA	NA
ARC24508.1|814535_815471_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
ARC24509.1|815736_816759_+	adenosine deaminase	NA	NA	NA	NA	NA
ARC24510.1|816817_817261_+	flavodoxin	NA	NA	NA	NA	NA
ARC24511.1|817337_817613_+	chorismate mutase	NA	NA	NA	NA	NA
ARC24512.1|817605_818802_+	voltage-gated chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	54.5	3.6e-103
ARC24513.1|819385_819733_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
ARC25704.1|819877_820492_-|integrase	site-specific integrase	integrase	F8HGP4	Streptococcus_phage	60.7	9.2e-55
820964:820978	attR	TGAAGAACGTGTAGA	NA	NA	NA	NA
>prophage 5
CP020432	Streptococcus sp. 'group B' strain FDAARGOS_229 chromosome, complete genome	2178261	1046066	1055397	2178261	capsid	Streptococcus_phage(50.0%)	8	NA	NA
ARC24700.1|1046066_1047284_+	macrolide efflux MFS transporter Mef(A)	NA	A0A2K5B2B5	Erysipelothrix_phage	90.6	5.1e-198
ARC24701.1|1047403_1048867_+	ABC-F type ribosomal protection protein Msr(D)	NA	A0A1B0RXA0	Streptococcus_phage	97.3	3.7e-251
ARC24702.1|1048984_1049275_-	DNA methylase N-4/N-6	NA	A0A1B0RX98	Streptococcus_phage	82.5	1.7e-11
ARC24703.1|1049274_1049487_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
ARC24704.1|1049613_1049808_+	hypothetical protein	NA	NA	NA	NA	NA
ARC24705.1|1049798_1052123_+	nucleoside triphosphatase	NA	A0A2H4J4H0	uncultured_Caudovirales_phage	30.9	2.1e-99
ARC24706.1|1052541_1053489_+|capsid	phage major capsid protein	capsid	Q6DMU0	Streptococcus_phage	31.3	8.4e-39
ARC24707.1|1053744_1055397_+	recombinase	NA	C7F8K5	Bacillus_phage	27.7	1.7e-26
>prophage 6
CP020432	Streptococcus sp. 'group B' strain FDAARGOS_229 chromosome, complete genome	2178261	1305951	1366652	2178261	holin,portal,capsid,head,protease,tail,terminase,transposase	Streptococcus_phage(89.74%)	62	NA	NA
ARC24907.1|1305951_1307952_-|portal	portal protein	portal	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	34.8	2.5e-69
ARC24908.1|1308909_1309902_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
ARC24909.1|1309927_1310812_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
AVH83440.1|1310808_1311645_-	NAD(+) kinase	NA	NA	NA	NA	NA
ARC24910.1|1311619_1312291_-	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
ARC24911.1|1312400_1312973_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
ARC24912.1|1313149_1314124_+	ribose-phosphate pyrophosphokinase 2	NA	A0A2K9L2G2	Tupanvirus	33.8	1.6e-37
ARC24913.1|1314127_1315243_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	27.0	2.4e-29
ARC24914.1|1315244_1315592_+	cysteine desulfurase	NA	NA	NA	NA	NA
ARC24915.1|1315752_1316385_+	transcriptional regulator	NA	NA	NA	NA	NA
ARC24916.1|1316397_1317078_-	JAB domain-containing protein	NA	NA	NA	NA	NA
ARC24917.1|1317173_1318307_-	AI-2E family transporter	NA	NA	NA	NA	NA
AVH83441.1|1318397_1319834_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
ARC24918.1|1319996_1320611_-	lipase	NA	NA	NA	NA	NA
ARC24919.1|1320711_1321533_-	HAD family hydrolase	NA	NA	NA	NA	NA
ARC24920.1|1321652_1323218_-	recombinase family protein	NA	Q6DMS5	Streptococcus_phage	61.5	8.0e-180
ARC24921.1|1323220_1324429_-	recombinase family protein	NA	Q6DMS6	Streptococcus_phage	49.7	1.8e-102
ARC24922.1|1324643_1325045_-	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
ARC24923.1|1325154_1326624_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1X9I678	Streptococcus_phage	78.9	1.8e-226
ARC24924.1|1326625_1327030_-|holin	holin	holin	D0R0E9	Streptococcus_phage	74.8	3.0e-46
ARC24925.1|1327047_1328904_-	hypothetical protein	NA	Q6DMS9	Streptococcus_phage	73.3	2.5e-257
ARC24926.1|1328916_1331832_-	carbamoylsarcosine amidase	NA	Q6DMT0	Streptococcus_phage	64.8	0.0e+00
ARC24927.1|1331831_1332557_-|tail	phage tail protein	tail	Q6DMT1	Streptococcus_phage	57.9	1.4e-81
ARC24928.1|1332553_1335673_-|tail	phage tail tape measure protein	tail	Q6DMT2	Streptococcus_phage	76.7	2.0e-254
ARC24929.1|1335855_1336275_-	hypothetical protein	NA	A0A1X9I691	Streptococcus_phage	76.3	1.3e-55
ARC24930.1|1336286_1336856_-|tail	phage tail protein	tail	A0A1B0RXE2	Streptococcus_phage	93.6	1.5e-96
ARC24931.1|1336858_1337185_-	hypothetical protein	NA	M1Q1Z4	Streptococcus_phage	69.4	8.3e-39
ARC24932.1|1337193_1337562_-	hypothetical protein	NA	Q6DMT7	Streptococcus_phage	62.9	7.0e-34
ARC24933.1|1337554_1337893_-|head,tail	head-tail adaptor protein	head,tail	A0A1B0RXJ6	Streptococcus_phage	70.5	4.3e-38
ARC24934.1|1337892_1338150_-|head,tail	phage gp6-like head-tail connector protein	head,tail	D0R0D7	Streptococcus_phage	78.8	9.5e-30
ARC24935.1|1338146_1339355_-|capsid	phage major capsid protein	capsid	E4ZFM5	Streptococcus_phage	91.3	1.0e-211
ARC24936.1|1339367_1340066_-|protease	Clp protease ClpP	protease	A0A1B0RXE1	Streptococcus_phage	83.6	5.8e-106
ARC24937.1|1340058_1341354_-|portal	phage portal protein	portal	A0A1B0RXD8	Streptococcus_phage	89.3	8.0e-226
ARC24938.1|1341422_1341626_-	hypothetical protein	NA	NA	NA	NA	NA
ARC24939.1|1341695_1342034_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
ARC24940.1|1342026_1342320_-	antitoxin	NA	NA	NA	NA	NA
ARC24941.1|1342386_1343979_-|terminase	terminase large subunit	terminase	A0A1B0RXJ8	Streptococcus_phage	95.8	6.0e-308
ARC24942.1|1343975_1344449_-|terminase	phage terminase small subunit P27 family	terminase	A0A1X9I6K0	Streptococcus_phage	96.8	1.5e-84
ARC24943.1|1344497_1344947_-	DUF4314 domain-containing protein	NA	A0A1X9I6A3	Streptococcus_phage	67.1	4.1e-20
ARC24944.1|1344948_1345200_-	hypothetical protein	NA	M1PG57	Streptococcus_phage	59.3	5.8e-16
ARC24945.1|1345261_1346542_-	DNA (cytosine-5-)-methyltransferase	NA	M1NSK8	Streptococcus_phage	92.3	2.2e-231
ARC24946.1|1346538_1347795_-	DNA modification methylase	NA	A0A1B0RXE5	Streptococcus_phage	90.9	3.0e-225
ARC24947.1|1347766_1348222_-	hypothetical protein	NA	M1Q209	Streptococcus_phage	50.3	1.0e-42
ARC25722.1|1348510_1348876_-	HNH endonuclease	NA	A0A1B0RXJ3	Streptococcus_phage	88.4	3.2e-63
ARC24948.1|1349962_1350145_-	hypothetical protein	NA	A0A1B0RXC3	Streptococcus_phage	86.7	1.7e-20
ARC24949.1|1350339_1350816_-	hypothetical protein	NA	A0A1B0RXB9	Streptococcus_phage	84.2	3.2e-71
ARC24950.1|1350808_1352185_-	ATP-dependent helicase	NA	A0A1X9I6B0	Streptococcus_phage	86.7	1.6e-232
ARC24951.1|1352165_1352447_-	VRR-NUC domain-containing protein	NA	M1PFY8	Streptococcus_phage	84.9	2.2e-40
ARC24952.1|1352727_1355016_-	DNA primase	NA	A0A1B0RXC5	Streptococcus_phage	87.9	0.0e+00
ARC24953.1|1355374_1355698_+	hypothetical protein	NA	D0R0B4	Streptococcus_phage	72.9	8.8e-33
ARC24954.1|1355690_1356812_+	DUF2800 domain-containing protein	NA	M1Q218	Streptococcus_phage	90.9	3.5e-201
ARC24955.1|1356816_1357380_+	DUF2815 domain-containing protein	NA	A0A1B0RXA9	Streptococcus_phage	92.8	1.5e-91
ARC25723.1|1357614_1359570_+	DNA polymerase I	NA	E4ZFK1	Streptococcus_phage	86.2	0.0e+00
ARC24956.1|1359631_1360174_-	hypothetical protein	NA	NA	NA	NA	NA
ARC24957.1|1360335_1360932_-	hypothetical protein	NA	A0A1B0RXB3	Streptococcus_phage	27.9	4.6e-11
ARC24958.1|1361364_1362489_+	hypothetical protein	NA	NA	NA	NA	NA
ARC24959.1|1362488_1362713_+	hypothetical protein	NA	NA	NA	NA	NA
AVH83503.1|1363483_1364362_+	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
ARC24961.1|1364351_1364561_+	transcriptional regulator	NA	A0A2K5B263	Erysipelothrix_phage	58.5	4.8e-16
ARC24962.1|1364819_1365170_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
ARC24963.1|1365223_1365409_+|transposase	transposase	transposase	NA	NA	NA	NA
ARC24964.1|1365380_1366652_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
>prophage 7
CP020432	Streptococcus sp. 'group B' strain FDAARGOS_229 chromosome, complete genome	2178261	1441771	1515765	2178261	tRNA,tail,transposase,protease	Bacillus_phage(30.77%)	57	NA	NA
AVH83504.1|1441771_1443006_-|transposase	IS3-like element IS861 family transposase	transposase	A0A1B1P773	Bacillus_phage	50.4	6.8e-65
ARC25029.1|1443192_1443960_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
ARC25030.1|1443968_1444679_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
ARC25031.1|1444662_1445919_-	voltage-gated chloride channel family protein	NA	NA	NA	NA	NA
ARC25032.1|1445920_1446730_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
ARC25033.1|1446768_1447176_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	52.3	7.7e-34
ARC25034.1|1447226_1448438_-	phosphopentomutase	NA	NA	NA	NA	NA
AVH83450.1|1448494_1449166_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
ARC25035.1|1449403_1450114_-|protease	Zn-dependent protease	protease	NA	NA	NA	NA
ARC25036.1|1450203_1450992_-	esterase family protein	NA	NA	NA	NA	NA
ARC25037.1|1451048_1452710_-	ribonuclease J	NA	NA	NA	NA	NA
ARC25038.1|1453006_1453768_-	phosphonate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.3	3.1e-12
ARC25039.1|1453767_1454631_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
ARC25040.1|1454643_1455648_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
ARC25041.1|1456006_1457662_+	DUF814 domain-containing protein	NA	A0A1J0F9J4	Only_Syngen_Nebraska_virus	41.0	2.3e-07
ARC25042.1|1457715_1458435_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
ARC25043.1|1458448_1460131_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
ARC25044.1|1460240_1461467_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
ARC25045.1|1461456_1462647_-	AI-2E family transporter	NA	NA	NA	NA	NA
ARC25046.1|1462738_1463200_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
ARC25047.1|1463189_1463672_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
ARC25048.1|1463888_1467107_+	hyaluronate lyase	NA	NA	NA	NA	NA
ARC25049.1|1467158_1468205_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.6	6.6e-69
ARC25050.1|1468411_1469005_-	dTDP-4-keto-6-deoxy-D-glucose epimerase	NA	NA	NA	NA	NA
ARC25051.1|1469004_1469874_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	62.2	2.7e-100
AVH83451.1|1469932_1471036_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
ARC25052.1|1471044_1471833_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
ARC25053.1|1471822_1472506_-|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
ARC25054.1|1472609_1473290_-	DNA replication protein DnaD	NA	Q938N2	Temperate_phage	31.8	1.9e-08
ARC25055.1|1473407_1473926_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.1	4.6e-31
ARC25056.1|1474048_1476613_-	hypothetical protein	NA	NA	NA	NA	NA
ARC25057.1|1476596_1476695_-	hypothetical protein	NA	NA	NA	NA	NA
ARC25058.1|1476764_1478963_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.1	1.2e-72
ARC25059.1|1478959_1479721_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
ARC25060.1|1479722_1480652_-	ribonuclease Z	NA	NA	NA	NA	NA
ARC25061.1|1480693_1481341_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
ARC25062.1|1481333_1482572_-	GTPase HflX	NA	NA	NA	NA	NA
ARC25063.1|1482662_1483553_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
ARC25064.1|1483663_1483840_+	DUF3042 domain-containing protein	NA	NA	NA	NA	NA
ARC25065.1|1484934_1488693_-	pullulanase	NA	NA	NA	NA	NA
ARC25066.1|1488861_1489596_-	hypothetical protein	NA	NA	NA	NA	NA
ARC25067.1|1489610_1490195_-	uracil-DNA glycosylase	NA	NA	NA	NA	NA
ARC25068.1|1490291_1491698_-	dipeptidase PepV	NA	NA	NA	NA	NA
ARC25069.1|1491744_1492347_-	nitroreductase family protein	NA	NA	NA	NA	NA
ARC25070.1|1492516_1494298_+	glycerophosphodiester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	25.0	4.6e-06
AVH83505.1|1494354_1495589_-|transposase	IS3-like element IS861 family transposase	transposase	A0A1B1P773	Bacillus_phage	50.4	6.8e-65
ARC25071.1|1495774_1497556_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
AVH83452.1|1497714_1498482_+	DNA integration/recombination/inversion protein	NA	NA	NA	NA	NA
ARC25072.1|1498540_1499881_-	MATE family efflux transporter	NA	NA	NA	NA	NA
ARC25724.1|1499980_1500391_-	VOC family protein	NA	NA	NA	NA	NA
ARC25073.1|1500400_1500898_-|tail	phage tail protein	tail	NA	NA	NA	NA
AVH83453.1|1501119_1501716_+	hypothetical protein	NA	NA	NA	NA	NA
AVH83454.1|1501904_1503009_+|transposase	IS3-like element ISSag2 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	48.9	6.3e-70
ARC25075.1|1504843_1507312_-	pneumococcal-type histidine triad protein	NA	NA	NA	NA	NA
ARC25076.1|1507324_1508245_-	metal ABC transporter substrate-binding lipoprotein/laminin-binding adhesin Lmb	NA	NA	NA	NA	NA
AVH83455.1|1510336_1513777_-	peptidase C5	NA	A0A218KC60	Bacillus_phage	39.4	7.6e-05
ARC25077.1|1514430_1515765_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
>prophage 8
CP020432	Streptococcus sp. 'group B' strain FDAARGOS_229 chromosome, complete genome	2178261	1793658	1805154	2178261	transposase	Streptococcus_phage(90.91%)	15	NA	NA
ARC25312.1|1793658_1794486_+	exodeoxyribonuclease	NA	M1PSC0	Streptococcus_phage	78.0	4.3e-124
ARC25313.1|1794525_1794882_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	72.6	5.2e-42
ARC25314.1|1794883_1795360_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	50.9	7.1e-39
ARC25315.1|1796637_1797186_-	acetyltransferase	NA	M1PSC3	Streptococcus_phage	58.4	1.1e-54
ARC25316.1|1797253_1798345_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	77.1	1.3e-163
AVH83473.1|1798477_1799113_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
ARC25317.1|1799156_1799261_-	hypothetical protein	NA	NA	NA	NA	NA
ARC25318.1|1799245_1799407_+	hypothetical protein	NA	NA	NA	NA	NA
ARC25737.1|1799382_1800246_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	70.4	3.7e-110
ARC25319.1|1800251_1800578_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	61.1	3.2e-30
ARC25320.1|1800607_1801471_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	49.0	3.1e-72
ARC25321.1|1801490_1802126_-	thymidylate kinase	NA	M1PSC7	Streptococcus_phage	61.1	2.8e-67
ARC25322.1|1802334_1803501_+|transposase	IS30-like element ISSag9 family transposase	transposase	NA	NA	NA	NA
ARC25323.1|1803765_1804425_-	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	56.0	8.0e-65
ARC25324.1|1804443_1805154_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.1	5.2e-17
