The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP020424	Clostridioides difficile strain FDAARGOS_267 chromosome, complete genome	4109635	620168	629895	4109635		Pandoravirus(37.5%)	11	NA	NA
ARC14027.1|620168_621341_-	RNA polymerase sigma factor RpoD	NA	M4SMP8	Cyanophage	36.8	9.7e-37
ARC14028.1|621352_623143_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	32.6	1.2e-51
ARC14029.1|623397_624183_-	3-deoxy-7-phosphoheptulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	27.9	1.7e-13
ARC14030.1|624163_624670_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4VNV0	Pandoravirus	35.2	2.7e-12
ARC16765.1|624662_625028_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AVI58798.1|625038_625842_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	28.8	4.9e-24
ARC14031.1|625893_626466_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	51.6	3.0e-44
ARC14032.1|626491_627193_-	hypothetical protein	NA	NA	NA	NA	NA
ARC14033.1|627226_627970_-	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
ARC14034.1|627959_629318_-	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	41.2	2.3e-37
ARC14035.1|629310_629895_-	type 1 glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	52.6	1.4e-57
>prophage 2
CP020424	Clostridioides difficile strain FDAARGOS_267 chromosome, complete genome	4109635	711931	764126	4109635	plate,portal,tRNA,tail,protease	Clostridium_phage(43.48%)	55	NA	NA
ARC14096.1|711931_712330_+	transcriptional regulator	NA	A0A1L2JY18	Aeribacillus_phage	29.7	2.7e-07
ARC14097.1|712546_712768_-	hypothetical protein	NA	NA	NA	NA	NA
ARC14098.1|712787_712997_-	XRE family transcriptional regulator	NA	Q5YAA3	Bacillus_phage	47.2	5.9e-06
ARC14099.1|713295_713715_+	XRE family transcriptional regulator	NA	S5MUV6	Brevibacillus_phage	37.2	5.4e-06
ARC14100.1|713942_714398_+	hypothetical protein	NA	NA	NA	NA	NA
ARC14101.1|714553_715366_-|tail	phage tail protein	tail	A0A0A8WES5	Clostridium_phage	62.6	1.6e-75
ARC14102.1|715367_715985_-	DUF2313 domain-containing protein	NA	J9QD29	Clostridium_phage	63.9	4.1e-71
ARC14103.1|715984_717034_-|plate	baseplate protein J	plate	J9QDY7	Clostridium_phage	67.4	1.2e-131
ARC14104.1|717026_717458_-	DUF2634 domain-containing protein	NA	A0A0K2SUB3	Clostridium_phage	82.3	9.3e-62
ARC14105.1|717457_717784_-	DUF2577 domain-containing protein	NA	J9QE86	Clostridium_phage	57.4	1.3e-31
ARC14106.1|717797_719315_-	cell wall hydrolase	NA	A0A0A8WF62	Clostridium_phage	83.4	4.3e-247
ARC14107.1|719583_720006_-	hypothetical protein	NA	A0A1V0DZX0	Clostridioides_phage	65.0	9.4e-51
AVI58802.1|720005_722336_-	hypothetical protein	NA	A0A1V0DZX3	Clostridioides_phage	59.7	1.7e-16
ARC14108.1|722335_722503_-	hypothetical protein	NA	NA	NA	NA	NA
ARC14109.1|722529_722976_-|portal	phage portal protein	portal	A0A0A7RTP2	Clostridium_phage	36.4	1.1e-12
ARC14110.1|723089_723518_-|portal	phage portal protein	portal	A0A1V0DZX1	Clostridioides_phage	51.8	4.8e-34
ARC14111.1|723531_724596_-|tail	phage tail sheath protein	tail	A0A1V0DZX4	Clostridioides_phage	53.7	1.6e-99
ARC14112.1|724600_725044_-	hypothetical protein	NA	A0A1V0DZX9	Clostridioides_phage	35.4	1.3e-18
ARC14113.1|725292_725733_-	hypothetical protein	NA	A0A090EUN5	Clostridium_phage	51.4	6.0e-32
ARC14114.1|725837_726035_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
ARC14115.1|726203_726524_+	XRE family transcriptional regulator	NA	A0A0A8WE28	Clostridium_phage	54.5	3.7e-23
ARC14116.1|726605_727112_+	hypothetical protein	NA	A0A0A8WEK1	Clostridium_phage	67.1	4.0e-56
ARC14117.1|727275_727692_+	hypothetical protein	NA	NA	NA	NA	NA
ARC14118.1|727812_728568_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
ARC14119.1|728710_729139_-	CBS domain-containing protein	NA	NA	NA	NA	NA
ARC14120.1|729559_729760_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	66.2	2.7e-16
ARC14121.1|729942_731097_-	amidase domain-containing protein	NA	NA	NA	NA	NA
ARC14122.1|731347_732169_+	pyridoxamine kinase	NA	NA	NA	NA	NA
ARC14123.1|732244_733633_-	sensor histidine kinase	NA	NA	NA	NA	NA
ARC14124.1|733767_734526_-	lantibiotic immunity ABC transporter MutG family permease subunit	NA	NA	NA	NA	NA
ARC14125.1|734527_735244_-	lantibiotic immunity ABC transporter MutE/EpiE family permease subunit	NA	NA	NA	NA	NA
ARC14126.1|735245_735953_-	lantibiotic ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	48.5	1.2e-55
ARC14127.1|736068_736605_-	lipoprotein	NA	NA	NA	NA	NA
ARC14128.1|736706_737777_-	hypothetical protein	NA	NA	NA	NA	NA
ARC14129.1|737769_738852_-	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
ARC14130.1|738838_739171_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AVI59022.1|739369_740491_+	galactosyldiacylglycerol synthase	NA	NA	NA	NA	NA
ARC14131.1|740618_742517_-	glutamine synthetase	NA	NA	NA	NA	NA
ARC14132.1|742831_743608_+	exonuclease	NA	NA	NA	NA	NA
ARC14133.1|743699_744452_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	45.6	1.9e-57
AVI58803.1|744612_745563_-	galactose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
ARC14134.1|745947_747144_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
ARC14135.1|747478_747931_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
ARC14136.1|748242_749688_-	adenylosuccinate lyase	NA	NA	NA	NA	NA
ARC14137.2|749831_750740_-	recombinase	NA	NA	NA	NA	NA
ARC14138.1|750996_751821_+	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
ARC14139.1|751860_752391_+	signal peptidase I	NA	NA	NA	NA	NA
ARC14140.1|752472_754254_-	DNA helicase	NA	NA	NA	NA	NA
ARC16771.1|754888_756430_-	ribonuclease Y	NA	NA	NA	NA	NA
ARC14141.1|756605_757652_-	DNA recombination/repair protein RecA	NA	A0A0S2MVG1	Bacillus_phage	63.5	2.7e-123
ARC14142.1|757939_758482_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
ARC14143.1|758468_759803_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
ARC14144.1|759796_760855_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
ARC14145.1|760857_763269_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	50.4	3.3e-92
ARC14146.1|763391_764126_-|protease	Clp protease	protease	NA	NA	NA	NA
>prophage 3
CP020424	Clostridioides difficile strain FDAARGOS_267 chromosome, complete genome	4109635	1842103	1935065	4109635	integrase,head,terminase,portal,coat,capsid,tail	Clostridium_phage(74.7%)	113	1876753:1876769	1929175:1929191
ARC15006.1|1842103_1842772_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	46.9	4.1e-24
ARC15007.1|1842801_1843785_-	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	46.7	1.9e-78
ARC15008.1|1843822_1844380_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	53.6	1.3e-47
ARC15009.1|1844428_1845298_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	61.5	4.7e-97
ARC15010.1|1845406_1846279_-	dTDP-4-dehydrorhamnose reductase	NA	H9NCE8	Sphingomonas_phage	30.0	2.3e-14
ARC15011.1|1846484_1850291_-	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	24.5	1.0e-31
ARC15012.1|1850315_1851566_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
ARC15013.1|1851576_1853109_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/inosine monophosphate cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	49.7	2.3e-38
ARC15014.1|1853101_1853695_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.4	4.3e-25
ARC15015.1|1853688_1854765_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	R9TMC7	Synechococcus_phage	42.2	2.2e-64
ARC15016.1|1854758_1856126_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.0	2.6e-49
ARC15017.1|1856137_1856836_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	43.9	1.5e-45
ARC15018.1|1856841_1857318_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	45.8	6.9e-26
ARC15019.1|1857767_1858280_+	nitroreductase family protein	NA	A0A1V0E011	Clostridioides_phage	87.6	3.5e-84
ARC15020.1|1858691_1858907_+	hypothetical protein	NA	NA	NA	NA	NA
ARC15021.1|1858912_1859206_+|coat	spore coat protein	coat	NA	NA	NA	NA
ARC15022.1|1859400_1860117_-	HAD family hydrolase	NA	NA	NA	NA	NA
ARC15023.1|1860204_1861470_-	sugar-phosphate kinase	NA	NA	NA	NA	NA
ARC15024.1|1861573_1861882_-	PTS system fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
ARC15025.1|1861948_1863004_-	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
ARC15026.1|1863005_1863458_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
AVI58860.1|1863454_1865485_-	PRD domain-containing protein	NA	NA	NA	NA	NA
ARC15027.1|1865740_1867975_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
ARC15028.1|1868293_1871722_+	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	37.4	1.4e-176
ARC15029.1|1872031_1872268_+	hypothetical protein	NA	NA	NA	NA	NA
ARC15030.1|1872396_1872963_-	chromate transporter	NA	NA	NA	NA	NA
ARC15031.1|1872959_1873523_-	chromate transporter	NA	NA	NA	NA	NA
ARC15032.1|1873642_1874518_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVI58861.1|1874665_1876057_-	metallophosphatase	NA	NA	NA	NA	NA
1876753:1876769	attL	TATCATTTTAGTATCAC	NA	NA	NA	NA
ARC15033.1|1876776_1877157_-	transcriptional regulator	NA	A0A0A8WJP7	Clostridium_phage	88.2	6.1e-57
ARC15034.2|1877249_1877639_-	transcriptional regulator	NA	J9QE23	Clostridium_phage	100.0	4.4e-63
ARC15035.1|1878822_1879011_+	hypothetical protein	NA	A0A0A8WJ69	Clostridium_phage	100.0	3.1e-30
ARC15036.1|1879712_1880234_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A090D850	Clostridium_phage	100.0	1.6e-95
ARC15037.1|1880209_1881796_+	hypothetical protein	NA	A0A090DBU6	Clostridium_phage	100.0	2.6e-303
ARC15038.2|1881859_1882378_-	hypothetical protein	NA	A0A090EUG6	Clostridium_phage	100.0	3.2e-85
ARC15039.1|1882543_1882906_-	hypothetical protein	NA	A0A090DCS4	Clostridium_phage	100.0	6.0e-62
ARC15040.1|1882986_1883799_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A090D823	Clostridium_phage	99.6	9.3e-156
AVI58862.1|1883798_1884290_-	protein utxA	NA	J9QD30	Clostridium_phage	96.5	5.6e-71
ARC15041.1|1884297_1884516_-	hypothetical protein	NA	NA	NA	NA	NA
ARC15042.1|1884611_1884794_-	hypothetical protein	NA	X5JAB9	Clostridium_phage	95.0	5.5e-24
ARC15043.1|1884793_1885087_-	hypothetical protein	NA	E2ELK3	Clostridium_phage	74.7	1.2e-36
ARC15044.1|1885102_1886791_-	hypothetical protein	NA	A0A0A8WJP3	Clostridium_phage	85.5	5.8e-184
ARC15045.1|1886805_1887831_-|tail	phage tail protein	tail	A3QSB7	Clostridium_virus	97.1	5.5e-161
ARC15046.1|1887842_1888460_-	DUF2313 domain-containing protein	NA	A0A0A8WII4	Clostridium_phage	100.0	3.2e-116
ARC15047.1|1888452_1889502_-|tail	phage tail protein	tail	A0A0A8WFK0	Clostridium_phage	98.0	2.3e-191
ARC15048.1|1889502_1889922_-	DUF2634 domain-containing protein	NA	X5JB38	Clostridium_phage	97.8	2.5e-72
ARC15049.1|1889926_1890187_-	DUF2577 domain-containing protein	NA	A3QSB4	Clostridium_virus	100.0	1.7e-39
ARC15050.1|1890200_1892171_-	cell wall hydrolase	NA	A0A0A8WIF2	Clostridium_phage	98.8	0.0e+00
ARC15051.1|1892163_1892853_-	LysM peptidoglycan-binding domain-containing protein	NA	X5J9Z8	Clostridium_phage	95.2	4.1e-120
ARC15052.1|1892868_1895238_-	hypothetical protein	NA	X5JAB7	Clostridium_phage	71.4	1.4e-297
ARC15053.1|1895304_1896075_-	DUF4428 domain-containing protein	NA	X5JB37	Clostridium_phage	81.6	3.5e-104
ARC16801.1|1896425_1896821_-	hypothetical protein	NA	X5JAW1	Clostridium_phage	89.1	7.2e-61
ARC15054.1|1897376_1897550_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
ARC15055.1|1898874_1899036_-	hypothetical protein	NA	A0A0A8WE04	Clostridium_phage	84.3	1.2e-14
ARC15056.1|1899182_1899377_-	hypothetical protein	NA	NA	NA	NA	NA
ARC15057.1|1899376_1899817_-|portal	phage portal protein	portal	X5JAB6	Clostridium_phage	62.3	7.3e-46
ARC15058.1|1899885_1900362_-	hypothetical protein	NA	A0A0A8WJ62	Clostridium_phage	69.5	2.7e-54
ARC15059.1|1900382_1901693_-|tail	phage tail protein	tail	A0A0A8WIF0	Clostridium_phage	92.0	9.3e-230
ARC15060.1|1901693_1901870_-	hypothetical protein	NA	A0A0A8WFD8	Clostridium_phage	89.7	1.0e-19
ARC15061.1|1901862_1902300_-	hypothetical protein	NA	X5JAB5	Clostridium_phage	94.5	3.3e-75
ARC15062.1|1902292_1902718_-	hypothetical protein	NA	A0A0A8WFV8	Clostridium_phage	99.3	3.8e-76
ARC15063.1|1902717_1903080_-	hypothetical protein	NA	X5JAV9	Clostridium_phage	84.2	9.9e-49
ARC15064.1|1903079_1903424_-	hypothetical protein	NA	A0A0A7RTX9	Clostridium_phage	73.0	5.2e-39
ARC15065.1|1903434_1904454_-|capsid	minor capsid protein E	capsid	S5MA55	Brevibacillus_phage	45.1	1.1e-76
ARC15066.1|1904465_1904846_-	hypothetical protein	NA	NA	NA	NA	NA
ARC15067.1|1904861_1905455_-	hypothetical protein	NA	NA	NA	NA	NA
ARC15068.1|1905479_1905707_-	hypothetical protein	NA	A0A090EUB5	Clostridium_phage	89.5	1.4e-32
ARC15069.1|1905757_1906030_-	hypothetical protein	NA	NA	NA	NA	NA
ARC15070.1|1906048_1906585_-	hypothetical protein	NA	A0A090D7Z7	Clostridium_phage	46.0	3.1e-30
ARC15071.1|1906586_1906832_-	hypothetical protein	NA	NA	NA	NA	NA
ARC15072.1|1906902_1907151_-	hypothetical protein	NA	NA	NA	NA	NA
ARC15073.1|1907152_1908688_-|head	phage head morphogenesis protein	head	A0A0A8WIE7	Clostridium_phage	96.8	3.3e-194
ARC15074.1|1908677_1910072_-|portal	phage portal protein	portal	A0A0A7S0I9	Clostridium_phage	52.9	1.2e-131
ARC15075.1|1910076_1911306_-|terminase	PBSX family phage terminase large subunit	terminase	A0A059T7K2	Staphylococcus_phage	61.8	2.1e-143
ARC15076.1|1911298_1911985_-	hypothetical protein	NA	A0A0A8WJN3	Clostridium_phage	69.8	1.7e-73
ARC15077.1|1912362_1913040_-	BRO family protein	NA	A0A0A8WJQ8	Clostridium_phage	98.7	6.0e-124
AVI58863.1|1913573_1914062_-	hypothetical protein	NA	A0A090EUN5	Clostridium_phage	100.0	6.1e-86
ARC15078.1|1914151_1915000_-	hypothetical protein	NA	A0A0A8WJ22	Clostridium_phage	100.0	6.3e-155
ARC15079.1|1915101_1915509_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0A8WIA1	Clostridium_phage	96.3	1.2e-66
ARC15080.1|1915526_1915742_-	DUF3850 domain-containing protein	NA	NA	NA	NA	NA
ARC15081.1|1916130_1916460_-	hypothetical protein	NA	A0A0A8WI99	Clostridium_phage	93.6	1.9e-54
ARC15082.1|1916486_1916663_-	hypothetical protein	NA	J9QE29	Clostridium_phage	74.1	1.5e-18
ARC15083.1|1916659_1917385_-	reductase	NA	Q24LD4	Clostridium_phage	93.1	2.2e-124
ARC15084.1|1917393_1918389_-	nucleoid-associated protein	NA	J9QE81	Clostridium_phage	81.1	7.2e-150
ARC15085.1|1918385_1918607_-	hypothetical protein	NA	A0A0A8WJQ5	Clostridium_phage	97.3	3.5e-33
ARC15086.1|1918701_1918950_-	hypothetical protein	NA	NA	NA	NA	NA
ARC15087.1|1919276_1919393_-	hypothetical protein	NA	A0A0A8WI97	Clostridium_phage	86.8	1.8e-12
ARC15088.1|1919376_1919826_-	hypothetical protein	NA	A0A0A8WF29	Clostridium_phage	93.9	3.3e-78
ARC16802.1|1919812_1919947_-	hypothetical protein	NA	A0A0A8WJQ3	Clostridium_phage	95.5	2.0e-15
ARC15089.1|1919930_1920314_-	hypothetical protein	NA	X5JAK1	Clostridium_phage	59.8	3.4e-31
ARC15090.1|1920330_1920582_-	hypothetical protein	NA	J9QD22	Clostridium_phage	91.6	1.9e-35
ARC15091.1|1920568_1920979_-	hypothetical protein	NA	A0A0A8WFY4	Clostridium_phage	97.1	1.5e-72
ARC15092.1|1921053_1921461_-	single-stranded DNA-binding protein	NA	A0A0A8WIK6	Clostridium_phage	98.5	1.9e-72
ARC15093.1|1921478_1921652_-	resolvase	NA	A0A0A8WIG5	Clostridium_phage	100.0	2.0e-23
ARC15094.1|1921712_1922594_-	DnaD domain protein	NA	A0A0A8WFH2	Clostridium_phage	95.2	8.9e-152
ARC15095.1|1922603_1923212_-	recombinase	NA	A0A0A8WG30	Clostridium_phage	99.0	2.5e-105
ARC15096.1|1923221_1923731_-	hypothetical protein	NA	A0A0A8WJQ2	Clostridium_phage	98.2	3.3e-82
ARC15097.1|1923813_1924131_-	hypothetical protein	NA	A0A090DBX1	Clostridium_phage	99.0	2.4e-46
ARC15098.1|1924143_1924371_-	hypothetical protein	NA	NA	NA	NA	NA
ARC15099.1|1924472_1924697_-	hypothetical protein	NA	A0A0A8WI91	Clostridium_phage	46.7	5.6e-10
ARC15100.1|1924732_1924987_-	hypothetical protein	NA	NA	NA	NA	NA
ARC15101.1|1925022_1925811_-	phage antirepressor Ant	NA	A0A0A8WIG2	Clostridium_phage	55.3	1.4e-71
ARC15102.1|1925803_1925983_-	hypothetical protein	NA	A0A0A8WJW4	Clostridium_phage	56.4	2.9e-09
ARC15103.1|1926118_1926298_+	Arc family DNA-binding protein	NA	A0A0A8WG21	Clostridium_phage	76.4	5.1e-14
ARC15104.1|1926594_1926798_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
ARC15105.1|1926981_1927347_+	XRE family transcriptional regulator	NA	X5JA02	Clostridium_phage	63.6	6.3e-35
ARC15106.1|1927835_1928051_+	XRE family transcriptional regulator	NA	J9QEC2	Clostridium_phage	94.4	8.2e-27
AVI59028.1|1928127_1929174_+|integrase	site-specific integrase	integrase	A0A0A8WF08	Clostridium_phage	88.2	1.2e-179
ARC15107.1|1929250_1930786_-	GMP synthase (glutamine-hydrolyzing)	NA	A0A1V0SH76	Hokovirus	33.7	1.2e-23
1929175:1929191	attR	TATCATTTTAGTATCAC	NA	NA	NA	NA
ARC16803.1|1931167_1931587_-	DUF111 domain-containing protein	NA	NA	NA	NA	NA
ARC15108.2|1931616_1932351_-	nickel pincer cofactor biosynthesis protein LarC	NA	NA	NA	NA	NA
ARC15109.1|1932434_1933175_-	nickel pincer cofactor biosynthesis protein LarB	NA	A0A288TYA6	Enterococcus_phage	44.8	5.2e-20
ARC15110.1|1933436_1935065_-	molecular chaperone GroEL	NA	A0A240F779	uncultured_virus	55.7	5.8e-157
>prophage 4
CP020424	Clostridioides difficile strain FDAARGOS_267 chromosome, complete genome	4109635	2521362	2543517	4109635		Streptococcus_phage(73.33%)	24	NA	NA
ARC15560.1|2521362_2521689_+	DUF961 domain-containing protein	NA	A0A1S5SF38	Streptococcus_phage	52.4	1.4e-25
ARC15561.1|2521704_2522088_+	DUF961 domain-containing protein	NA	A0A1S5SF96	Streptococcus_phage	55.9	2.3e-32
ARC15562.1|2522178_2522793_+	hypothetical protein	NA	NA	NA	NA	NA
ARC15563.1|2522859_2524254_+	ATP-binding protein	NA	A0A1S5SFB5	Streptococcus_phage	66.6	4.6e-179
ARC15564.1|2524437_2525634_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	62.3	1.1e-147
ARC15565.1|2525646_2525781_+	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
ARC15566.1|2525781_2526003_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	87.7	9.0e-29
ARC15567.1|2526210_2526852_+	chloramphenicol acetyltransferase CAT	NA	G3CFL0	Escherichia_phage	33.3	1.2e-33
ARC16816.1|2526934_2527231_+	conjugal transfer protein	NA	NA	NA	NA	NA
ARC15568.1|2527149_2527653_+	antirestriction protein	NA	NA	NA	NA	NA
ARC15569.1|2527670_2528174_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	60.2	4.4e-55
ARC15570.1|2528291_2528690_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	73.0	3.2e-48
ARC15571.1|2528667_2531118_+	ATP/GTP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	76.2	0.0e+00
ARC15572.1|2531117_2533322_+	MFS transporter	NA	A0A1S5SF30	Streptococcus_phage	51.5	1.4e-182
ARC15573.1|2533318_2534326_+	peptidase P60	NA	A0A1S5SEZ8	Streptococcus_phage	69.0	1.1e-132
AVI58909.1|2534342_2535245_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	52.3	5.8e-82
ARC15574.1|2535443_2535779_-	hypothetical protein	NA	NA	NA	NA	NA
ARC15575.1|2535728_2535938_+	hypothetical protein	NA	NA	NA	NA	NA
ARC15576.2|2536030_2538694_+	magnesium-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	24.8	1.8e-38
ARC15577.1|2538709_2539213_+	winged helix family transcriptional regulator	NA	NA	NA	NA	NA
ARC15578.1|2539350_2540028_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	36.0	3.3e-13
ARC15579.1|2540028_2540259_+	conjugal transfer protein	NA	NA	NA	NA	NA
ARC15580.1|2540274_2540586_+	conjugal transfer protein	NA	NA	NA	NA	NA
ARC15581.1|2540751_2543517_+	magnesium-translocating P-type ATPase	NA	M1HJQ2	Paramecium_bursaria_Chlorella_virus	25.6	5.8e-48
>prophage 5
CP020424	Clostridioides difficile strain FDAARGOS_267 chromosome, complete genome	4109635	3220562	3229515	4109635		Catovirus(50.0%)	8	NA	NA
AVI58956.1|3220562_3221402_+	glycosyltransferase family 2 protein	NA	A0A2P1ELT8	Moumouvirus	26.3	7.0e-05
AVI58957.1|3221401_3222592_+	glycerophosphotransferase	NA	NA	NA	NA	NA
ARC16065.1|3222620_3223370_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.8	1.2e-16
ARC16066.1|3223391_3224300_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AVI58958.1|3224347_3225100_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	40.5	4.6e-16
AVI59029.1|3225125_3226421_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	43.6	2.9e-90
AVI58959.1|3226426_3227518_+	glycosyltransferase family 4 protein	NA	A0A1V0SL50	Klosneuvirus	26.2	1.8e-16
ARC16068.1|3227601_3229515_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	29.8	1.1e-26
>prophage 1
CP020425	Clostridioides difficile strain FDAARGOS_267 plasmid unnamed1, complete sequence	45187	0	23832	45187	plate,head,tail,portal	Clostridioides_phage(57.14%)	30	NA	NA
ARC16861.1|902_1664_+|head	phage head morphogenesis protein	head	A0A1V0DZW9	Clostridioides_phage	86.6	5.0e-111
ARC16862.1|1722_2049_+	hypothetical protein	NA	A0A1J1J9Q7	Escherichia_phage	30.6	1.2e-05
ARC16863.1|2074_2677_+	DUF4355 domain-containing protein	NA	A0A1V0DZW6	Clostridioides_phage	71.9	2.8e-72
ARC16864.1|2705_3629_+	hypothetical protein	NA	A0A1V0DZW0	Clostridioides_phage	85.3	9.6e-149
ARC16865.1|3642_3915_+	hypothetical protein	NA	A0A1V0DZV5	Clostridioides_phage	76.3	1.1e-28
ARC16866.1|3898_4279_+	hypothetical protein	NA	A0A1V0DZU9	Clostridioides_phage	93.7	1.9e-58
ARC16867.1|4290_4638_+	hypothetical protein	NA	A0A1V0DZW2	Clostridioides_phage	88.7	5.2e-55
ARC16868.1|4637_4994_+	hypothetical protein	NA	A0A1V0DZV8	Clostridioides_phage	91.5	2.8e-56
ARC16869.1|5002_5467_+	hypothetical protein	NA	A0A1V0DZX9	Clostridioides_phage	83.1	5.9e-62
ARC16870.1|5467_6523_+|tail	phage tail sheath protein	tail	A0A1V0DZX4	Clostridioides_phage	85.5	5.6e-169
ARC16871.1|6538_6979_+|portal	phage portal protein	portal	A0A1V0DZX1	Clostridioides_phage	77.5	1.3e-63
ARC16872.1|6994_7411_+|portal	phage portal protein	portal	A0A1V0DZX5	Clostridioides_phage	79.7	3.9e-57
ARC16873.1|7590_10983_+|tail	phage tail tape measure protein	tail	A0A1V0DZX3	Clostridioides_phage	61.5	1.2e-193
ARC16874.1|11029_11506_+	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
ARC16875.1|11563_12199_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A1V0DZX0	Clostridioides_phage	87.7	7.9e-110
ARC16920.1|12438_13956_+	cell wall hydrolase	NA	A0A1V0DZX6	Clostridioides_phage	88.2	1.8e-264
ARC16876.1|13969_14302_+	DUF2577 domain-containing protein	NA	J9QE86	Clostridium_phage	85.2	9.0e-49
ARC16877.1|14294_14729_+	DUF2634 domain-containing protein	NA	A0A1V0DZX2	Clostridioides_phage	90.1	6.5e-71
ARC16878.1|14721_15774_+|plate	baseplate protein J	plate	A0A1V0DZY2	Clostridioides_phage	89.4	7.6e-174
ARC16879.1|15775_16390_+	DUF2313 domain-containing protein	NA	J9QD29	Clostridium_phage	84.9	4.7e-91
ARC16880.1|16390_17173_+|tail	phage tail protein	tail	J9QED3	Clostridium_phage	86.2	1.6e-107
ARC16881.1|17192_18680_+	hypothetical protein	NA	J9QE87	Clostridium_phage	60.0	4.6e-116
ARC16882.1|18695_18989_+	hypothetical protein	NA	E2ELK3	Clostridium_phage	74.7	1.2e-36
ARC16883.1|18988_19171_+	hypothetical protein	NA	X5JAB9	Clostridium_phage	95.0	5.5e-24
ARC16884.1|19268_19487_+	hypothetical protein	NA	NA	NA	NA	NA
ARC16885.1|19494_19986_+	protein utxA	NA	J9QD30	Clostridium_phage	96.5	5.6e-71
ARC16886.1|19985_20822_+	N-acetylmuramoyl-L-alanine amidase	NA	J9QED4	Clostridium_phage	90.4	4.1e-146
ARC16887.1|21983_22319_+	CopY family transcriptional regulator	NA	A0A0A8WFI6	Clostridium_phage	45.0	1.4e-17
ARC16888.1|22329_22845_-	hypothetical protein	NA	A0A0A8WEM4	Clostridium_phage	35.6	2.0e-23
ARC16889.1|22926_23832_-	ATPase	NA	Q0SPH6	Clostridium_phage	29.6	8.0e-23
>prophage 2
CP020425	Clostridioides difficile strain FDAARGOS_267 plasmid unnamed1, complete sequence	45187	28919	44618	45187		Clostridium_phage(52.94%)	25	NA	NA
ARC16896.1|28919_29609_+	HTH domain-containing protein	NA	E2ELL5	Clostridium_phage	41.7	1.7e-41
ARC16897.1|29757_30141_-	transcriptional regulator	NA	A0A0A8WJP7	Clostridium_phage	46.5	3.3e-26
ARC16898.1|30906_31275_-	XRE family transcriptional regulator	NA	E2ELL8	Clostridium_phage	81.8	3.2e-47
ARC16899.1|31639_31855_+	hypothetical protein	NA	E2ELM0	Clostridium_phage	52.2	1.1e-12
ARC16900.1|31883_32615_+	helix-turn-helix domain-containing protein	NA	A0A1V0E018	Clostridioides_phage	77.2	9.3e-38
ARC16901.1|32643_32829_+	hypothetical protein	NA	NA	NA	NA	NA
ARC16902.1|32855_33074_+	hypothetical protein	NA	A0A090D836	Clostridium_phage	46.9	1.7e-08
ARC16903.1|33092_33305_-	hypothetical protein	NA	NA	NA	NA	NA
ARC16904.1|33467_33728_+	hypothetical protein	NA	NA	NA	NA	NA
ARC16905.1|33650_33908_-	hypothetical protein	NA	NA	NA	NA	NA
ARC16906.1|34019_34364_+	hypothetical protein	NA	NA	NA	NA	NA
ARC16907.1|34385_35717_+	replicative DNA helicase	NA	A0A2H4J8K1	uncultured_Caudovirales_phage	26.4	6.1e-19
ARC16908.1|36091_36478_+	hypothetical protein	NA	A0A0A7RUF3	Clostridium_phage	47.8	7.4e-18
AVI59031.1|36528_37233_+	hypothetical protein	NA	A0A0A7RWW3	Clostridium_phage	51.9	2.4e-59
ARC16909.1|37290_37473_+	hypothetical protein	NA	NA	NA	NA	NA
ARC16910.1|37469_37847_+	single-stranded DNA-binding protein	NA	E2ELN0	Clostridium_phage	57.8	2.1e-38
ARC16911.1|37824_38409_+	sigma-70 family RNA polymerase sigma factor	NA	S5MNV1	Brevibacillus_phage	28.4	4.0e-07
ARC16912.1|38598_38928_+	hypothetical protein	NA	NA	NA	NA	NA
ARC16913.1|39000_39486_+	hypothetical protein	NA	Q24LD1	Clostridium_phage	58.7	6.6e-16
ARC16914.1|39505_39763_+	hypothetical protein	NA	NA	NA	NA	NA
AVI59032.1|39870_40314_+	RNA polymerase subunit sigma	NA	A0A1V0E028	Clostridioides_phage	72.4	9.3e-49
ARC16915.1|40457_41003_+	hypothetical protein	NA	A0A1V0E034	Clostridioides_phage	83.3	3.0e-73
ARC16916.1|41006_41651_+	recombinase	NA	A0A1V0E036	Clostridioides_phage	97.7	2.0e-113
ARC16917.1|41865_42324_+	resolvase	NA	A0A1V0E032	Clostridioides_phage	78.2	1.7e-58
ARC16918.1|42878_44618_+	hypothetical protein	NA	A0A1V0DZW7	Clostridioides_phage	93.3	0.0e+00
>prophage 1
CP020426	Clostridioides difficile strain FDAARGOS_267 plasmid unnamed2, complete sequence	131326	104	91744	131326	tail,transposase,integrase,protease	Clostridium_phage(91.67%)	120	63057:63076	98401:98420
ARC16922.1|104_296_+	XRE family transcriptional regulator	NA	A0A0A8WF95	Clostridium_phage	100.0	1.2e-26
ARC16923.1|509_821_-	XRE family transcriptional regulator	NA	A0A0A8WIV9	Clostridium_phage	100.0	2.2e-49
ARC16924.1|1552_1876_+	hypothetical protein	NA	A0A2R2ZGZ0	Clostridioides_phage	100.0	2.9e-15
ARC16925.1|1887_2121_+	hypothetical protein	NA	A0A0A8WEP1	Clostridium_phage	100.0	5.2e-35
ARC16926.1|2215_2404_+	hypothetical protein	NA	A0A0A8WJL0	Clostridium_phage	100.0	1.7e-28
ARC16927.1|2633_2828_+	XRE family transcriptional regulator	NA	A0A0A8WF92	Clostridium_phage	100.0	2.5e-27
ARC17059.2|2979_3693_+	antirestriction protein ArdA	NA	A0A0A8WIV6	Clostridium_phage	100.0	1.1e-131
ARC16928.1|3917_4139_+	hypothetical protein	NA	A0A0A8WEN8	Clostridium_phage	100.0	2.6e-36
ARC16929.1|4183_4420_+	hypothetical protein	NA	A0A0A8WJK8	Clostridium_phage	100.0	6.7e-38
AVI59033.1|4454_4958_+	hypothetical protein	NA	A0A0A8WF88	Clostridium_phage	100.0	2.9e-91
ARC16930.1|4995_5358_+	hypothetical protein	NA	A0A0A8WIV3	Clostridium_phage	100.0	4.4e-65
ARC16931.1|5408_5672_+	hypothetical protein	NA	A0A0A8WI39	Clostridium_phage	100.0	2.1e-40
ARC16932.1|5709_6294_+	hypothetical protein	NA	A0A2R2ZGV5	Clostridioides_phage	100.0	7.5e-107
ARC16933.1|6611_7109_+	hypothetical protein	NA	A0A0A8WF85	Clostridium_phage	100.0	1.6e-89
ARC17060.1|7517_7853_+	hypothetical protein	NA	A0A0A8WI37	Clostridium_phage	100.0	7.0e-57
ARC16934.1|7959_9405_+	hypothetical protein	NA	A0A0A8WEN1	Clostridium_phage	100.0	6.2e-251
ARC16935.2|9415_9784_+	XRE family transcriptional regulator	NA	A0A0A8WJK5	Clostridium_phage	100.0	8.7e-61
ARC16936.1|9803_10184_+	XRE family transcriptional regulator	NA	A0A0A8WF83	Clostridium_phage	100.0	6.7e-64
ARC16937.1|10189_10537_+	XRE family transcriptional regulator	NA	A0A0A8WIU9	Clostridium_phage	100.0	7.7e-59
ARC16938.1|10623_10956_+	hypothetical protein	NA	A0A0A8WI35	Clostridium_phage	100.0	5.7e-59
ARC16939.2|11100_11577_+	hypothetical protein	NA	A0A0A8WEM7	Clostridium_phage	100.0	2.8e-83
ARC16940.1|11882_12182_-	hypothetical protein	NA	A0A0A8WJK3	Clostridium_phage	100.0	2.9e-46
ARC16941.1|12567_12969_+|transposase	IS200/IS605 family transposase	transposase	A0A0A8WIU6	Clostridium_phage	100.0	1.9e-72
ARC16942.1|12965_14129_+|transposase	transposase	transposase	A0A0A8WI33	Clostridium_phage	100.0	4.1e-221
ARC16943.1|14415_14988_+|integrase	integrase	integrase	A0A0A8WEM4	Clostridium_phage	100.0	1.1e-91
ARC16944.1|15234_15603_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A2R2ZGX0	Clostridioides_phage	100.0	4.2e-63
ARC16945.1|15799_16726_+	hypothetical protein	NA	A0A0A8WIU3	Clostridium_phage	100.0	6.9e-171
AVI59034.1|16730_18299_+	hypothetical protein	NA	A0A0A8WI31	Clostridium_phage	100.0	1.5e-295
ARC16946.1|18772_19039_+	helix-turn-helix domain containing protein	NA	A0A0A8WJJ9	Clostridium_phage	100.0	1.6e-43
ARC16947.1|19107_19353_+	hypothetical protein	NA	A0A0A8WF72	Clostridium_phage	100.0	3.7e-39
ARC16948.1|19354_19741_+	hypothetical protein	NA	A0A0A8WIU2	Clostridium_phage	100.0	6.1e-65
ARC16949.1|19770_20034_+	helix-turn-helix domain containing protein	NA	A0A0A8WI28	Clostridium_phage	100.0	7.9e-40
ARC16950.1|20120_20384_+	helix-turn-helix domain containing protein	NA	A0A0A8WEL7	Clostridium_phage	100.0	5.3e-44
ARC16951.1|20650_21829_+	hypothetical protein	NA	A0A0A8WF68	Clostridium_phage	100.0	9.5e-218
ARC16952.1|22741_23080_-	XRE family transcriptional regulator	NA	A0A0A8WEL4	Clostridium_phage	100.0	9.2e-57
ARC16953.1|23536_23890_-	XRE family transcriptional regulator	NA	A0A0A8WF63	Clostridium_phage	100.0	1.5e-57
ARC16954.1|24050_24245_+	hypothetical protein	NA	A0A0A8WIT6	Clostridium_phage	100.0	1.9e-27
ARC16955.1|24289_25096_+	hypothetical protein	NA	A0A0A8WI24	Clostridium_phage	100.0	3.6e-152
ARC16956.1|25159_25384_+	hypothetical protein	NA	A0A0A8WEL1	Clostridium_phage	100.0	6.5e-35
ARC16957.1|25407_25944_+	hypothetical protein	NA	A0A0A8WJJ4	Clostridium_phage	99.4	1.4e-86
ARC16958.1|26103_26337_+	hypothetical protein	NA	A0A0A8WIT3	Clostridium_phage	100.0	1.2e-39
ARC16959.1|26360_26783_+	DUF3850 domain-containing protein	NA	A0A0A8WI22	Clostridium_phage	100.0	2.2e-76
ARC16960.1|26975_27518_+	RNA 2'-phosphotransferase	NA	A0A0A8WJJ2	Clostridium_phage	100.0	1.8e-99
ARC16961.1|27567_27936_+	hypothetical protein	NA	A0A0A8WF56	Clostridium_phage	100.0	2.0e-65
AVI59035.1|27955_28732_+	hypothetical protein	NA	A0A0A8WIT2	Clostridium_phage	100.0	3.6e-141
ARC16962.1|28721_29126_+	hypothetical protein	NA	A0A0A8WI20	Clostridium_phage	100.0	3.8e-73
ARC16963.1|29163_29553_+	hypothetical protein	NA	A0A0A8WEK3	Clostridium_phage	100.0	2.2e-70
ARC16964.1|29612_29933_+	hypothetical protein	NA	A0A0A8WJJ0	Clostridium_phage	100.0	4.5e-61
ARC16965.1|29963_30149_+	hypothetical protein	NA	A0A0A8WF52	Clostridium_phage	100.0	1.5e-29
ARC16966.1|30203_30605_+	DNA ligase	NA	A0A0A8WIS9	Clostridium_phage	100.0	4.0e-67
ARC16967.1|30706_31210_+	hypothetical protein	NA	A0A0A8WI18	Clostridium_phage	100.0	2.2e-86
ARC16968.1|31269_33495_+	anaerobic ribonucleoside triphosphate reductase	NA	A0A0A8WEK0	Clostridium_phage	100.0	0.0e+00
ARC16969.1|33487_33985_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0A8WJI9	Clostridium_phage	100.0	1.5e-92
ARC16970.1|34185_34593_+	hypothetical protein	NA	A0A0A8WIS6	Clostridium_phage	100.0	2.5e-72
ARC16971.1|35383_36823_+|transposase	transposase	transposase	A0A0A8WJI7	Clostridium_phage	100.0	1.6e-275
ARC16972.1|37023_37248_+	hypothetical protein	NA	A0A2R2ZGT3	Clostridioides_phage	98.6	3.6e-33
ARC16973.1|37234_37345_+	acyltransferase	NA	A0A2R2ZGT2	Clostridioides_phage	100.0	5.8e-13
ARC16974.1|37373_37841_+	hypothetical protein	NA	A0A0A8WI14	Clostridium_phage	100.0	9.3e-84
ARC16975.1|37876_38257_+	hypothetical protein	NA	A0A0A8WEJ2	Clostridium_phage	100.0	8.4e-67
ARC16976.1|38454_38901_+	hypothetical protein	NA	A0A0A8WF39	Clostridium_phage	100.0	3.5e-80
ARC16977.1|39386_40640_+	RNA-splicing ligase RtcB	NA	A0A0A8WI12	Clostridium_phage	100.0	1.0e-225
ARC16978.1|40679_41081_+	hypothetical protein	NA	A0A0A8WEI8	Clostridium_phage	100.0	3.3e-77
ARC16979.1|41107_41341_+	hypothetical protein	NA	A0A0A8WJI3	Clostridium_phage	100.0	5.6e-37
ARC16980.1|41383_41794_+	hypothetical protein	NA	A0A0A8WF36	Clostridium_phage	100.0	2.6e-77
ARC16981.1|42252_42558_+	hypothetical protein	NA	A0A0A8WJI2	Clostridium_phage	100.0	4.3e-53
ARC16982.1|42583_42937_+	hypothetical protein	NA	A0A0A8WF31	Clostridium_phage	100.0	9.9e-62
ARC16983.1|43016_43301_+	DUF5052 domain-containing protein	NA	A0A0A8WIR7	Clostridium_phage	100.0	3.0e-45
ARC16984.1|43857_44460_+	hypothetical protein	NA	A0A0A8WF28	Clostridium_phage	100.0	1.5e-113
ARC16985.1|44474_44684_+	hypothetical protein	NA	A0A0A8WIR5	Clostridium_phage	100.0	1.0e-34
ARC16986.1|44738_44984_+	hypothetical protein	NA	A0A0A8WI06	Clostridium_phage	100.0	1.0e-41
AVI59036.1|45012_48084_+	PHP domain-containing protein	NA	A0A0A8WEH6	Clostridium_phage	100.0	0.0e+00
ARC16987.1|48186_48438_+	hypothetical protein	NA	A0A0A8WJH6	Clostridium_phage	100.0	2.4e-25
ARC16988.2|48437_48758_+	hypothetical protein	NA	A0A0A8WF25	Clostridium_phage	100.0	6.4e-52
ARC16989.1|48832_49954_+	hypothetical protein	NA	A0A0A8WIR3	Clostridium_phage	100.0	5.2e-213
ARC16990.1|49947_50379_+	hypothetical protein	NA	A0A0A8WI03	Clostridium_phage	100.0	5.1e-76
ARC16991.1|50588_50816_+	hypothetical protein	NA	A0A0A8WJH4	Clostridium_phage	100.0	1.0e-35
ARC16992.1|50841_51402_+	hypothetical protein	NA	A0A0A8WF21	Clostridium_phage	100.0	2.4e-102
ARC16993.1|51413_52079_+	hypothetical protein	NA	A0A2R2ZGQ4	Clostridioides_phage	100.0	1.8e-125
ARC16994.1|52124_53018_+	hypothetical protein	NA	A0A0A8WI02	Clostridium_phage	100.0	3.7e-137
ARC16995.1|53057_53615_+	recombination protein	NA	A0A0A8WEG9	Clostridium_phage	100.0	2.0e-96
ARC16996.1|53675_54227_+	hypothetical protein	NA	A0A0A8WJH2	Clostridium_phage	100.0	5.3e-102
ARC16997.1|54267_55794_+	hypothetical protein	NA	A0A0A8WF16	Clostridium_phage	100.0	9.3e-266
AVI59037.1|55803_56865_+	hypothetical protein	NA	A0A0A8WIQ8	Clostridium_phage	99.7	1.4e-204
ARC16999.1|57262_58114_+	hypothetical protein	NA	A0A0A8WEG6	Clostridium_phage	100.0	4.3e-151
AVI59038.1|58137_58581_+	hypothetical protein	NA	A0A0A8WJG9	Clostridium_phage	100.0	8.3e-82
ARC17000.2|58607_59267_+	fructose-bisphosphatase class III	NA	A0A2R2ZH50	Clostridioides_phage	99.5	1.3e-126
ARC17001.1|59277_59805_+|protease	spore protease YyaC	protease	A0A0A8WIQ6	Clostridium_phage	100.0	3.7e-89
ARC17002.1|59801_60056_+	hypothetical protein	NA	A0A0A8WHZ8	Clostridium_phage	100.0	8.5e-39
ARC17003.1|60039_60297_+	hypothetical protein	NA	A0A0A8WEG3	Clostridium_phage	100.0	3.2e-33
ARC17004.1|60307_60517_+	hypothetical protein	NA	A0A0A8WJG7	Clostridium_phage	98.6	3.1e-31
ARC17005.2|60591_61392_+	PD-(D/E)XK nuclease family protein	NA	A0A0A8WF10	Clostridium_phage	100.0	4.3e-153
ARC17006.1|61413_62565_+	site-specific DNA-methyltransferase	NA	A0A0A8WIQ4	Clostridium_phage	100.0	1.3e-224
ARC17007.1|62598_63429_+	SsmT	NA	A0A0A8WHZ5	Clostridium_phage	100.0	4.0e-162
63057:63076	attL	AAAAAAATTAAAAGAAATAA	NA	NA	NA	NA
ARC17008.1|63461_63845_+	hypothetical protein	NA	A0A0A8WEF9	Clostridium_phage	100.0	4.8e-70
ARC17009.1|63844_64417_+	guanylate kinase	NA	A0A0A8WJG4	Clostridium_phage	100.0	7.4e-107
ARC17010.1|64407_64902_+	crossover junction endodeoxyribonuclease RuvC	NA	A0A0A8WF06	Clostridium_phage	100.0	8.1e-86
ARC17011.1|64925_65474_+	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	A0A0A8WIQ1	Clostridium_phage	100.0	4.6e-98
ARC17012.1|65482_66142_+	hypothetical protein	NA	A0A0A8WHZ4	Clostridium_phage	100.0	4.5e-124
ARC17013.1|66229_67540_-|transposase	ISL3 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	100.0	3.0e-236
ARC17014.1|67542_68385_-	hypothetical protein	NA	A0A2R2ZGM6	Clostridioides_phage	100.0	2.5e-159
AVI59039.1|68835_69948_+|integrase	site-specific integrase	integrase	A0A0A8WF01	Clostridium_phage	100.0	1.3e-205
ARC17015.1|70184_70319_+	hypothetical protein	NA	A0A0A8WIQ0	Clostridium_phage	100.0	8.7e-19
ARC17016.1|70524_70902_+	BlaI/MecI/CopY family transcriptional regulator	NA	A0A0A8WHZ2	Clostridium_phage	100.0	4.3e-63
ARC17017.2|72458_72785_-	transcriptional regulator	NA	A0A2R2ZGM0	Clostridioides_phage	100.0	1.9e-51
ARC17018.1|72916_73270_-	XRE family transcriptional regulator	NA	A0A0A8WIP7	Clostridium_phage	100.0	2.1e-56
ARC17019.1|73600_74548_-	hypothetical protein	NA	A0A0A8WHY9	Clostridium_phage	99.7	6.8e-174
ARC17020.1|74573_74885_-	hypothetical protein	NA	A0A0A8WEE8	Clostridium_phage	100.0	1.4e-48
ARC17021.1|74885_75137_-	hypothetical protein	NA	A0A2R2ZGL6	Clostridioides_phage	100.0	6.4e-39
ARC17022.1|75148_75766_-	cell surface protein	NA	A0A0A8WEZ4	Clostridium_phage	100.0	9.1e-119
ARC17023.1|75777_76593_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A8WIP6	Clostridium_phage	100.0	2.1e-155
ARC17024.1|76869_77196_-	hypothetical protein	NA	A0A0A8WEE5	Clostridium_phage	100.0	1.8e-54
ARC17025.1|77210_79112_-	hypothetical protein	NA	A0A0A8WJF5	Clostridium_phage	100.0	0.0e+00
ARC17026.1|79139_79322_-	hypothetical protein	NA	A0A0A8WEZ0	Clostridium_phage	100.0	5.9e-26
ARC17027.1|79321_79615_-	hypothetical protein	NA	A0A0A8WIP3	Clostridium_phage	100.0	6.8e-48
ARC17028.1|79631_81314_-	hypothetical protein	NA	A0A0A8WHY5	Clostridium_phage	100.0	4.7e-287
ARC17029.1|81330_81870_-	hypothetical protein	NA	A0A0A8WEE2	Clostridium_phage	100.0	3.7e-84
ARC17030.1|81949_82273_-	hypothetical protein	NA	A0A0A8WJF2	Clostridium_phage	100.0	5.2e-49
AVI59040.1|82284_87564_-	hypothetical protein	NA	A0A0A8WEY5	Clostridium_phage	100.0	0.0e+00
ARC17031.1|87574_89653_-|tail	phage tail protein	tail	A0A0A8WIP0	Clostridium_phage	100.0	5.0e-230
ARC17032.1|89821_91744_-	hypothetical protein	NA	A0A0A8WEE0	Clostridium_phage	100.0	0.0e+00
98401:98420	attR	TTATTTCTTTTAATTTTTTT	NA	NA	NA	NA
>prophage 2
CP020426	Clostridioides difficile strain FDAARGOS_267 plasmid unnamed2, complete sequence	131326	102264	130524	131326	tail	Clostridium_phage(96.55%)	29	NA	NA
ARC17036.1|102264_103890_-|tail	phage tail tape measure protein	tail	A0A0A8WEX8	Clostridium_phage	100.0	3.8e-257
AVI59041.1|103949_104696_-	SHOCT domain-containing protein	NA	A0A0A8WIN6	Clostridium_phage	100.0	2.5e-94
ARC17038.1|104794_105868_-	phage repressor protein/antirepressor Ant	NA	A0A0A8WHY0	Clostridium_phage	100.0	8.2e-200
AVI59042.1|106469_106919_+	XRE family transcriptional regulator	NA	A0A0A8WJE4	Clostridium_phage	100.0	5.6e-78
ARC17039.1|108327_108768_-	hypothetical protein	NA	A0A0A8WED2	Clostridium_phage	100.0	1.0e-79
ARC17040.1|108768_109227_-	hypothetical protein	NA	A0A0A8WJE1	Clostridium_phage	100.0	4.6e-75
ARC17041.1|109240_110026_-	hypothetical protein	NA	A0A0A8WEX1	Clostridium_phage	100.0	1.3e-149
ARC17042.1|110124_110943_-	hypothetical protein	NA	A0A2R2ZGH3	Clostridioides_phage	99.3	2.9e-141
ARC17043.1|110989_111793_-	hypothetical protein	NA	A0A0A8WHX6	Clostridium_phage	100.0	1.6e-147
ARC17044.1|111792_112287_-	hypothetical protein	NA	A0A0A8WEC8	Clostridium_phage	100.0	1.9e-79
ARC17045.1|112301_113291_-	hypothetical protein	NA	A0A0A8WJD9	Clostridium_phage	100.0	5.4e-190
ARC17046.1|113292_113922_-	hypothetical protein	NA	A0A0A8WEW6	Clostridium_phage	100.0	3.4e-113
ARC17047.1|113936_114569_-	hypothetical protein	NA	A0A0A8WIN0	Clostridium_phage	100.0	2.7e-110
ARC17048.1|114622_115633_-	hypothetical protein	NA	A0A0A8WHX4	Clostridium_phage	100.0	1.7e-191
ARC17049.1|115720_116218_-	hypothetical protein	NA	A0A0A8WEC6	Clostridium_phage	100.0	7.1e-90
AVI59043.1|116232_117666_-	hypothetical protein	NA	A0A0A8WJD7	Clostridium_phage	100.0	8.2e-272
ARC17050.1|117672_117864_-	hypothetical protein	NA	A0A0A8WEW4	Clostridium_phage	100.0	1.1e-27
AVI59044.1|117866_119345_-	hypothetical protein	NA	A0A0A8WIM8	Clostridium_phage	100.0	2.8e-275
ARC17051.1|119361_121110_-	hypothetical protein	NA	A0A0A8WHX2	Clostridium_phage	100.0	0.0e+00
AVI59045.1|121099_121999_-	hypothetical protein	NA	A0A0A8WEC3	Clostridium_phage	100.0	9.6e-170
ARC17052.1|122129_123329_-	hypothetical protein	NA	A0A0A8WJL5	Clostridium_phage	100.0	3.7e-225
ARC17053.1|123965_124583_-	hypothetical protein	NA	A0A0A8WFA1	Clostridium_phage	100.0	5.2e-106
ARC17054.1|125296_125575_-	hypothetical protein	NA	A0A0A8WIW3	Clostridium_phage	100.0	1.2e-41
ARC17055.1|125708_127151_-	hypothetical protein	NA	A0A0A8WI47	Clostridium_phage	100.0	1.5e-265
ARC17056.1|127153_127402_-	hypothetical protein	NA	A0A0A8WEQ0	Clostridium_phage	100.0	2.2e-39
ARC17062.2|127579_128458_-	hypothetical protein	NA	A0A0A8WF99	Clostridium_phage	100.0	1.8e-165
AVI59046.1|128714_128987_-	hypothetical protein	NA	A0A0A8WIW1	Clostridium_phage	100.0	5.5e-44
ARC17057.1|128999_129914_-	hypothetical protein	NA	A0A0A8WI45	Clostridium_phage	100.0	6.4e-169
ARC17058.1|130335_130524_-	hypothetical protein	NA	A0A0A8WEP6	Clostridium_phage	100.0	1.1e-27
