The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP020449	Streptococcus agalactiae strain FDAARGOS_254 chromosome, complete genome	2218698	28911	36433	2218698	transposase	Bacillus_virus(50.0%)	7	NA	NA
ARC43952.1|28911_30246_-	aminopeptidase C	NA	R4TV59	Phaeocystis_globosa_virus	33.3	1.1e-63
ARC43953.1|30335_31796_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	76.5	1.3e-208
ARC43954.1|31924_32746_-	NAD(+) synthetase	NA	G3MA24	Bacillus_virus	55.1	7.7e-73
ARC43955.1|32742_34203_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	42.3	3.4e-100
ARC43956.1|34360_35275_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	52.8	2.1e-87
ARC43957.1|35343_35568_-	DUF4059 domain-containing protein	NA	NA	NA	NA	NA
ARC43958.1|35689_36433_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.1	4.7e-29
>prophage 2
CP020449	Streptococcus agalactiae strain FDAARGOS_254 chromosome, complete genome	2218698	159324	177376	2218698	tRNA,integrase	Streptococcus_phage(57.14%)	23	160674:160691	173924:173941
ARC44074.1|159324_160584_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1S6UA79	Serratia_phage	41.2	8.1e-74
160674:160691	attL	AAGTCCACAAAAAGGGGA	NA	NA	NA	NA
ARC44075.1|160848_161229_-	HicB family protein	NA	A0A1X9I5X0	Streptococcus_phage	76.0	4.7e-49
ARC44076.1|161265_161457_-	type II toxin-antitoxin system HicA family toxin	NA	A0A1X9I5T5	Streptococcus_phage	83.9	1.7e-23
ARC44077.1|161901_162108_-	hypothetical protein	NA	NA	NA	NA	NA
ARC44078.1|162235_162571_-	hypothetical protein	NA	NA	NA	NA	NA
ARC44079.1|162570_163149_-	hypothetical protein	NA	NA	NA	NA	NA
ARC44080.1|163196_163640_-	DUF1492 domain-containing protein	NA	A0A1S5S8W3	Streptococcus_phage	28.5	7.9e-08
ARC45892.1|165079_166528_-	DNA primase	NA	Q9AZI5	Lactococcus_phage	40.5	8.8e-72
ARC44081.1|166610_167468_-	hypothetical protein	NA	A0A1X9I6L2	Streptococcus_phage	74.7	1.0e-123
ARC44082.1|167602_167767_-	flagellar biosynthesis protein FlgC	NA	NA	NA	NA	NA
ARC44083.1|167763_168036_-	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	53.5	3.2e-20
ARC44084.1|168038_168389_-	HTH domain-containing protein	NA	A0A218MNC1	uncultured_virus	36.8	2.0e-06
ARC44085.1|168385_168622_-	hypothetical protein	NA	NA	NA	NA	NA
ARC44086.1|168784_169312_-	hypothetical protein	NA	NA	NA	NA	NA
ARC44087.1|169759_170392_-	hypothetical protein	NA	R9QNB1	Lactococcus_phage	43.4	1.0e-32
ARC44088.1|170382_171129_-	BRO-like protein	NA	A0A0A7RW33	Clostridium_phage	49.6	7.3e-22
ARC44089.1|171145_171553_-	hypothetical protein	NA	A0A1X9I5V7	Streptococcus_phage	57.5	1.4e-35
ARC44090.1|171567_171771_-	transcriptional regulator	NA	NA	NA	NA	NA
AVJ52150.1|171993_172584_+	XRE family transcriptional regulator	NA	A0A1X9I723	Streptococcus_phage	65.1	7.6e-14
AVJ52151.1|172777_173923_+|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	53.8	2.3e-107
ARC44093.1|174621_175653_+	endonuclease	NA	NA	NA	NA	NA
173924:173941	attR	AAGTCCACAAAAAGGGGA	NA	NA	NA	NA
ARC44094.1|175863_176676_-	metal ABC transporter permease	NA	NA	NA	NA	NA
ARC44095.1|176665_177376_-	metal ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.9	2.6e-08
>prophage 3
CP020449	Streptococcus agalactiae strain FDAARGOS_254 chromosome, complete genome	2218698	307837	316044	2218698		Synechococcus_phage(33.33%)	7	NA	NA
ARC44215.1|307837_309142_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A2D1GNZ3	Streptomyces_phage	40.5	4.9e-05
ARC44216.1|309288_310188_-	zoocin A	NA	A0A221J6U0	Arthrobacter_phage	45.9	4.1e-19
ARC44217.1|310380_311928_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase PurH	NA	Q58MG4	Prochlorococcus_phage	50.2	3.0e-78
ARC44218.1|311947_312700_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
ARC44219.2|312722_313274_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.8	4.7e-26
ARC44220.1|313536_314562_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	R9TMC7	Synechococcus_phage	42.7	8.1e-64
ARC44221.1|314589_316044_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	1.7e-54
>prophage 4
CP020449	Streptococcus agalactiae strain FDAARGOS_254 chromosome, complete genome	2218698	383693	395772	2218698	transposase	Streptococcus_phage(44.44%)	12	NA	NA
ARC44264.1|383693_385106_-|transposase	IS5/IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	76.5	1.7e-208
ARC44265.1|385215_386325_-	DNA replication and repair protein RecF	NA	NA	NA	NA	NA
ARC44266.1|386327_386681_-	S4 domain-containing protein YaaA	NA	A0A1X9I5V8	Streptococcus_phage	61.8	9.4e-20
ARC44267.1|386919_388164_+	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	41.3	6.3e-87
ARC44268.1|388165_389449_+	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	23.6	2.2e-05
ARC44269.1|389571_390114_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
ARC44270.1|390113_390953_+	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	30.0	3.5e-20
ARC44271.1|390928_391771_+	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	28.5	2.0e-15
AVJ52160.1|391763_392558_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
ARC44272.1|392773_393313_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A249XZV3	Enterococcus_phage	46.4	3.0e-17
ARC44273.1|393418_394123_+	transglycosylase	NA	A0A2H4J6C5	uncultured_Caudovirales_phage	65.3	6.4e-28
ARC44274.1|394317_395772_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	76.5	1.3e-208
>prophage 5
CP020449	Streptococcus agalactiae strain FDAARGOS_254 chromosome, complete genome	2218698	410330	419822	2218698		Streptococcus_phage(81.82%)	17	NA	NA
ARC44286.1|410330_410918_-	helix-turn-helix domain-containing protein	NA	A0A1X9I5U6	Streptococcus_phage	37.5	4.0e-15
ARC44287.1|411072_411258_+	hypothetical protein	NA	A0A1X9I5U7	Streptococcus_phage	54.8	6.2e-07
ARC44288.1|411273_411876_+	phage repressor protein	NA	A0A1W6JPC3	Staphylococcus_phage	46.7	6.7e-42
ARC44289.1|412111_412750_+	hypothetical protein	NA	NA	NA	NA	NA
ARC44290.1|412848_413022_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
ARC44291.1|413110_413617_+	hypothetical protein	NA	A0A1X9I5V7	Streptococcus_phage	35.4	4.5e-07
ARC44292.1|413693_414026_+	hypothetical protein	NA	NA	NA	NA	NA
ARC44293.1|414022_414244_+	hypothetical protein	NA	NA	NA	NA	NA
ARC44294.1|414246_414438_+	hypothetical protein	NA	NA	NA	NA	NA
ARC44295.1|414778_415051_+	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	56.8	1.8e-18
ARC44296.1|415051_415909_+	hypothetical protein	NA	A0A1X9I6L2	Streptococcus_phage	72.9	3.0e-120
ARC44297.1|415920_417315_+	virulence-associated protein E	NA	W8CQP1	Croceibacter_phage	33.7	3.7e-43
ARC44298.1|417607_417865_+	hypothetical protein	NA	NA	NA	NA	NA
ARC44299.1|417861_418035_+	DUF2758 domain-containing protein	NA	A0A1X9I5U0	Streptococcus_phage	56.1	4.3e-10
ARC44300.1|418192_418750_+	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	59.8	2.4e-30
ARC44301.1|418822_419311_+	hypothetical protein	NA	A0A1X9I5V2	Streptococcus_phage	59.3	3.5e-49
ARC44302.1|419444_419822_+	DUF1492 domain-containing protein	NA	Q7Y4J3	Streptococcus_phage	37.9	3.2e-10
>prophage 6
CP020449	Streptococcus agalactiae strain FDAARGOS_254 chromosome, complete genome	2218698	697495	723777	2218698	transposase,integrase	Streptococcus_phage(86.36%)	29	702313:702327	725944:725958
ARC44537.1|697495_698719_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.0	1.6e-29
ARC44538.1|698737_700465_+	glycine/betaine ABC transporter permease	NA	NA	NA	NA	NA
ARC44539.1|700841_700961_+	hypothetical protein	NA	NA	NA	NA	NA
ARC44540.1|700983_701298_+	DUF961 domain-containing protein	NA	A0A1S5SF38	Streptococcus_phage	100.0	5.2e-54
ARC44541.1|701313_701700_+	DUF961 domain-containing protein	NA	A0A1S5SF96	Streptococcus_phage	100.0	3.0e-64
ARC44542.1|701728_703114_+	DNA translocase FtsK	NA	A0A1S5SFB5	Streptococcus_phage	100.0	1.1e-265
702313:702327	attL	TATTTCTATTGATGA	NA	NA	NA	NA
ARC44543.1|703116_703269_+	conjugal transfer protein	NA	NA	NA	NA	NA
ARC44544.1|703291_704497_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	100.0	2.8e-233
ARC44545.1|704539_704761_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	100.0	4.3e-31
ARC44546.1|704877_705375_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	100.0	1.7e-91
ARC44547.1|705349_705856_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	100.0	8.6e-91
ARC44548.1|705839_708287_+	ATP/GTP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	100.0	0.0e+00
ARC44549.1|708289_710467_+	hypothetical protein	NA	A0A1S5SF30	Streptococcus_phage	100.0	0.0e+00
ARC44550.1|710463_711465_+	peptidase P60	NA	A0A1S5SEZ8	Streptococcus_phage	100.0	5.0e-191
ARC44551.1|711461_712394_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	99.4	3.1e-171
ARC44552.1|712668_712755_+	tetracycline resistance protein	NA	NA	NA	NA	NA
AVJ52178.1|712770_714690_+	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	99.5	0.0e+00
ARC44555.1|714790_714976_+	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	67.9	6.6e-17
ARC44556.1|715588_715672_+	23S rRNA methyltransferase attenuator leader peptide ErmL	NA	NA	NA	NA	NA
ARC44557.1|715796_716534_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	1.4e-134
AVJ52179.1|716538_716670_+	hypothetical protein	NA	E4ZFP9	Streptococcus_phage	90.7	8.2e-14
ARC44558.1|716888_717443_+	resolvase	NA	A0A0F7LA37	Escherichia_phage	52.1	2.3e-36
ARC44559.1|717446_720365_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	36.1	1.1e-169
ARC45913.1|720864_720936_+	hypothetical protein	NA	NA	NA	NA	NA
ARC44560.1|721164_721587_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	100.0	2.5e-72
ARC44561.1|721583_721814_+	helix-turn-helix domain-containing protein	NA	A0A1S5SEX1	Streptococcus_phage	100.0	2.7e-36
ARC44562.1|722039_722291_-	hypothetical protein	NA	NA	NA	NA	NA
ARC44563.1|722274_722478_+	excisionase	NA	A0A1S5SF07	Streptococcus_phage	100.0	4.0e-31
ARC44564.1|722559_723777_+|integrase	site-specific integrase	integrase	A0A1S5SEW7	Streptococcus_phage	100.0	3.7e-233
725944:725958	attR	TATTTCTATTGATGA	NA	NA	NA	NA
>prophage 7
CP020449	Streptococcus agalactiae strain FDAARGOS_254 chromosome, complete genome	2218698	939728	955454	2218698	transposase	Streptococcus_phage(86.67%)	19	NA	NA
ARC44776.1|939728_940493_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.8	2.6e-14
AVJ52186.1|940492_941203_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	4.7e-18
ARC44777.1|941221_941881_+	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	56.5	8.0e-65
ARC44778.1|941969_942605_+	thymidylate kinase	NA	M1PSC7	Streptococcus_phage	61.1	2.8e-67
ARC44779.1|942624_943488_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	50.0	2.5e-74
ARC44780.1|943518_943845_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	61.1	3.2e-30
ARC45918.1|943850_944714_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	70.4	3.1e-109
ARC44781.1|944855_946268_+|transposase	IS5/IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	76.5	1.7e-208
ARC44782.1|946317_947595_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
ARC44783.1|948126_948276_-	hypothetical protein	NA	NA	NA	NA	NA
ARC44784.1|948260_948365_+	hypothetical protein	NA	NA	NA	NA	NA
ARC44785.1|948408_949044_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
ARC44786.1|949176_950268_+	phosphoserine aminotransferase	NA	M1Q1P2	Streptococcus_phage	78.0	3.9e-165
ARC44787.1|950336_950885_+	GNAT family N-acetyltransferase	NA	M1PSC3	Streptococcus_phage	57.9	1.4e-54
ARC44788.1|950946_952128_+	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	75.3	9.1e-168
ARC44789.1|952183_952660_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	50.9	1.6e-38
ARC44790.1|952661_953018_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	72.6	5.2e-42
ARC44791.1|953147_954605_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	76.5	1.3e-208
ARC44792.1|954626_955454_-	exodeoxyribonuclease	NA	M1PSC0	Streptococcus_phage	78.0	1.1e-124
>prophage 8
CP020449	Streptococcus agalactiae strain FDAARGOS_254 chromosome, complete genome	2218698	1178191	1249209	2218698	tRNA,protease,transposase,integrase	Bacillus_phage(40.0%)	59	1178097:1178156	1241463:1242779
1178097:1178156	attL	CACGCCAAACGCATGAAGAAACTTTTGTTTTCAGAAAACTAGATTCATAATGACAAAATC	NA	NA	NA	NA
ARC44987.1|1178191_1179325_+|transposase	ISAs1 family transposase IS1548	transposase	NA	NA	NA	NA
ARC44989.1|1179489_1179870_+	DUF1149 domain-containing protein	NA	NA	NA	NA	NA
ARC44990.1|1179869_1180718_+	DegV family protein	NA	NA	NA	NA	NA
ARC44991.1|1180902_1182111_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	47.5	3.3e-40
ARC44992.1|1182121_1183990_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	31.4	1.6e-62
ARC44993.1|1184525_1186265_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.5	1.3e-37
ARC44994.2|1186269_1188039_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.6	2.0e-54
ARC44995.1|1188079_1188589_-	hypothetical protein	NA	NA	NA	NA	NA
ARC44996.1|1188756_1190106_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
ARC44997.1|1190175_1190586_+	peptide deformylase	NA	A0A2I7QLT9	Vibrio_phage	35.0	1.0e-09
ARC44998.1|1190622_1192695_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
ARC44999.1|1192963_1193404_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
ARC45000.1|1193450_1195268_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.8	2.4e-34
ARC45001.1|1195257_1197012_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.2	3.0e-50
ARC45002.1|1197119_1197746_+	GTP pyrophosphokinase	NA	NA	NA	NA	NA
ARC45003.1|1197747_1198434_+	DNA-binding response regulator	NA	NA	NA	NA	NA
ARC45004.1|1198433_1199663_+	sensor histidine kinase	NA	NA	NA	NA	NA
ARC45005.1|1199778_1200657_+	mevalonate kinase	NA	NA	NA	NA	NA
ARC45006.1|1200638_1201583_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
ARC45007.1|1201575_1202568_+	phosphomevalonate kinase	NA	NA	NA	NA	NA
ARC45008.1|1202564_1203560_+	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
ARC45009.1|1203627_1203846_+	DUF4649 domain-containing protein	NA	NA	NA	NA	NA
ARC45010.1|1203891_1204746_-	glutathione-dependent reductase	NA	NA	NA	NA	NA
ARC45011.1|1204846_1205761_-	diacylglycerol kinase family lipid kinase	NA	NA	NA	NA	NA
ARC45930.1|1205847_1206492_-	hemolysin III	NA	NA	NA	NA	NA
ARC45012.1|1206496_1206946_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
ARC45013.1|1207037_1208321_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
ARC45931.1|1208322_1209495_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
ARC45014.1|1209648_1210488_+	thymidylate synthase	NA	U5J9N5	Bacillus_phage	53.6	9.9e-84
ARC45015.1|1210567_1211062_+	dihydrofolate reductase	NA	A0A0A8JB64	Ralstonia_phage	35.3	6.3e-22
ARC45016.1|1211079_1211250_+	hypothetical protein	NA	NA	NA	NA	NA
ARC45932.1|1211279_1212506_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	60.0	8.1e-135
ARC45017.1|1212516_1213113_+	GTP-binding protein	NA	NA	NA	NA	NA
ARC45018.1|1213093_1213723_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
ARC45019.1|1213725_1213818_+	hypothetical protein	NA	NA	NA	NA	NA
ARC45020.1|1214475_1215126_+	HXXEE domain-containing protein	NA	NA	NA	NA	NA
ARC45021.1|1216636_1217581_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
AVJ52248.1|1217613_1217691_+	hypothetical protein	NA	NA	NA	NA	NA
ARC45022.1|1217674_1219783_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	37.4	8.2e-119
ARC45023.1|1220216_1220717_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
ARC45024.1|1220780_1221146_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
AVJ52196.1|1221422_1225034_+	type II restriction endonuclease	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	24.3	1.9e-06
ARC45025.1|1225047_1225539_+	hypothetical protein	NA	NA	NA	NA	NA
ARC45026.1|1225590_1226796_+	hypothetical protein	NA	NA	NA	NA	NA
ARC45027.1|1227030_1227345_+	hypothetical protein	NA	NA	NA	NA	NA
ARC45028.1|1227344_1227848_+	hypothetical protein	NA	NA	NA	NA	NA
ARC45029.1|1227911_1228421_+	cell division protein FtsK	NA	NA	NA	NA	NA
ARC45030.1|1228422_1228731_+	hypothetical protein	NA	NA	NA	NA	NA
ARC45031.1|1228727_1229036_+	hypothetical protein	NA	NA	NA	NA	NA
ARC45032.1|1229170_1229737_+	Replication protein RepB	NA	NA	NA	NA	NA
ARC45033.1|1229740_1229974_+	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
ARC45034.1|1229991_1231173_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
ARC45933.1|1231374_1232592_-	hypothetical protein	NA	NA	NA	NA	NA
ARC45035.1|1233025_1234840_+	DNA polymerase III subunit epsilon	NA	A0A0A7RWA3	Clostridium_phage	31.9	5.0e-32
ARC45036.1|1237854_1241307_+	peptidase C5	NA	A0A218KC60	Bacillus_phage	39.4	7.6e-05
ARC45037.1|1241557_1242691_+|transposase	ISAs1 family transposase IS1548	transposase	NA	NA	NA	NA
ARC45039.1|1242868_1243789_+	metal ABC transporter substrate-binding lipoprotein/laminin-binding adhesin Lmb	NA	NA	NA	NA	NA
1241463:1242779	attR	CACGCCAAACGCATGAAGAAACTTTTGTTTTCAGAAAACTAGATTCATAATGACAAAATCAATCAAAGTAGTACACTATAGATGAGGTGACTACGATGATTGATTTTATTATTTCTATTGATGATTGCGCAGTTGAATTGGATAGTCGTCAATCTTGGAAAATTCGCTACCCCTTATCAACCATTCTATTTCTTGTCTTCGTTTGTCAGTTAGCTGGCATTGAAACCTGGAAGGAGATGGAAGATTTTATTGAAATGAATGAACCATTGTTTGCGACCTACGTTGATTTGAGTGAAGGTTGTCCGTCTCATGATACCTTAGAGCGTGTGATTAGTCTTGTTAATTCAGACCGTTTAAAAGAGCTTAAAGTTCAATTTGAGCAATCATTGACAAGCTTAGATGCCGTTCATCAACTGATTTCAGTGGACGGTAAAACGATTCGAGGCAATCGAGGTAAAAATCAGAAGCCTGTTCATATTGTAACGGCTTATGATGGGGGTCATCATCTTAGTTTGGGACAGGTAGCGGTTGAGGAGAAAAGTAATGAAATTGTTGCCATTCCTCAGTTATTGCGGACAATTGATATCCGTAAAAGCATTGTAACGATAGACGCAATGGGCACGCAGACGGCTATCGTTGATACGATTATAAAAGGTAAAGCAGACTATTGCTTAGCCGTCAAAGGAAATCAAGAAACACTTTATGATGATATTGCTCTTTATTTTAGTGATGTCAACTTATTGGAAGAACTCCAAGAAAATGCGCAGTATTATCAGACTGTTGAAAAATCTAGGGGACAGATTGAAGTTAGAGAATACTGGGTGTCTTCCGATATCAAATGGTTGTGTCAAAACCATCCCAAATGGCATAAGTTACGTGGTATTGGGATGACTCGTAACACGATTGATAAGGATGGTCAGCTGAGTCAAGAGAATCGTTATTTTATCTTTAGCTTTAAGCCGGATGTCCTCACATTTGCCAATTGTGTACGAGGTCATTGGCAGATAGAGAGTATGCACTGGTTATTGGACGTTGTTTATCATGAAGATCATCATCAGACATTGGATAAAAGAGCCGCATTTAACCTAAATCTTATCCGAAAAATGTGCTTATATTTTCTCAAAGTGATGGTATTTCCTAAAAAAGACCTCAGTTATCGTCGCAAACAACGGTATATTTCTGTCCATTTGGAAGATTATTTAGTCCAATTATTTGGAGAAAGAGGCTAAGCAGATCATTGATTTAAAAAGGAATCTTTTCAAAATTGATGTCCGGGCACAAAAGGATGAAGAGAAAGTTTTCATGCGTACGGCGTGT	NA	NA	NA	NA
ARC45040.1|1243801_1246270_+	pneumococcal-type histidine triad protein	NA	NA	NA	NA	NA
AVJ52197.1|1248103_1249209_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	48.9	3.7e-70
>prophage 9
CP020449	Streptococcus agalactiae strain FDAARGOS_254 chromosome, complete genome	2218698	1278712	1341879	2218698	tRNA,protease,capsid,transposase,integrase	Streptococcus_phage(33.33%)	57	1333353:1333370	1349440:1349457
ARC45064.1|1278712_1279396_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
ARC45065.1|1279385_1280174_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
ARC45066.1|1280182_1281286_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
ARC45067.1|1281344_1282214_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	62.2	2.7e-100
ARC45068.1|1282213_1282807_+	dTDP-4-keto-6-deoxy-D-glucose epimerase	NA	NA	NA	NA	NA
ARC45069.1|1283013_1284060_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.6	1.9e-68
ARC45070.1|1284194_1285679_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	76.5	1.3e-208
ARC45071.1|1285675_1288894_-	hyaluronate lyase	NA	NA	NA	NA	NA
ARC45072.1|1289110_1289593_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
ARC45073.1|1289582_1290044_+	DNA mismatch repair protein MutT	NA	NA	NA	NA	NA
ARC45074.1|1290135_1291326_+	AI-2E family transporter	NA	NA	NA	NA	NA
ARC45075.1|1291315_1292542_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
ARC45076.1|1292651_1294334_+	acetolactate synthase AlsS	NA	NA	NA	NA	NA
ARC45077.1|1294347_1295067_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
ARC45078.1|1295120_1296776_-	DUF814 domain-containing protein	NA	A0A1J0F9J4	Only_Syngen_Nebraska_virus	41.0	2.3e-07
ARC45079.1|1297133_1298138_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
ARC45080.1|1298150_1299014_+	ABC transporter permease	NA	NA	NA	NA	NA
ARC45081.1|1299013_1299775_+	phosphonate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.3	4.1e-12
ARC45082.1|1300071_1301733_+	ribonuclease J	NA	NA	NA	NA	NA
ARC45083.1|1301789_1302578_+	esterase family protein	NA	NA	NA	NA	NA
ARC45084.1|1302667_1303378_+|protease	Zn-dependent protease	protease	NA	NA	NA	NA
ARC45085.1|1303615_1304287_+	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
ARC45086.1|1304343_1305555_+	phosphopentomutase	NA	NA	NA	NA	NA
ARC45087.1|1305605_1306013_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	53.0	1.0e-33
ARC45088.1|1306051_1306861_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
ARC45089.1|1307666_1308800_+|transposase	ISAs1 family transposase IS1548	transposase	NA	NA	NA	NA
ARC45090.1|1309428_1310139_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
ARC45091.1|1310147_1310915_+	LytR family transcriptional regulator	NA	NA	NA	NA	NA
ARC45092.1|1310939_1311863_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	36.1	1.2e-05
ARC45093.2|1312051_1313509_+	LytR family transcriptional regulator	NA	A0A1X9I5X1	Streptococcus_phage	51.9	3.8e-115
ARC45094.1|1313514_1314246_+	tyrosine-protein phosphatase CpsB	NA	NA	NA	NA	NA
ARC45095.1|1314254_1314947_+	capsular polysaccharide biosynthesis protein CpsC	NA	A0A1X9I5E1	Streptococcus_phage	48.1	1.6e-47
ARC45096.1|1314957_1315647_+	tyrosine protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	49.6	1.2e-58
ARC45097.1|1315659_1317048_+	sugar transferase	NA	NA	NA	NA	NA
ARC45098.1|1317071_1317521_+	UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase	NA	NA	NA	NA	NA
ARC45099.1|1317520_1318012_+	multidrug MFS transporter	NA	NA	NA	NA	NA
ARC45100.2|1317998_1319105_+	hypothetical protein	NA	NA	NA	NA	NA
ARC45101.1|1319097_1320069_+	hypothetical protein	NA	A0A1V0SAH6	Catovirus	36.2	2.8e-13
ARC45102.1|1320090_1321056_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	33.1	5.7e-11
ARC45103.1|1321057_1321921_+	conjugal transfer protein	NA	NA	NA	NA	NA
ARC45104.1|1321936_1322890_+	hypothetical protein	NA	NA	NA	NA	NA
ARC45105.1|1322897_1323827_+	alpha-2,3-N-acetylneuraminyltransferase	NA	NA	NA	NA	NA
ARC45106.1|1323823_1325224_+|capsid	capsid assembly protein	capsid	NA	NA	NA	NA
ARC45107.1|1325223_1326249_+	N-acetylneuraminate synthase	NA	A0A1B1IVE2	uncultured_Mediterranean_phage	37.1	2.0e-33
ARC45108.1|1326325_1327480_+	UDP-N-acetylglucosamine 2-epimerase (hydrolyzing)	NA	NA	NA	NA	NA
ARC45109.1|1327476_1328106_+	NeuD protein	NA	NA	NA	NA	NA
ARC45110.1|1328116_1329358_+	acylneuraminate cytidylyltransferase	NA	NA	NA	NA	NA
ARC45111.1|1329471_1329957_+	hypothetical protein	NA	NA	NA	NA	NA
ARC45112.1|1330055_1330709_+	uracil-DNA glycosylase	NA	A0A0S1TKU8	Elephant_endotheliotropic_herpesvirus	42.0	1.0e-35
ARC45113.2|1330774_1331413_-	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
ARC45114.1|1331514_1333476_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	41.9	7.8e-124
1333353:1333370	attL	AATTGAAGATTTAGCAAG	NA	NA	NA	NA
ARC45115.1|1333609_1336069_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	32.4	6.4e-99
ARC45116.1|1336181_1337204_+	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
ARC45117.1|1337286_1337517_+	DUF2969 domain-containing protein	NA	NA	NA	NA	NA
ARC45935.1|1337860_1339063_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
ARC45118.1|1339190_1340666_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	76.5	1.3e-208
ARC45119.1|1340802_1341879_-|integrase	site-specific integrase	integrase	J7KK80	Streptococcus_phage	86.6	1.4e-143
1349440:1349457	attR	CTTGCTAAATCTTCAATT	NA	NA	NA	NA
>prophage 10
CP020449	Streptococcus agalactiae strain FDAARGOS_254 chromosome, complete genome	2218698	1925759	1982960	2218698	capsid,protease,portal,holin,transposase,tail,integrase,terminase	Streptococcus_phage(72.31%)	84	1942111:1942128	1980650:1980667
ARC45612.1|1925759_1926893_-|transposase	ISAs1-like element IS1548 family transposase	transposase	NA	NA	NA	NA
ARC45613.1|1927062_1928268_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
ARC45614.1|1928588_1930001_+|transposase	IS5/IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	76.5	1.7e-208
ARC45615.1|1930050_1931328_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
ARC45616.1|1932113_1932302_-	Paratox	NA	J7KIW4	Streptococcus_phage	78.2	3.3e-16
ARC45617.1|1932343_1932544_-	CsbD family protein	NA	J7KJ36	Streptococcus_phage	97.0	8.4e-26
AVJ52226.1|1933420_1934740_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.9	2.2e-05
ARC45618.1|1934736_1935390_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.6	8.1e-25
AVJ52227.1|1935486_1936863_-	ABC transporter permease	NA	NA	NA	NA	NA
ARC45619.1|1936862_1937519_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.8	2.2e-22
ARC45620.1|1937528_1938806_-	ABC transporter permease	NA	NA	NA	NA	NA
ARC45621.1|1939548_1939710_+	NINE protein	NA	NA	NA	NA	NA
ARC45622.1|1939882_1940092_-	hypothetical protein	NA	A0A0C5AEA5	Paenibacillus_phage	55.4	1.4e-15
ARC45623.1|1940217_1940475_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	43.5	5.8e-11
ARC45624.1|1940499_1940700_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
ARC45625.1|1940861_1941089_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
ARC45626.1|1941265_1941532_+|integrase	integrase	integrase	Q77YW7	Streptococcus_phage	65.2	7.1e-20
ARC45627.2|1941534_1942149_+|integrase	site-specific integrase	integrase	F8HGP4	Streptococcus_phage	60.7	9.2e-55
1942111:1942128	attL	ATGTCCCCTGCCGGAATC	NA	NA	NA	NA
ARC45628.1|1942248_1942428_-	Paratox	NA	J7KIW4	Streptococcus_phage	86.2	2.1e-20
ARC45629.1|1942844_1943015_+	hypothetical protein	NA	A0A286QNA2	Streptococcus_phage	63.8	1.1e-07
ARC45630.1|1943055_1943256_-	CsbD family protein	NA	J7KJ36	Streptococcus_phage	87.9	9.6e-22
ARC45631.1|1943359_1944331_-|protease	CAAX protease	protease	A0A059NT88	Lactococcus_phage	42.6	1.3e-74
ARC45632.1|1944663_1945383_-|holin	holin	holin	A0A1U9WRD0	Streptococcus_virus	72.1	1.6e-58
ARC45633.1|1945384_1945720_-|holin	phage holin	holin	A0A1P8VVK6	Streptococcus_phage	71.2	6.8e-36
ARC45634.1|1945721_1946024_-	hypothetical protein	NA	X2KT07	Streptococcus_phage	59.6	2.2e-25
ARC45635.1|1946036_1946249_-	hypothetical protein	NA	J7KDP6	Streptococcus_phage	60.0	2.1e-14
ARC45636.1|1946223_1946553_-	DUF1366 domain-containing protein	NA	J7KDI9	Streptococcus_phage	54.3	7.2e-22
ARC45637.1|1946578_1948585_-	hypothetical protein	NA	J7KK23	Streptococcus_phage	43.3	3.6e-140
AVJ52228.1|1948595_1952720_-	CHAP domain-containing protein	NA	J7KBT9	Streptococcus_phage	75.6	0.0e+00
ARC45638.1|1952720_1954241_-|tail	phage tail protein	tail	J7KH53	Streptococcus_phage	74.6	2.9e-203
AVJ52229.1|1954234_1956247_-	PblA	NA	Q9F4J3	Streptococcus_phage	58.9	9.8e-13
ARC45639.1|1956246_1956618_-	hypothetical protein	NA	A0A1P8BMT6	Lactococcus_phage	54.0	7.3e-31
ARC45640.1|1956632_1956878_-	hypothetical protein	NA	A0A0B5A2F3	Streptococcus_phage	55.3	9.7e-16
ARC45641.1|1956877_1957435_-|tail	phage tail protein	tail	M1PKG8	Streptococcus_phage	65.8	3.4e-64
ARC45642.1|1957444_1957780_-	hypothetical protein	NA	A0A1P8BMR5	Lactococcus_phage	64.9	9.8e-35
ARC45643.1|1957780_1958017_-	hypothetical protein	NA	A0A1P8BMT2	Lactococcus_phage	66.7	2.5e-21
ARC45644.1|1958009_1958348_-	hypothetical protein	NA	A0A0B5A086	Streptococcus_phage	67.9	1.4e-41
ARC45645.1|1958298_1958730_-	hypothetical protein	NA	A0A0B5A2F6	Streptococcus_phage	70.1	3.8e-47
ARC45646.1|1958743_1958959_-	hypothetical protein	NA	M1PRX2	Streptococcus_phage	52.9	6.5e-08
ARC45647.1|1958955_1959858_-|capsid	phage major capsid protein	capsid	A0A0B5A5W3	Streptococcus_phage	86.0	9.7e-146
ARC45648.1|1959860_1960325_-	DUF4355 domain-containing protein	NA	A0A0B5A7G6	Streptococcus_phage	51.3	9.7e-41
AVJ52230.1|1960405_1961821_-|terminase	terminase	terminase	A0A0B5A091	Streptococcus_phage	74.8	6.3e-216
ARC45649.1|1961928_1962117_-	hypothetical protein	NA	NA	NA	NA	NA
ARC45650.1|1962116_1963337_-	hypothetical protein	NA	Q7Y4I9	Streptococcus_phage	66.0	6.6e-113
ARC45651.1|1963329_1964598_-|portal	phage portal protein	portal	A0A1X9I693	Streptococcus_phage	76.2	8.2e-191
ARC45652.1|1964594_1964951_-	hypothetical protein	NA	A0A0B5A7G9	Streptococcus_phage	49.6	5.9e-22
ARC45954.1|1965102_1965480_-	HNH endonuclease	NA	Q7Y4J1	Streptococcus_phage	71.3	2.1e-41
ARC45653.1|1966062_1966491_-	DUF1492 domain-containing protein	NA	A0A0B5A564	Streptococcus_phage	49.3	6.4e-31
ARC45654.1|1966878_1967145_-	hypothetical protein	NA	NA	NA	NA	NA
ARC45655.1|1967141_1967675_-	DUF1642 domain-containing protein	NA	A0A097PAV5	Streptococcus_pyogenes_phage	41.4	1.6e-23
ARC45656.1|1967767_1967899_-	hypothetical protein	NA	NA	NA	NA	NA
ARC45657.1|1967981_1968314_-	hypothetical protein	NA	J7KDM7	Streptococcus_phage	55.8	2.6e-27
ARC45658.1|1968316_1968586_-	hypothetical protein	NA	A7J287	Streptococcus_phage	70.8	1.3e-24
ARC45659.1|1968582_1968747_-	hypothetical protein	NA	NA	NA	NA	NA
ARC45660.1|1968743_1969160_-	hypothetical protein	NA	Q938M1	Temperate_phage	58.5	1.1e-32
ARC45661.1|1969159_1969291_-	hypothetical protein	NA	NA	NA	NA	NA
ARC45662.1|1969294_1969597_-	DUF1599 domain-containing protein	NA	J7KDH9	Streptococcus_phage	74.7	1.0e-30
ARC45663.1|1969608_1969956_-	hypothetical protein	NA	J7KK12	Streptococcus_phage	87.0	2.2e-53
ARC45664.1|1969945_1970422_-	RusA family crossover junction endodeoxyribonuclease	NA	J7KBT1	Streptococcus_phage	98.2	1.3e-59
ARC45665.1|1970411_1970615_-	hypothetical protein	NA	J7KIX6	Streptococcus_phage	96.8	1.7e-26
ARC45666.1|1970618_1971035_-	Single-stranded DNA-binding protein 3	NA	Q938M7	Temperate_phage	80.6	1.5e-56
ARC45667.1|1971027_1971702_-	single-stranded DNA-binding protein	NA	Q938M8	Temperate_phage	82.6	7.6e-95
ARC45668.1|1971702_1972185_-	hypothetical protein	NA	Q938M9	Temperate_phage	92.5	1.2e-44
ARC45669.1|1972186_1972348_-	hypothetical protein	NA	J7KDI4	Streptococcus_phage	84.9	5.2e-18
ARC45670.1|1972350_1972605_-	hypothetical protein	NA	J7KK18	Streptococcus_phage	79.8	1.1e-30
ARC45671.1|1972615_1972756_-	hypothetical protein	NA	NA	NA	NA	NA
ARC45672.1|1972752_1972986_-	hypothetical protein	NA	Q938N1	Temperate_phage	94.8	8.0e-36
AVJ52231.1|1972966_1973827_-	DnaD domain protein	NA	J7KBV5	Streptococcus_phage	85.5	5.6e-58
ARC45673.1|1973837_1974062_-	hypothetical protein	NA	J7KBY5	Streptococcus_phage	95.9	1.7e-35
ARC45674.1|1974199_1974430_-	hypothetical protein	NA	NA	NA	NA	NA
ARC45675.1|1974579_1974723_-	hypothetical protein	NA	J7KIV4	Streptococcus_phage	100.0	1.6e-18
ARC45676.1|1974734_1975484_-	phage antirepressor Ant	NA	F8HGQ0	Streptococcus_phage	60.0	6.5e-79
ARC45677.1|1975551_1975743_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
ARC45678.1|1975794_1976601_+	DUF4393 domain-containing protein	NA	A0A1S5SD60	Streptococcus_phage	36.5	1.9e-28
ARC45679.1|1976583_1976772_-	hypothetical protein	NA	NA	NA	NA	NA
ARC45680.1|1976801_1976960_-	hypothetical protein	NA	J7KH24	Streptococcus_phage	92.3	9.9e-22
ARC45681.1|1977018_1977243_+	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	67.6	2.2e-22
ARC45682.1|1977239_1977383_-	hypothetical protein	NA	NA	NA	NA	NA
ARC45683.1|1977743_1978541_+	XRE family transcriptional regulator	NA	A0A1S5S8S8	Streptococcus_phage	74.7	2.6e-65
ARC45684.1|1978542_1979100_+	GTP pyrophosphokinase	NA	Q0H269	Geobacillus_phage	30.2	1.6e-18
ARC45685.1|1979202_1979406_+	hypothetical protein	NA	O34033	Streptococcus_phage	48.4	1.7e-10
ARC45686.1|1979528_1980608_+|integrase	site-specific integrase	integrase	A0A1X9IGD8	Lactococcus_phage	40.4	3.2e-63
ARC45687.1|1980832_1981180_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
1980650:1980667	attR	ATGTCCCCTGCCGGAATC	NA	NA	NA	NA
ARC45688.1|1981763_1982960_-	voltage-gated chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	54.5	3.6e-103
