The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP017757	Cupriavidus necator strain NH9 chromosome 1, complete sequence	4347557	270514	318872	4347557	integrase,transposase	uncultured_Caudovirales_phage(25.0%)	51	264282:264297	299368:299383
264282:264297	attL	CCCTGGCGCTGGCCAA	NA	NA	NA	NA
AQV92529.1|270514_272395_-|integrase	integrase	integrase	A0A2H4J185	uncultured_Caudovirales_phage	27.1	2.7e-33
AQV92530.1|272391_274272_-|integrase	integrase	integrase	NA	NA	NA	NA
AQV92531.1|274268_275717_-|integrase	integrase	integrase	NA	NA	NA	NA
AQV92533.1|276428_277169_+	Restriction endonuclease S subunit	NA	NA	NA	NA	NA
AQV92534.1|277189_278065_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
AQV92535.1|278108_279170_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AQV92536.1|279182_279482_+	hypothetical protein	NA	NA	NA	NA	NA
AQV92537.1|279530_280604_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
AQV92538.1|280674_280995_+	hypothetical protein	NA	NA	NA	NA	NA
AQV92539.1|281012_281348_+	hypothetical protein	NA	A0A2H4N839	Lake_Baikal_phage	34.3	2.6e-11
AQV92540.1|282019_282658_+	DUF429 domain-containing protein	NA	NA	NA	NA	NA
AQV92541.1|282765_283035_-	MazF family transcriptional regulator	NA	NA	NA	NA	NA
AQV92542.1|283553_283928_-	PHA-granule associated protein 4	NA	NA	NA	NA	NA
AVK72177.1|284143_284407_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
AQV92543.1|284817_285441_+	hypothetical protein	NA	NA	NA	NA	NA
AQV92544.1|285879_286134_-	hypothetical protein	NA	NA	NA	NA	NA
AQV92545.1|286117_286699_-	serine hydrolase family protein	NA	NA	NA	NA	NA
AQV92546.1|287668_288934_-	amidohydrolase	NA	NA	NA	NA	NA
AVK72178.1|289134_289461_-	hypothetical protein	NA	NA	NA	NA	NA
AQV92547.1|289631_290063_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AQV92548.1|290123_290702_-	hypothetical protein	NA	NA	NA	NA	NA
AQV92549.1|290745_291324_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AQV92550.1|292755_293817_+	porin	NA	NA	NA	NA	NA
AVK72179.1|294160_294640_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AQV92551.1|294764_295010_+	CDP-diacylglycerol pyrophosphatase	NA	NA	NA	NA	NA
AQV92552.1|295023_295455_-	N-acetyltransferase GCN5	NA	NA	NA	NA	NA
AQV92553.1|295514_296084_-	hypothetical protein	NA	NA	NA	NA	NA
AQV92554.1|296135_296711_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AQV92555.1|297030_297477_+	hypothetical protein	NA	NA	NA	NA	NA
AVK72180.1|297635_298388_+	diguanylate cyclase	NA	NA	NA	NA	NA
AQV92556.1|298454_299429_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	51.6	4.5e-80
299368:299383	attR	CCCTGGCGCTGGCCAA	NA	NA	NA	NA
AVK72181.1|299560_300607_+	CBS domain-containing protein	NA	NA	NA	NA	NA
AQV92557.1|300737_301061_+	hypothetical protein	NA	NA	NA	NA	NA
AQV92558.1|301268_301607_-	DUF3562 domain-containing protein	NA	NA	NA	NA	NA
AQV92559.1|302481_302928_+	hypothetical protein	NA	NA	NA	NA	NA
AQV92560.1|303509_304376_+	metal-chelation protein CHAD	NA	NA	NA	NA	NA
AQV92561.1|304837_306355_+	diguanylate cyclase	NA	NA	NA	NA	NA
AQV92562.1|306422_306692_-	hypothetical protein	NA	NA	NA	NA	NA
AQV92563.2|306994_307330_-	hypothetical protein	NA	NA	NA	NA	NA
AQV92564.1|307638_307977_+	hypothetical protein	NA	NA	NA	NA	NA
AQV92565.1|308203_308551_-	hypothetical protein	NA	NA	NA	NA	NA
AQV92566.1|308918_309362_+	hypothetical protein	NA	NA	NA	NA	NA
AQV92568.1|309804_310017_-	hypothetical protein	NA	NA	NA	NA	NA
AVK72182.1|310407_310746_+	hypothetical protein	NA	NA	NA	NA	NA
AVK72183.1|310836_311031_-	DUF3562 domain-containing protein	NA	NA	NA	NA	NA
AQV92569.1|311062_311566_-	hypothetical protein	NA	NA	NA	NA	NA
AQV92570.1|311871_312765_-	DUF72 domain-containing protein	NA	F2WLJ5	Lausannevirus	25.0	7.7e-10
AQV92571.1|313821_314406_-	hypothetical protein	NA	NA	NA	NA	NA
AQV92572.1|314509_315028_+	hypothetical protein	NA	NA	NA	NA	NA
AQV92573.1|315942_317298_+	hypothetical protein	NA	NA	NA	NA	NA
AQV92574.1|317309_318872_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
CP017757	Cupriavidus necator strain NH9 chromosome 1, complete sequence	4347557	2803387	2849881	4347557	terminase,portal,transposase,protease	Burkholderia_virus(21.05%)	61	NA	NA
AQV94752.1|2803387_2807014_-	hypothetical protein	NA	A0A1B0Z0R4	Vibrio_phage	50.7	2.9e-07
AQV94753.1|2807182_2807617_-	hypothetical protein	NA	NA	NA	NA	NA
AQV94754.1|2807620_2808391_-	hypothetical protein	NA	A0A2D2W2E0	Stenotrophomonas_phage	36.1	4.1e-28
AQV94755.1|2808412_2808865_-	hypothetical protein	NA	NA	NA	NA	NA
AQV94756.1|2808861_2809197_-	hypothetical protein	NA	NA	NA	NA	NA
AQV94757.1|2809211_2809556_-	DUF2190 domain-containing protein	NA	NA	NA	NA	NA
AQV94758.1|2809596_2811672_-|protease	Clp protease ClpP	protease	B7SYD7	Stenotrophomonas_phage	58.3	1.2e-125
AQV94759.1|2811967_2812450_-	hypothetical protein	NA	NA	NA	NA	NA
AQV94760.1|2812495_2814055_-|portal	phage portal protein	portal	A0A0A0YUB7	Pseudomonas_phage	43.0	2.0e-106
AQV94761.1|2814057_2814285_-	hypothetical protein	NA	K7PMB5	Enterobacterial_phage	46.0	3.8e-06
AQV94762.1|2814354_2814663_-	hypothetical protein	NA	NA	NA	NA	NA
AQV94763.1|2814659_2816660_-|terminase	terminase	terminase	R9TMM4	Vibrio_phage	41.0	4.1e-120
AQV94764.1|2816659_2817154_-	DNA packaging Nu1	NA	NA	NA	NA	NA
AQV94765.1|2817338_2818154_-	hypothetical protein	NA	A0A291AUT0	Sinorhizobium_phage	35.2	7.0e-26
AQV94766.1|2818427_2818727_-	hypothetical protein	NA	NA	NA	NA	NA
AQV94767.1|2818723_2819545_-	crossover junction endodeoxyribonuclease RuvA	NA	U6C809	Ralstonia_phage	68.9	2.0e-41
AQV94768.1|2819541_2820975_-	hypothetical protein	NA	A0A0U5G7F5	unidentified_phage	30.4	3.7e-06
AQV94769.1|2820971_2821250_-	hypothetical protein	NA	NA	NA	NA	NA
AQV94770.1|2821246_2821432_-	hypothetical protein	NA	NA	NA	NA	NA
AQV94771.1|2821428_2821776_-	hypothetical protein	NA	NA	NA	NA	NA
AQV94772.1|2821772_2822144_-	hypothetical protein	NA	NA	NA	NA	NA
AQV94773.1|2822151_2822445_-	hypothetical protein	NA	NA	NA	NA	NA
AQV94774.1|2822441_2822975_-	hypothetical protein	NA	NA	NA	NA	NA
AQV94775.1|2822971_2824114_-	hypothetical protein	NA	A0A1J0MCP9	Streptomyces_phage	45.6	3.2e-16
AQV94776.1|2824124_2824316_-	hypothetical protein	NA	NA	NA	NA	NA
AQV94777.1|2824395_2824641_-	hypothetical protein	NA	NA	NA	NA	NA
AQV94778.1|2824772_2824982_-	hypothetical protein	NA	NA	NA	NA	NA
AQV94779.1|2825076_2825568_+	hypothetical protein	NA	A0A0P0J076	Acinetobacter_phage	52.7	5.3e-13
AQV94780.1|2825533_2825770_+	hypothetical protein	NA	NA	NA	NA	NA
AQV94781.1|2826003_2826525_+	hypothetical protein	NA	NA	NA	NA	NA
AQV94782.1|2826622_2827132_-	hypothetical protein	NA	NA	NA	NA	NA
AQV94783.1|2827165_2827891_-	hypothetical protein	NA	NA	NA	NA	NA
AQV94784.1|2828244_2828592_+	hypothetical protein	NA	NA	NA	NA	NA
AQV94785.1|2828588_2828822_+	hypothetical protein	NA	R4JG80	Burkholderia_phage	54.7	3.9e-06
AQV94786.1|2828818_2829070_+	hypothetical protein	NA	NA	NA	NA	NA
AQV94787.1|2829066_2829189_+	hypothetical protein	NA	NA	NA	NA	NA
AQV94788.1|2829188_2829320_+	hypothetical protein	NA	NA	NA	NA	NA
AQV94789.1|2829316_2829661_+	hypothetical protein	NA	NA	NA	NA	NA
AQV94790.1|2829657_2829894_+	hypothetical protein	NA	NA	NA	NA	NA
AQV94791.1|2829890_2830292_+	hypothetical protein	NA	C5IHK2	Burkholderia_virus	38.7	4.5e-10
AQV94792.1|2830322_2831180_+	DUF2303 domain-containing protein	NA	I6NVL7	Burkholderia_virus	35.2	7.6e-31
AQV94793.1|2831229_2831415_+	hypothetical protein	NA	NA	NA	NA	NA
AQV94794.1|2831411_2831936_+	hypothetical protein	NA	A0A0K2FHI1	Achromobacter_phage	37.2	1.3e-30
AQV94795.1|2832086_2832563_+	hypothetical protein	NA	NA	NA	NA	NA
AQV94796.1|2832594_2834385_+	type II restriction endonuclease subunit M	NA	A0A1I9KFW0	Aeromonas_phage	44.7	2.1e-136
AQV94798.1|2834938_2835394_+	hypothetical protein	NA	NA	NA	NA	NA
AQV94799.1|2835390_2835609_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AQV94800.1|2835616_2836378_+	hypothetical protein	NA	Q8W6R7	Burkholderia_virus	50.4	6.9e-60
AQV94801.1|2836380_2836860_+|transposase	transposase	transposase	NA	NA	NA	NA
AQV94802.1|2836856_2837951_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.2	1.1e-10
AQV94803.1|2838059_2838404_+	hypothetical protein	NA	Q6JIJ8	Burkholderia_virus	49.5	2.7e-19
AQV94804.1|2838378_2839539_-	putative transmembrane protein	NA	NA	NA	NA	NA
AQV94805.1|2839558_2839981_-	TadE family protein	NA	NA	NA	NA	NA
AQV94806.1|2840549_2841293_-	DNA polymerase III subunit epsilon	NA	NA	NA	NA	NA
AQV94807.1|2841407_2841929_-	hypothetical protein	NA	NA	NA	NA	NA
AQV94808.1|2842510_2842732_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AQV94809.1|2842981_2843458_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
AQV94810.1|2843801_2844641_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AQV94811.1|2844699_2846232_-	exopolyphosphatase	NA	NA	NA	NA	NA
AQV94812.1|2846426_2848514_+	RNA degradosome polyphosphate kinase	NA	NA	NA	NA	NA
AQV94813.1|2848564_2849881_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
>prophage 3
CP017757	Cupriavidus necator strain NH9 chromosome 1, complete sequence	4347557	4116704	4122733	4347557		uncultured_Caudovirales_phage(33.33%)	9	NA	NA
AQV95984.1|4116704_4117292_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	3.1e-15
AQV95985.1|4117356_4117752_-	YraN family protein	NA	NA	NA	NA	NA
AQV95986.1|4117770_4118679_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	40.0	7.0e-35
AQV95987.1|4118766_4119489_-	RlpA-like protein	NA	H2BCY4	Synechococcus_phage	54.3	3.3e-19
AQV95988.1|4119782_4120433_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AQV95989.1|4120437_4121094_+	exonuclease	NA	A0A2L0UZL4	Agrobacterium_phage	40.4	1.1e-34
AQV95990.1|4121299_4121527_+	hypothetical protein	NA	NA	NA	NA	NA
AQV95991.1|4121615_4121975_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	44.4	1.4e-18
AQV95992.1|4122148_4122733_+	GNAT family N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	42.3	2.8e-21
>prophage 1
CP017758	Cupriavidus necator strain NH9 chromosome 2, complete sequence	3395604	251083	291590	3395604	transposase,integrase	Ralstonia_phage(20.0%)	34	267435:267451	285423:285439
AQV96384.1|251083_251779_-|transposase	transposase	transposase	NA	NA	NA	NA
AQV96385.1|252002_254705_-	DUF4214 domain-containing protein	NA	NA	NA	NA	NA
AQV96386.1|254976_256353_-|transposase	transposase	transposase	NA	NA	NA	NA
AQV96387.1|256577_257780_-	hypothetical protein	NA	NA	NA	NA	NA
AQV96388.1|257763_258969_-	sodium:calcium exchanger	NA	NA	NA	NA	NA
AQV96389.1|259367_259868_+	hypothetical protein	NA	NA	NA	NA	NA
AQV96390.1|259897_260557_-	hypothetical protein	NA	NA	NA	NA	NA
AQV96391.1|261399_262395_-	plasmid segregation protein ParM	NA	NA	NA	NA	NA
AQV96392.1|262695_263583_-|integrase	integrase	integrase	NA	NA	NA	NA
AQV96393.1|266605_269050_-	hypothetical protein	NA	NA	NA	NA	NA
267435:267451	attL	GCACCAGTGATGGTAAC	NA	NA	NA	NA
AQV96394.1|269823_271023_-|integrase	site-specific integrase	integrase	A0A221SAN4	Ralstonia_phage	25.9	2.3e-17
AQV96395.1|272465_272711_+	MazF family transcriptional regulator	NA	NA	NA	NA	NA
AVK72219.1|272796_272958_+	DUF433 domain-containing protein	NA	NA	NA	NA	NA
AQV96396.1|273197_273506_+	hypothetical protein	NA	NA	NA	NA	NA
AQV96397.1|273577_273775_+	hypothetical protein	NA	NA	NA	NA	NA
AQV96398.1|274287_274917_+	hypothetical protein	NA	NA	NA	NA	NA
AQV96399.1|274913_275210_+	hypothetical protein	NA	NA	NA	NA	NA
AVK72220.1|275386_275875_-	DUF1917 domain-containing protein	NA	NA	NA	NA	NA
AQV96400.1|276577_277072_+	hypothetical protein	NA	NA	NA	NA	NA
AVK72221.1|277191_277524_+	hypothetical protein	NA	NA	NA	NA	NA
AVK72222.1|277591_277846_+	hypothetical protein	NA	NA	NA	NA	NA
AQV96401.1|278046_278385_+	hypothetical protein	NA	NA	NA	NA	NA
AQV96402.1|279190_281017_+	DUF559 domain-containing protein	NA	Q9DSV4	Diadromus_pulchellus_ascovirus	33.7	6.0e-17
AQV96403.1|281087_282062_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	51.6	4.5e-80
AQV96404.1|282195_283950_+	hypothetical protein	NA	A0A2H4UVQ8	Bodo_saltans_virus	27.0	6.8e-10
AQV96405.1|283965_284730_+	hypothetical protein	NA	NA	NA	NA	NA
AQV96406.1|285126_285426_-	hypothetical protein	NA	NA	NA	NA	NA
AQV96407.1|286822_287089_+	hypothetical protein	NA	NA	NA	NA	NA
285423:285439	attR	GCACCAGTGATGGTAAC	NA	NA	NA	NA
AQV96408.1|287300_287675_-	PHA-granule associated protein 4	NA	NA	NA	NA	NA
AQV96409.1|287870_288185_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
AQV96410.1|288506_289247_-	endonuclease	NA	H6X497	Enterobacteria_phage	31.4	2.1e-21
AQV96411.1|289432_289759_+	DNA-binding protein	NA	NA	NA	NA	NA
AQV96412.1|289990_290179_-	hypothetical protein	NA	NA	NA	NA	NA
AQV96413.1|290348_291590_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
CP017758	Cupriavidus necator strain NH9 chromosome 2, complete sequence	3395604	561653	605968	3395604	transposase,integrase	Mycobacterium_virus(16.67%)	40	600820:600834	608815:608829
AQV96645.1|561653_562736_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AQV96646.1|562748_563048_+	hypothetical protein	NA	NA	NA	NA	NA
AQV96647.1|563302_564472_+|transposase	transposase	transposase	Q19ZT4	Mycobacterium_virus	36.0	5.1e-30
AQV96648.1|564960_565161_-	hypothetical protein	NA	NA	NA	NA	NA
AQV96649.1|565144_565693_-	hypothetical protein	NA	NA	NA	NA	NA
AQV96650.1|565841_566552_-	hypothetical protein	NA	NA	NA	NA	NA
AQV96651.1|566814_567675_-	hypothetical protein	NA	A0A1S6L011	Salmonella_phage	38.1	1.9e-45
AQV96652.1|567976_569140_+|transposase	transposase	transposase	Q19ZT4	Mycobacterium_virus	38.0	2.3e-30
AQV96653.1|569161_569884_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AQV96654.1|569897_570704_-	hypothetical protein	NA	NA	NA	NA	NA
AQV96655.1|571185_571974_-	hypothetical protein	NA	NA	NA	NA	NA
AQV96656.1|572375_572870_+	hypothetical protein	NA	NA	NA	NA	NA
AQV96657.1|573221_573593_+	hypothetical protein	NA	NA	NA	NA	NA
AQV96658.1|573699_574524_-	alpha/beta hydrolase	NA	W8EHU1	Mycobacterium_phage	28.8	2.4e-05
AQV96659.1|575045_576782_+	thiamine pyrophosphate-binding protein	NA	G9E525	Ostreococcus_lucimarinus_virus	27.8	5.1e-26
AQV96660.1|576784_577585_+	NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.4	1.3e-13
AQV96661.1|577598_578546_+	hypothetical protein	NA	NA	NA	NA	NA
AQV96662.1|578639_579995_+	MFS transporter	NA	NA	NA	NA	NA
AQV96663.1|580182_581067_-|transposase	transposase	transposase	U5P429	Shigella_phage	52.4	1.2e-44
AQV96664.1|581063_581360_-|transposase	transposase	transposase	A9YX41	Burkholderia_phage	41.5	7.9e-12
AQV96665.1|581704_582181_+|transposase	transposase	transposase	NA	NA	NA	NA
AQV96666.1|582180_582534_+|transposase	transposase	transposase	S5VXZ8	Leptospira_phage	42.2	6.5e-21
AQV96667.1|582591_584199_+|transposase	transposase	transposase	A0A218MNE7	uncultured_virus	34.2	3.7e-63
AQV96668.1|584257_584518_-	hypothetical protein	NA	NA	NA	NA	NA
AQV96669.1|584871_585387_+	hypothetical protein	NA	NA	NA	NA	NA
AQV96670.1|585734_586268_-	hypothetical protein	NA	NA	NA	NA	NA
AQV96671.1|586441_587005_+	hypothetical protein	NA	NA	NA	NA	NA
AVK72237.1|587988_588444_+	hypothetical protein	NA	U5P429	Shigella_phage	32.7	4.8e-08
AQV96672.1|588440_589709_+	hypothetical protein	NA	NA	NA	NA	NA
AQV96673.1|589899_591477_+	hypothetical protein	NA	NA	NA	NA	NA
AQV96674.1|591491_592931_+	hypothetical protein	NA	NA	NA	NA	NA
AQV96675.1|592927_593428_+	hypothetical protein	NA	NA	NA	NA	NA
AQV96676.1|593445_594687_-|transposase	transposase	transposase	NA	NA	NA	NA
AVK72238.1|594721_594910_+	hypothetical protein	NA	NA	NA	NA	NA
AQV96678.1|595844_597086_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AQV96679.1|597343_598933_+	hypothetical protein	NA	NA	NA	NA	NA
AQV96680.1|600406_600769_-	hypothetical protein	NA	NA	NA	NA	NA
AQV96681.1|600765_602646_-|integrase	integrase	integrase	A0A2H4J185	uncultured_Caudovirales_phage	27.1	2.7e-33
600820:600834	attL	CGCCTGCGCCTCGAT	NA	NA	NA	NA
AQV96682.1|602642_604523_-|integrase	integrase	integrase	NA	NA	NA	NA
AQV96683.1|604519_605968_-|integrase	integrase	integrase	NA	NA	NA	NA
608815:608829	attR	CGCCTGCGCCTCGAT	NA	NA	NA	NA
>prophage 3
CP017758	Cupriavidus necator strain NH9 chromosome 2, complete sequence	3395604	765071	786780	3395604	transposase	Paenibacillus_phage(33.33%)	24	NA	NA
AQV96821.1|765071_766679_-|transposase	transposase	transposase	A0A218MNE7	uncultured_virus	34.4	3.7e-63
AQV96822.1|766736_767090_-|transposase	transposase	transposase	S5VXZ8	Leptospira_phage	43.1	1.7e-21
AQV96823.1|767089_767566_-|transposase	transposase	transposase	NA	NA	NA	NA
AQV96824.1|767788_768268_-	DUF1697 domain-containing protein	NA	NA	NA	NA	NA
AQV96825.1|768440_768821_-	VOC family protein	NA	NA	NA	NA	NA
AQV96826.1|769078_770005_+	alpha/beta hydrolase	NA	A0A1V0SD13	Indivirus	28.4	9.1e-06
AQV96827.1|770078_770846_-	cobyric acid synthase	NA	NA	NA	NA	NA
AQV96828.1|771099_772305_-	hypothetical protein	NA	NA	NA	NA	NA
AQV96829.1|772531_773578_+	lyase	NA	NA	NA	NA	NA
AQV96830.1|773813_775379_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AQV96831.1|775562_776504_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AQV96832.1|776717_777107_+	cupin	NA	NA	NA	NA	NA
AQV96833.1|777137_778268_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AQV96834.1|778459_779401_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AQV96835.1|779637_779865_+	hypothetical protein	NA	NA	NA	NA	NA
AQV96836.1|779907_780276_+|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	42.7	1.0e-21
AQV96837.1|780383_780665_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	40.7	7.7e-09
AQV96839.1|781402_781819_-	glycine zipper family protein	NA	NA	NA	NA	NA
AQV96840.1|781832_782270_-	hypothetical protein	NA	NA	NA	NA	NA
AQV96841.1|782621_783284_-	dihydrofolate reductase	NA	NA	NA	NA	NA
AQV96842.1|783655_784087_+	hypothetical protein	NA	NA	NA	NA	NA
AQV96843.1|784402_784855_+	VOC family protein	NA	NA	NA	NA	NA
AQV96844.1|784932_786183_-	FAD-linked oxidase	NA	S4VRT3	Pandoravirus	43.5	2.2e-31
AQV96845.1|786369_786780_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
CP017758	Cupriavidus necator strain NH9 chromosome 2, complete sequence	3395604	1246470	1291672	3395604	transposase,protease,integrase	Staphylococcus_phage(20.0%)	43	1251929:1251950	1293021:1293042
AQV97231.1|1246470_1247496_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AQV97232.1|1247858_1248566_-	aspartate racemase	NA	NA	NA	NA	NA
AQV97233.1|1248699_1249863_-	ATPase	NA	NA	NA	NA	NA
AQV97234.1|1249996_1251097_-	CoA transferase	NA	NA	NA	NA	NA
AQV97235.1|1251175_1252168_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
1251929:1251950	attL	GCCGATGATGCCGCCGGCGCCG	NA	NA	NA	NA
AQV97236.1|1252231_1253416_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AQV97237.1|1253427_1254981_-	AMP-dependent synthetase	NA	A0A2H4PQM9	Staphylococcus_phage	27.5	1.6e-34
AQV97238.1|1255114_1256008_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AQV97239.1|1256030_1257035_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AQV97240.1|1257094_1257337_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AQV97241.1|1257360_1258488_-	porin	NA	NA	NA	NA	NA
AQV97242.1|1259104_1259854_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.5	3.6e-37
AQV97243.1|1259856_1260612_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AQV97244.1|1260615_1261314_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AQV97245.1|1261341_1262160_-	cysteine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AQV97246.1|1262196_1263402_-	aspartate aminotransferase	NA	NA	NA	NA	NA
AQV97248.1|1263624_1263939_-	hypothetical protein	NA	NA	NA	NA	NA
AVK72243.1|1263895_1264564_-	hypothetical protein	NA	NA	NA	NA	NA
AVK72244.1|1264532_1264880_-	hypothetical protein	NA	NA	NA	NA	NA
AQV97250.1|1265586_1265949_-	hypothetical protein	NA	NA	NA	NA	NA
AQV97251.1|1265945_1267826_-|integrase	integrase	integrase	A0A2H4J185	uncultured_Caudovirales_phage	27.1	2.7e-33
AQV97252.1|1267822_1269703_-|integrase	integrase	integrase	NA	NA	NA	NA
AQV97253.1|1269699_1271148_-|integrase	integrase	integrase	NA	NA	NA	NA
AQV97255.1|1271564_1272515_-	hypothetical protein	NA	M1NSB9	Streptococcus_phage	31.7	7.6e-08
AQV97256.1|1272571_1274059_-	hypothetical protein	NA	NA	NA	NA	NA
AQV97257.1|1274055_1275198_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AQV97258.1|1275728_1276358_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AQV97259.1|1276566_1277571_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AQV97260.1|1277632_1278799_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AQV97261.1|1278819_1280010_-	CoA transferase	NA	NA	NA	NA	NA
AQV97262.1|1280023_1280794_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AQV97263.1|1280912_1281749_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AQV97264.1|1281771_1282362_-	OmpA family protein	NA	NA	NA	NA	NA
AQV97265.1|1282472_1283207_-|protease	serine protease	protease	NA	NA	NA	NA
AQV97266.1|1283271_1283760_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
AQV97267.1|1283802_1285512_-	serine/threonine protein kinase	NA	M1PCM5	Moumouvirus	31.8	3.7e-21
AQV97268.1|1285536_1286316_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
AQV97269.1|1286393_1288118_-	hypothetical protein	NA	NA	NA	NA	NA
AQV97270.1|1288565_1289444_-	lipid A biosynthesis lauroyl acyltransferase	NA	NA	NA	NA	NA
AQV97271.1|1289930_1290329_-	hypothetical protein	NA	NA	NA	NA	NA
AQV97272.1|1290426_1291050_-	transcriptional regulator FlhC	NA	NA	NA	NA	NA
AQV97273.1|1291109_1291319_+	hypothetical protein	NA	NA	NA	NA	NA
AQV97274.1|1291468_1291672_+|transposase	transposase	transposase	NA	NA	NA	NA
1293021:1293042	attR	GCCGATGATGCCGCCGGCGCCG	NA	NA	NA	NA
>prophage 5
CP017758	Cupriavidus necator strain NH9 chromosome 2, complete sequence	3395604	2912174	2969441	3395604	transposase,holin	Hokovirus(20.0%)	42	NA	NA
AQV98711.1|2912174_2913305_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AQV98712.1|2914082_2914460_-	hypothetical protein	NA	NA	NA	NA	NA
AQV98713.1|2914459_2915425_-|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	50.6	5.8e-80
AQV98714.1|2915503_2916301_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AQV98715.1|2916703_2920018_-	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	27.6	2.4e-40
AQV98716.1|2920108_2920780_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AQV98717.1|2921035_2921677_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AQV98718.1|2921827_2925151_-	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	38.7	2.2e-33
AQV98719.1|2925366_2926434_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AQV98720.1|2926526_2929094_-	fimbrial assembly protein	NA	NA	NA	NA	NA
AQV98721.1|2929220_2929991_-	molecular chaperone EcpD	NA	NA	NA	NA	NA
AQV98722.1|2930093_2930654_-	fimbrial protein	NA	NA	NA	NA	NA
AQV98723.1|2931048_2932836_-	alpha,alpha-trehalase	NA	NA	NA	NA	NA
AQV98724.1|2932964_2934389_-	MFS transporter	NA	NA	NA	NA	NA
AQV98725.1|2934640_2937502_+	acyl-phosphate glycerol 3-phosphate acyltransferase	NA	A0A1V0SBX8	Catovirus	22.2	4.6e-16
AQV98726.1|2937530_2939720_-	ligand-gated channel protein	NA	A0A1B0VCF0	Salmonella_phage	38.5	2.4e-57
AQV98727.1|2940031_2940652_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
AQV98728.1|2940727_2941681_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AQV98729.1|2941806_2942976_+	amidohydrolase	NA	NA	NA	NA	NA
AQV98730.1|2943042_2944368_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	39.0	1.6e-75
AQV98731.1|2944386_2945208_-	CoA ester lyase	NA	NA	NA	NA	NA
AQV98732.1|2945220_2946393_-	CoA transferase	NA	NA	NA	NA	NA
AQV98733.1|2946518_2947475_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AQV98734.1|2947582_2948566_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AQV98735.1|2948752_2949910_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.5	9.6e-13
AQV98736.1|2949949_2951287_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.5	1.2e-22
AQV98737.1|2951470_2952559_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AQV98738.1|2952794_2953916_+	ring-hydroxylating oxygenase subunit alpha	NA	NA	NA	NA	NA
AQV98739.1|2953943_2955410_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AQV98740.1|2955511_2957242_+|holin	choline dehydrogenase	holin	A0A1V0S9J5	Catovirus	30.6	1.6e-51
AQV98741.1|2957411_2958299_+|holin	choline dehydrogenase	holin	NA	NA	NA	NA
AQV98742.1|2958347_2958650_+	hypothetical protein	NA	NA	NA	NA	NA
AQV98743.1|2958992_2960639_+	amino acid permease	NA	NA	NA	NA	NA
AQV98744.1|2960720_2961674_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AQV98745.1|2961778_2962243_+	vanillate O-demethylase oxidoreductase VanB	NA	NA	NA	NA	NA
AQV98746.1|2962223_2962580_+	transcriptional regulator	NA	NA	NA	NA	NA
AQV98747.1|2962689_2963907_+	efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AQV98748.1|2963930_2964623_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	1.2e-34
AQV98749.1|2964629_2965784_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AQV98750.1|2965799_2966966_+	multidrug ABC transporter permease	NA	NA	NA	NA	NA
AQV98751.1|2967094_2967328_-	CDP-diacylglycerol pyrophosphatase	NA	NA	NA	NA	NA
AQV98752.1|2968415_2969441_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 6
CP017758	Cupriavidus necator strain NH9 chromosome 2, complete sequence	3395604	3228437	3288605	3395604	plate,transposase,integrase	Burkholderia_phage(33.33%)	52	3244399:3244416	3303458:3303475
AQV98982.1|3228437_3228893_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AQV98983.1|3228920_3229442_-	virulence factor secretion apparatus protein	NA	NA	NA	NA	NA
AQV98984.1|3229501_3231013_-	EvpB family type VI secretion protein	NA	NA	NA	NA	NA
AQV98985.1|3231078_3231615_-	type VI secretion system-associated protein	NA	NA	NA	NA	NA
AQV98986.1|3232421_3233129_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AQV98987.1|3233205_3233412_-	hypothetical protein	NA	NA	NA	NA	NA
AQV98988.1|3233454_3234048_-	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
AQV98989.1|3234337_3235807_-	succinate-semialdehyde dehydrogenase (NADP(+))	NA	NA	NA	NA	NA
AQV98990.1|3235884_3237168_-	4-aminobutyrate transaminase	NA	NA	NA	NA	NA
AQV98991.1|3237309_3238866_+	DNA-binding protein	NA	NA	NA	NA	NA
AQV98992.1|3238927_3240640_-	amidohydrolase	NA	NA	NA	NA	NA
AQV98993.1|3240738_3242088_-	DUF1329 domain-containing protein	NA	NA	NA	NA	NA
AQV98994.1|3242400_3243318_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AQV98995.1|3243478_3244891_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
3244399:3244416	attL	GGCCCTTGTGCAGGTCGT	NA	NA	NA	NA
AQV98996.1|3244976_3245321_-	cupin	NA	NA	NA	NA	NA
AQV98997.1|3245388_3246873_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AQV98998.1|3246895_3247822_-	agmatinase	NA	NA	NA	NA	NA
AQV98999.1|3248059_3249562_-	nitrate reductase	NA	NA	NA	NA	NA
AQV99000.1|3249660_3250653_-	hypothetical protein	NA	NA	NA	NA	NA
AQV99001.1|3250680_3253047_-	RND transporter	NA	NA	NA	NA	NA
AQV99002.1|3253147_3254947_-	DUF1302 domain-containing protein	NA	NA	NA	NA	NA
AQV99003.1|3255170_3255380_-	hypothetical protein	NA	NA	NA	NA	NA
AQV99004.1|3255653_3255953_-	hypothetical protein	NA	NA	NA	NA	NA
AQV99005.1|3255965_3257027_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AQV99006.1|3257102_3257300_-	DUF3562 domain-containing protein	NA	NA	NA	NA	NA
AQV99007.1|3257386_3258253_-	metal-chelation protein CHAD	NA	NA	NA	NA	NA
AQV99008.1|3258837_3259284_-	hypothetical protein	NA	NA	NA	NA	NA
AQV99009.1|3260349_3260793_-	hypothetical protein	NA	NA	NA	NA	NA
AQV99010.1|3261157_3261475_+	hypothetical protein	NA	NA	NA	NA	NA
AQV99011.1|3261556_3261988_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AVK72255.1|3262624_3262951_+	hypothetical protein	NA	NA	NA	NA	NA
AQV99013.1|3263277_3263682_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AQV99015.1|3264152_3264842_+	transcriptional regulator	NA	NA	NA	NA	NA
AQV99016.1|3264884_3265391_+	hypothetical protein	NA	NA	NA	NA	NA
AQV99017.1|3265501_3266476_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	51.6	4.5e-80
AQV99018.1|3266622_3267555_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AQV99019.1|3267789_3268875_-	alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.3	3.9e-32
AQV99020.1|3268963_3270622_-	phospholipase D family protein	NA	NA	NA	NA	NA
AQV99021.1|3271009_3272545_+	gamma-aminobutyrate permease	NA	NA	NA	NA	NA
AQV99022.1|3272747_3273041_-	addiction module antitoxin	NA	NA	NA	NA	NA
AQV99023.1|3273024_3273291_-	RelB/DinJ family addiction module antitoxin	NA	NA	NA	NA	NA
AQV99024.1|3273494_3273875_+	hypothetical protein	NA	NA	NA	NA	NA
AQV99025.1|3273907_3274288_-	DUF427 domain-containing protein	NA	NA	NA	NA	NA
AQV99026.1|3274391_3275384_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AQV99027.1|3275459_3276617_-	formyl-CoA transferase	NA	NA	NA	NA	NA
AQV99028.1|3276625_3277573_-	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	27.0	4.3e-19
AQV99029.1|3277794_3278757_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AQV99030.1|3278944_3279637_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
AQV99031.1|3279869_3280961_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AQV99032.1|3284471_3285755_-	hypothetical protein	NA	NA	NA	NA	NA
AQV99033.1|3285757_3286018_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
AQV99035.1|3287156_3288605_+|integrase	integrase	integrase	NA	NA	NA	NA
3303458:3303475	attR	GGCCCTTGTGCAGGTCGT	NA	NA	NA	NA
>prophage 1
CP017759	Cupriavidus necator strain NH9 plasmid pENH92, complete sequence	426602	2618	52559	426602	holin,transposase	Catovirus(25.0%)	40	NA	NA
AQV99128.1|2618_3095_+|transposase	transposase	transposase	NA	NA	NA	NA
AQV99129.1|3094_3448_+|transposase	transposase	transposase	NA	NA	NA	NA
AQV99130.1|3505_5098_+|transposase	transposase	transposase	S5VTD3	Leptospira_phage	35.8	9.3e-67
AQV99131.1|5172_5433_-	hypothetical protein	NA	NA	NA	NA	NA
AQV99132.1|5523_7131_-|transposase	transposase	transposase	NA	NA	NA	NA
AQV99133.1|7649_8672_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AQV99134.1|8722_9163_+	hypothetical protein	NA	NA	NA	NA	NA
AQV99135.1|9906_11466_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	2.0e-13
AQV99136.1|11462_12701_+	ABC transporter permease	NA	NA	NA	NA	NA
AQV99137.1|12773_13955_+	porin	NA	NA	NA	NA	NA
AQV99138.1|14095_15067_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AQV99139.1|15224_15968_+	SDR family NAD(P)-dependent oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	28.3	2.2e-10
AQV99140.1|16059_16914_+	gluconolactonase	NA	NA	NA	NA	NA
AQV99141.1|17454_18369_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AQV99142.1|18591_18951_+	hypothetical protein	NA	NA	NA	NA	NA
AQV99143.1|20230_21730_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AQV99144.1|22085_23054_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AQV99145.1|23125_24742_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.0	5.0e-52
AQV99146.1|25126_25369_+	hypothetical protein	NA	NA	NA	NA	NA
AQV99147.1|25680_26649_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AQV99148.1|26746_28354_-	FAD-dependent oxidoreductase	NA	A0A1V0S9J5	Catovirus	28.5	1.2e-53
AQV99149.1|28474_29458_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AQV99150.1|29587_30910_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	32.3	1.1e-44
AQV99152.1|31902_32664_-	isochorismatase	NA	NA	NA	NA	NA
AQV99153.1|33294_33852_-	hypothetical protein	NA	NA	NA	NA	NA
AQV99154.1|33869_35075_-	MFS transporter	NA	NA	NA	NA	NA
AQV99155.1|35839_36814_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	51.6	4.5e-80
AQV99156.1|37424_38453_-	amidohydrolase	NA	NA	NA	NA	NA
AQV99157.1|38449_39031_-	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
AQV99158.1|39034_39913_-	3-keto-5-aminohexanoate cleavage protein	NA	A0A1V0SL81	Klosneuvirus	29.0	2.3e-27
AQV99159.1|39999_40251_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AQV99160.1|40279_41107_-	SDR family NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.5	3.6e-14
AQV99161.1|41124_42900_-	monooxygenase	NA	NA	NA	NA	NA
AQV99162.1|43107_44019_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AQV99163.1|44479_45454_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AQV99164.1|45716_46706_+	hypothetical protein	NA	NA	NA	NA	NA
AQV99165.1|47423_48398_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	51.6	4.5e-80
AQV99166.1|49468_50452_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
AQV99167.1|50461_51538_+	hypothetical protein	NA	A0A1V0S9M4	Catovirus	30.8	1.5e-28
AQV99168.1|51584_52559_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	51.6	4.5e-80
>prophage 2
CP017759	Cupriavidus necator strain NH9 plasmid pENH92, complete sequence	426602	224326	311094	426602	holin,integrase,transposase,portal	Staphylococcus_phage(13.04%)	77	268431:268490	301274:301399
AQV99312.1|224326_225745_+|integrase	integrase	integrase	NA	NA	NA	NA
AQV99313.1|226043_226514_-	hypothetical protein	NA	NA	NA	NA	NA
AQV99314.1|226510_228166_-	acyl-CoA synthetase	NA	A0A2H4PQM9	Staphylococcus_phage	29.2	8.6e-31
AQV99315.1|228194_229337_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AQV99316.1|229348_230479_-	4-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
AQV99317.1|230505_232074_-	propionate CoA-transferase	NA	NA	NA	NA	NA
AQV99318.1|232111_232552_-	dehydratase	NA	NA	NA	NA	NA
AQV99319.1|232578_233703_-	glycosyl hydrolase	NA	NA	NA	NA	NA
AQV99320.1|233866_234745_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	27.2	7.8e-07
AQV99321.1|234802_236395_-	aldehyde dehydrogenase (NADP(+))	NA	NA	NA	NA	NA
AQV99322.1|236391_237612_-	ABC transporter permease	NA	NA	NA	NA	NA
AQV99323.1|237668_238697_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AQV99324.1|238711_239599_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AQV99325.1|239620_240325_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	9.3e-11
AQV99326.1|240327_241107_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.9	3.0e-10
AQV99327.1|241464_241722_-	hypothetical protein	NA	NA	NA	NA	NA
AQV99328.1|241835_242474_+|portal	phage portal protein	portal	NA	NA	NA	NA
AQV99329.1|242524_242974_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
AQV99330.2|243608_243926_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AQV99331.1|243958_245302_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.7	3.8e-29
AQV99332.1|245480_246296_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
AQV99333.1|246299_247904_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.4	3.2e-30
AQV99334.1|247896_248475_-	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	40.5	5.7e-14
AQV99335.1|248471_249287_-	carbon monoxide dehydrogenase	NA	NA	NA	NA	NA
AQV99336.1|249283_252322_-	carbon monoxide dehydrogenase	NA	A0A0P0I429	Acinetobacter_phage	25.1	1.0e-37
AQV99337.1|252774_253680_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AQV99338.1|253700_254402_-	fatty acid hydroxylase	NA	NA	NA	NA	NA
AQV99339.1|254480_256220_-|holin	glucose-methanol-choline oxidoreductase	holin	A0A1V0SI18	Klosneuvirus	25.4	2.4e-31
AQV99340.1|256254_257217_-	MFS transporter	NA	NA	NA	NA	NA
AQV99341.1|257274_257868_-	3-octaprenyl-4-hydroxybenzoate carboxy-lyase	NA	NA	NA	NA	NA
AQV99342.1|257872_259366_-	3-octaprenyl-4-hydroxybenzoate carboxy-lyase	NA	NA	NA	NA	NA
AQV99343.1|259758_260703_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AQV99344.1|260699_262154_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AQV99345.1|262488_263154_+	adenylate kinase	NA	NA	NA	NA	NA
AQV99346.1|263681_264566_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AQV99347.1|264733_265108_+	ABC-type branched-chain amino acid transport systems	NA	NA	NA	NA	NA
AQV99348.1|265281_266247_+	hypothetical protein	NA	G1JX48	Mycobacterium_phage	27.4	9.5e-06
AQV99350.1|266540_266951_+|transposase	transposase	transposase	NA	NA	NA	NA
AQV99351.1|266947_268042_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.2	1.1e-10
AQV99352.1|268038_268506_+|integrase	putative integrase	integrase	NA	NA	NA	NA
268431:268490	attL	AAACTATGCCGCTAGCCTTACTATGCCGATTGGAATGGGGAAGACCCGAAAATTCAGCGT	NA	NA	NA	NA
AQV99353.1|268556_269789_+|integrase	integrase/recombinase	integrase	A0A1L4BKH1	Thermus_phage	29.6	2.4e-09
AQV99354.1|269785_270715_+|integrase	integrase	integrase	Q6SEA7	Lactobacillus_prophage	35.8	7.7e-05
AQV99355.1|270711_271710_+|integrase	integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	27.8	4.7e-16
AVK72256.1|271862_272276_+	hypothetical protein	NA	NA	NA	NA	NA
AQV99356.1|272272_273277_+|integrase	integrase	integrase	S5W9T9	Leptospira_phage	27.7	3.3e-09
AQV99357.1|273385_274240_-	hypothetical protein	NA	A0A1B0V7H9	Salmonella_phage	40.3	4.6e-20
AQV99358.1|274252_275359_-	porin	NA	NA	NA	NA	NA
AQV99359.1|275446_276961_-	carotenoid oxygenase	NA	NA	NA	NA	NA
AQV99360.1|276975_277770_-	hypothetical protein	NA	NA	NA	NA	NA
AQV99361.1|277795_279523_-	hypothetical protein	NA	NA	NA	NA	NA
AQV99362.1|279542_280535_-	nitronate monooxygenase	NA	NA	NA	NA	NA
AQV99363.1|280797_281724_+	transcriptional regulator	NA	NA	NA	NA	NA
AQV99364.1|281828_283022_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
AQV99365.1|283142_284126_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
AQV99366.1|284201_285542_+	MFS transporter	NA	NA	NA	NA	NA
AQV99367.1|285567_286332_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AQV99368.1|286328_287816_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AQV99369.1|288025_288355_+	hypothetical protein	NA	NA	NA	NA	NA
AQV99370.1|288594_289071_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AQV99371.1|289070_289424_+|transposase	transposase	transposase	NA	NA	NA	NA
AQV99372.1|289451_291086_+|transposase	transposase	transposase	S5VTD3	Leptospira_phage	35.8	2.0e-72
AQV99373.1|291160_291421_-	hypothetical protein	NA	NA	NA	NA	NA
AQV99374.1|291618_293289_+|integrase	integrase	integrase	NA	NA	NA	NA
AQV99375.1|293292_296277_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	26.9	4.4e-78
AQV99376.1|296457_297423_+	hypothetical protein	NA	G1JX48	Mycobacterium_phage	27.4	9.5e-06
AQV99377.1|297419_298067_+|integrase	integrase	integrase	NA	NA	NA	NA
AQV99378.1|298053_299052_-|integrase	integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	27.8	4.7e-16
AQV99379.1|299048_299978_-|integrase	integrase	integrase	Q6SEA7	Lactobacillus_prophage	35.8	7.7e-05
AQV99380.1|299974_301207_-|integrase	integrase/recombinase	integrase	A0A1L4BKH1	Thermus_phage	29.6	2.4e-09
AQV99381.1|302332_302836_+	hypothetical protein	NA	NA	NA	NA	NA
301274:301399	attR	ACGCTGAATTTTCGGGTCTTCCCCATTCCAATCGGCATAGTAAGGCTAGCGGCATAGTTTACGTACTTGACTCCCGATTCCACGATGCCCTTCTTCTGTGGGTCCCGTGGCGGACAGGGATCAATG	NA	NA	NA	NA
AQV99382.1|302874_303660_+	hypothetical protein	NA	NA	NA	NA	NA
AQV99383.1|303656_303851_+	hypothetical protein	NA	NA	NA	NA	NA
AQV99384.1|303875_305252_-	serine/threonine protein kinase	NA	A0A2I2L395	Orpheovirus	25.4	1.1e-07
AQV99385.1|305403_308604_-	hypothetical protein	NA	NA	NA	NA	NA
AQV99386.1|308822_309029_-	hypothetical protein	NA	NA	NA	NA	NA
AQV99387.1|309025_309898_-	hypothetical protein	NA	NA	NA	NA	NA
AQV99388.1|309984_311094_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
