The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP019213	Escherichia coli strain WCHEC050613 chromosome, complete genome	4670066	1005017	1018200	4670066		Escherichia_phage(50.0%)	12	NA	NA
APW91891.1|1005017_1005779_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
APW91890.1|1005772_1006399_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
APW91889.1|1006538_1007678_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
APW91888.1|1007740_1008733_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
APW91887.1|1008826_1010191_-	permease	NA	NA	NA	NA	NA
APW91886.1|1010279_1011056_-	hypothetical protein	NA	NA	NA	NA	NA
APW91885.1|1011060_1011699_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
APW91884.1|1011695_1012958_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
APW91883.1|1012954_1013863_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
APW91882.1|1014058_1014826_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
APW91881.1|1014876_1015533_-	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
APW91880.1|1015638_1018200_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 2
CP019213	Escherichia coli strain WCHEC050613 chromosome, complete genome	4670066	1360042	1411731	4670066	terminase,tail,holin,protease,lysis,transposase,portal,coat,head	Enterobacteria_phage(54.39%)	67	NA	NA
APW91553.1|1360042_1361581_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	94.3	3.8e-283
APW91552.1|1361928_1365522_-	two-component system sensor histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	1.1e-09
APW91551.1|1365526_1366141_-	DNA-binding response regulator	NA	NA	NA	NA	NA
APW91550.1|1366556_1367720_+	multidrug resistance protein EmrK	NA	NA	NA	NA	NA
APW91549.1|1367719_1369258_+	multidrug resistance protein EmrY	NA	NA	NA	NA	NA
APW91548.1|1369365_1370694_-	D-serine dehydratase	NA	NA	NA	NA	NA
APW91547.1|1370711_1372049_-	D-serine transporter DsdX	NA	NA	NA	NA	NA
APW91546.1|1372266_1373202_+	DNA-binding transcriptional regulator DsdC	NA	NA	NA	NA	NA
APW91545.1|1373385_1373586_-	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
APW91544.1|1373643_1373811_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	96.4	1.4e-26
APW91543.1|1373899_1374181_-	hypothetical protein	NA	NA	NA	NA	NA
APW91542.1|1374295_1374817_-	DUF551 domain-containing protein	NA	K7P7E3	Enterobacteria_phage	72.2	1.6e-63
APW91541.1|1374819_1375011_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	4.7e-26
APW91540.1|1375012_1375420_-	hypothetical protein	NA	A0A125RPT9	Escherichia_phage	97.8	1.9e-69
APW91539.1|1375421_1375721_-	hypothetical protein	NA	Q716F3	Shigella_phage	100.0	1.5e-58
APW91538.1|1375717_1375885_-	DUF2737 domain-containing protein	NA	G9L664	Escherichia_phage	98.2	5.6e-23
APW91537.1|1375895_1376189_-	RecBCD nuclease inhibitor	NA	Q687G7	Enterobacteria_phage	97.9	9.4e-50
APW91536.1|1376202_1376709_-	single-stranded DNA-binding protein	NA	K7PHK1	Enterobacteria_phage	99.4	1.2e-79
APW91535.1|1376709_1377417_-	recombinase	NA	K7PKU3	Enterobacteria_phage	99.1	5.0e-137
APW91533.1|1377671_1377824_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
APW91532.1|1377808_1377940_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
APW91531.1|1377964_1378933_-	cell envelope biogenesis protein TolA	NA	K7P7J7	Enterobacteria_phage	99.7	7.7e-56
APW91530.1|1379121_1379310_-	hypothetical protein	NA	K7PMF8	Enterobacteria_phage	90.9	1.1e-16
APW91529.1|1379318_1379645_-	antitermination protein	NA	A4KWR0	Enterobacteria_phage	100.0	2.7e-53
APW95579.2|1380137_1380833_-	helix-turn-helix domain-containing protein	NA	A0A0N7BTS4	Escherichia_phage	96.5	1.3e-129
APW91528.1|1380909_1381125_+	XRE family transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	98.6	1.1e-34
APW91527.1|1381241_1381523_+	hypothetical protein	NA	K7PMG0	Enterobacteria_phage	100.0	1.9e-44
APW91526.1|1381705_1382527_+	replication of DNA	NA	K7PJZ3	Enterobacterial_phage	99.3	1.3e-152
APW91525.1|1382523_1383900_+	replicative DNA helicase	NA	A0A0P0ZC27	Stx2-converting_phage	99.8	1.3e-253
APW91524.2|1383955_1384414_+	recombination protein NinB	NA	A5VW91	Enterobacteria_phage	100.0	7.3e-81
APW91523.1|1384410_1384938_+	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
APW91522.1|1385113_1385284_+	protein ninF	NA	K7PLU6	Enterobacteria_phage	100.0	2.5e-26
APW91521.1|1385276_1385546_+	hypothetical protein	NA	K7PHK7	Enterobacteria_phage	100.0	7.1e-44
APW91520.1|1385545_1386157_+	recombination protein NinG	NA	K7P6N9	Enterobacteria_phage	98.5	1.1e-97
APW91519.1|1386153_1386360_+	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
APW91518.1|1386337_1387003_+	serine/threonine protein phosphatase	NA	K7P721	Enterobacteria_phage	98.6	1.5e-130
APW91517.1|1386999_1387623_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	99.5	8.9e-114
APW91516.1|1388295_1388619_+|holin	phage holin, lambda family	holin	K7PH31	Enterobacteria_phage	100.0	2.2e-52
APW91515.1|1388602_1389079_+	lysozyme	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
APW91514.1|1389075_1389543_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	96.1	1.8e-74
APW91513.2|1389530_1389683_+	hypothetical protein	NA	Q716B2	Shigella_phage	98.0	4.7e-21
APW91512.1|1389885_1390410_+	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	93.6	1.3e-86
APW91511.1|1390641_1390998_+	hypothetical protein	NA	Q716B1	Shigella_phage	74.6	3.0e-42
APW91510.1|1391101_1391344_+	DUF2560 domain-containing protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
APW91509.1|1391345_1391525_+	hypothetical protein	NA	A0A088CPS9	Enterobacteria_phage	100.0	3.7e-25
APW95578.1|1391548_1391971_+	ubiquitin carboxyl-hydrolase	NA	Q716H4	Shigella_phage	100.0	7.2e-75
APW91508.1|1391967_1393383_+|terminase	PBSX family phage terminase large subunit	terminase	A0A088CQ06	Enterobacteria_phage	99.6	1.3e-277
APW91507.1|1393384_1395583_+|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	97.3	0.0e+00
APW91506.1|1395673_1396567_+	scaffolding protein	NA	A0A088CPT0	Enterobacteria_phage	99.0	4.3e-130
APW91505.1|1396585_1397839_+|coat	coat protein	coat	A0A088CQ56	Enterobacteria_phage	98.3	1.3e-233
APW91504.1|1397880_1398069_+	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	100.0	2.9e-28
APW91503.1|1398049_1398511_+|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	99.3	1.6e-83
APW91502.1|1398520_1399939_+	hypothetical protein	NA	A0A2D1GM00	Escherichia_phage	99.2	3.5e-275
APW91501.1|1399938_1400640_+|tail	phage tail protein	tail	A5VW68	Enterobacteria_phage	97.4	2.3e-118
APW91500.1|1400639_1401095_+	hypothetical protein	NA	A0A2D1GLX4	Escherichia_phage	98.7	3.3e-86
APW91499.1|1401097_1401790_+	DNA transfer protein	NA	A5VW66	Enterobacteria_phage	97.0	1.1e-112
APW91498.1|1401799_1403185_+	acyltransferase	NA	I6RSG0	Salmonella_phage	94.8	1.2e-243
APW95577.1|1403592_1405434_+	hypothetical protein	NA	A0A2D1GLK8	Escherichia_phage	92.8	4.7e-296
AWA19753.1|1405451_1405583_-	hypothetical protein	NA	NA	NA	NA	NA
APW91497.1|1405622_1406108_-	hypothetical protein	NA	NA	NA	NA	NA
APW95575.1|1406379_1406565_+	hypothetical protein	NA	I6RSG3	Salmonella_phage	100.0	1.1e-08
APW91496.2|1406586_1406958_-	hypothetical protein	NA	I6S5X4	Salmonella_phage	90.9	1.0e-56
APW91495.1|1406991_1407327_-	hypothetical protein	NA	NA	NA	NA	NA
APW91494.1|1407323_1407578_-	Arc family DNA-binding protein	NA	A5VW60	Enterobacteria_phage	90.0	2.4e-33
APW91493.1|1407668_1407830_+	Arc family DNA-binding protein	NA	A8CG91	Salmonella_phage	98.1	2.7e-22
APW91492.1|1407898_1408777_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	78.5	3.1e-96
APW91491.1|1410582_1411731_-	DUF4102 domain-containing protein	NA	Q716F9	Shigella_phage	99.2	4.0e-221
>prophage 3
CP019213	Escherichia coli strain WCHEC050613 chromosome, complete genome	4670066	1655250	1664692	4670066		Enterobacteria_phage(85.71%)	10	NA	NA
APW91267.1|1655250_1656177_+	ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
APW91266.1|1656181_1656913_+	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
APW91265.1|1656893_1657001_-	hypothetical protein	NA	NA	NA	NA	NA
APW91264.1|1657060_1657792_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
APW91263.1|1658013_1659699_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
APW91262.1|1659695_1660415_+	DNA-binding response regulator	NA	NA	NA	NA	NA
APW91261.1|1660461_1660932_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
APW91260.1|1660972_1661434_-	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
APW91259.1|1661558_1663559_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
APW91258.1|1663555_1664692_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
>prophage 4
CP019213	Escherichia coli strain WCHEC050613 chromosome, complete genome	4670066	1759255	1767556	4670066		Enterobacteria_phage(28.57%)	8	NA	NA
APW91186.1|1759255_1760650_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.5	8.3e-19
APW91185.1|1760824_1761718_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
APW91184.1|1762091_1763177_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	9.7e-100
APW91183.1|1763176_1764076_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	3.7e-28
APW91182.1|1764133_1765012_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	64.5	5.1e-107
APW91181.1|1765016_1765562_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.7	4.9e-52
APW91180.1|1765551_1766736_+	O149 family O-antigen flippase	NA	NA	NA	NA	NA
APW91179.1|1766719_1767556_+	polysaccharide pyruvyl transferase family protein	NA	A0A1V0SAR6	Catovirus	32.5	2.5e-26
>prophage 5
CP019213	Escherichia coli strain WCHEC050613 chromosome, complete genome	4670066	1972682	2040280	4670066	tail,integrase,protease,tRNA,plate	Shigella_phage(39.29%)	68	1982988:1983008	2000485:2000505
APW95403.1|1972682_1974416_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
APW95402.1|1974631_1975198_+	VOC family protein	NA	NA	NA	NA	NA
APW95401.1|1975211_1975958_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
APW95400.1|1976345_1977446_+	cytochrome C	NA	NA	NA	NA	NA
APW95399.1|1977470_1979900_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	NA	NA	NA	NA
APW95398.1|1980064_1981036_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
APW95397.1|1981032_1981776_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
APW95396.1|1981816_1982212_-	hypothetical protein	NA	NA	NA	NA	NA
APW95395.1|1982264_1983044_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	4.7e-72
1982988:1983008	attL	CACGCAGTTAAAGTGGCGGGC	NA	NA	NA	NA
APW95726.2|1983040_1984102_-|integrase	site-specific integrase	integrase	A0A286S1S8	Klebsiella_phage	88.4	8.4e-181
APW95394.1|1984157_1984718_+	hypothetical protein	NA	Q8SBH4	Shigella_phage	99.5	1.8e-105
APW95393.1|1984726_1984894_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	96.3	8.6e-24
APW95392.1|1984880_1986374_+|tail	phage tail protein	tail	S5FKL0	Shigella_phage	98.2	7.7e-273
APW95391.1|1986373_1986730_+|tail	phage tail protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
APW95390.1|1986729_1986999_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
APW95389.1|1986965_1987154_+	hypothetical protein	NA	NA	NA	NA	NA
APW95388.1|1987140_1988976_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.7	1.5e-307
APW95387.1|1988994_1990365_+	DNA circularization protein	NA	S5FUX4	Shigella_phage	98.0	2.4e-252
APW95386.1|1990361_1991441_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	3.4e-206
APW95385.1|1991440_1991989_+|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	98.4	3.3e-96
APW95384.1|1991985_1992414_+|tail	phage tail protein	tail	U5P0R9	Shigella_phage	100.0	2.3e-81
APW95383.1|1992400_1993459_+|plate	phage baseplate protein	plate	M1FQW3	Enterobacteria_phage	98.9	2.8e-200
APW95382.1|1993449_1994034_+	DUF2313 domain-containing protein	NA	O22003	Shigella_phage	99.5	1.8e-113
APW95381.1|1994037_1994739_+|integrase	integrase	integrase	U5P0I1	Shigella_phage	93.5	2.7e-50
APW95380.1|1994738_1995341_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	87.4	1.5e-94
APW95379.1|1995985_1997929_-	glycosyl transferase	NA	NA	NA	NA	NA
APW95378.1|1997930_1998776_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
APW95377.1|2000105_2000312_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	49.2	3.3e-09
APW95376.1|2000576_2001143_-	hydrolase	NA	NA	NA	NA	NA
2000485:2000505	attR	CACGCAGTTAAAGTGGCGGGC	NA	NA	NA	NA
APW95375.1|2001452_2003225_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
APW95374.2|2003342_2003795_+	NUDIX pyrophosphatase	NA	NA	NA	NA	NA
APW95373.1|2003823_2004564_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
APW95372.1|2004598_2005120_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
APW95371.1|2005121_2005724_-	hypothetical protein	NA	NA	NA	NA	NA
APW95725.1|2005794_2005860_+	hypothetical protein	NA	NA	NA	NA	NA
APW95370.1|2005998_2006610_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
APW95369.1|2006618_2007629_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
APW95368.1|2007775_2008561_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
APW95367.1|2008557_2009313_-	Mn2+/Zn2+ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
APW95724.1|2009391_2010324_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
APW95366.1|2010339_2011662_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
APW95365.1|2011781_2012753_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
APW95364.1|2012883_2014326_-	pyruvate kinase	NA	NA	NA	NA	NA
APW95363.1|2014453_2015323_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
APW95360.1|2015660_2017136_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	3.7e-78
APW95359.1|2017370_2019182_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
APW95358.1|2019218_2019860_+	KHG/KDPG aldolase	NA	NA	NA	NA	NA
APW95357.1|2019915_2021094_-	phosphoribosylglycinamide formyltransferase 2	NA	NA	NA	NA	NA
APW95356.1|2021227_2021518_+	damage-inducible protein YebG	NA	NA	NA	NA	NA
APW95355.1|2021584_2021941_+	protein YebF	NA	NA	NA	NA	NA
APW95352.1|2022267_2022927_+	DUF533 domain-containing protein	NA	NA	NA	NA	NA
APW95350.1|2023135_2025196_+	oligopeptidase B	NA	NA	NA	NA	NA
APW95349.1|2025192_2025855_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
APW95348.1|2025878_2026535_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
APW95347.1|2026636_2026867_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
APW95346.1|2027005_2027380_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
APW95345.1|2027383_2028256_+	hypothetical protein	NA	NA	NA	NA	NA
APW95344.1|2028268_2028610_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
APW95342.1|2029005_2029662_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	8.0e-57
APW95341.2|2029662_2029854_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
APW95340.1|2029958_2030195_-	DUF1480 domain-containing protein	NA	NA	NA	NA	NA
APW95339.2|2030312_2031752_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
APW95338.1|2031831_2034465_-	MCE family protein	NA	NA	NA	NA	NA
APW95337.1|2034433_2035717_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
APW95336.1|2035846_2036344_+	GAF domain-containing protein	NA	NA	NA	NA	NA
APW95335.1|2036440_2037139_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
APW95334.1|2037158_2039207_+|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.5	8.8e-86
APW95333.1|2039398_2040280_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 6
CP019213	Escherichia coli strain WCHEC050613 chromosome, complete genome	4670066	2282087	2355036	4670066	terminase,tail,holin,protease,transposase,portal	Enterobacteria_phage(47.73%)	76	NA	NA
APW95089.1|2282087_2282909_-|protease	serine protease	protease	NA	NA	NA	NA
APW95088.1|2283008_2283092_-	hypothetical protein	NA	NA	NA	NA	NA
APW95087.1|2283184_2283520_-	acid shock protein	NA	NA	NA	NA	NA
APW95086.1|2283916_2285170_-	MFS transporter	NA	NA	NA	NA	NA
APW95085.1|2285276_2286170_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
APW95084.1|2286304_2287525_+	protein mlc	NA	NA	NA	NA	NA
APW95083.1|2287649_2288345_+	dethiobiotin synthase	NA	NA	NA	NA	NA
APW95082.1|2288297_2289590_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
APW95081.1|2289748_2290363_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
APW95080.1|2290405_2291260_-	dimethylsulfoxide reductase	NA	NA	NA	NA	NA
APW95079.1|2291261_2291879_-	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
APW95714.1|2291889_2294313_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	3.7e-208
APW95078.1|2294373_2296800_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	5.9e-214
APW95077.1|2296998_2297304_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
APW95713.1|2297411_2298122_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
APW95076.1|2298124_2298685_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
APW95075.1|2298719_2299061_-	DUF1283 domain-containing protein	NA	NA	NA	NA	NA
APW95074.1|2299195_2299522_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
APW95073.1|2299558_2299747_+	hypothetical protein	NA	NA	NA	NA	NA
APW95072.1|2299727_2300942_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
APW95071.1|2300953_2301814_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	28.6	2.0e-15
APW95068.2|2302554_2302749_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
APW95067.1|2302806_2302917_+	transporter	NA	NA	NA	NA	NA
APW95712.1|2303761_2304142_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	4.2e-66
APW95065.1|2304138_2304486_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
APW95064.1|2304535_2306074_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	94.3	3.8e-283
APW95063.1|2306701_2306953_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AWA19767.1|2307025_2308963_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	1.5e-58
APW95059.1|2309759_2310719_+	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
APW95058.1|2310723_2310912_+	hypothetical protein	NA	NA	NA	NA	NA
APW95057.2|2311116_2311839_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
APW95056.1|2312029_2312245_+|holin	holin	holin	A5LH82	Enterobacteria_phage	94.4	2.9e-32
APW95055.1|2312249_2312468_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	63.8	1.6e-17
APW95054.1|2312492_2312789_-	hypothetical protein	NA	NA	NA	NA	NA
APW95053.1|2312916_2313450_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	94.9	2.6e-98
APW95052.1|2313446_2313944_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
APW95051.1|2314307_2314520_+	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
APW95050.2|2314530_2314719_+	cold-shock protein	NA	NA	NA	NA	NA
APW95710.1|2314866_2315022_+	hypothetical protein	NA	NA	NA	NA	NA
APW95709.2|2315079_2315205_-	nitrite extrusion protein 2	NA	NA	NA	NA	NA
APW95048.2|2315170_2316443_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
APW95708.1|2316530_2316704_+	protein GnsB	NA	NA	NA	NA	NA
APW95047.2|2317106_2318269_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
APW95045.2|2318876_2319416_+	DUF1441 domain-containing protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
APW95044.2|2319424_2321524_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	97.1	0.0e+00
APW95043.2|2321520_2321733_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
APW95042.1|2321732_2323241_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	100.0	1.6e-289
APW95041.1|2323089_2325213_+	peptidase S14	NA	K7PGT6	Enterobacteria_phage	100.0	0.0e+00
APW95040.1|2325254_2325623_+	DUF2190 domain-containing protein	NA	A0A291AWX2	Escherichia_phage	99.1	3.7e-51
APW95039.1|2325615_2325891_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
APW95038.1|2325902_2326481_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	6.1e-101
APW95037.1|2326477_2326879_+|tail	phage tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
APW95036.1|2326889_2327633_+|tail	phage tail protein	tail	K7PGT7	Enterobacteria_phage	99.2	2.0e-133
APW95707.1|2327693_2328080_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.1	1.1e-61
APW95035.1|2328088_2328418_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
APW95034.1|2328389_2331455_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.3	0.0e+00
APW95033.1|2331454_2331784_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
APW95032.1|2331793_2332492_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.3e-133
APW95031.1|2332497_2333241_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.3	7.3e-147
APW95030.1|2333138_2333786_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	1.2e-110
APW95029.1|2333845_2337259_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	98.4	0.0e+00
APW95028.1|2337329_2337929_+	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.1e-108
APW95027.1|2337993_2341299_+|tail	phage tail protein	tail	K7PGT9	Enterobacteria_phage	69.0	5.0e-280
APW95026.1|2341353_2341473_+	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	84.6	3.1e-12
APW95025.1|2341570_2342161_-	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
APW95024.1|2342477_2342711_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
APW95023.1|2343496_2344780_+	MFS transporter	NA	NA	NA	NA	NA
APW95022.1|2344868_2346329_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	2.1e-41
APW95021.1|2346363_2346567_-	protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
APW95020.1|2346743_2347430_-	transcriptional regulator	NA	NA	NA	NA	NA
APW95019.1|2347518_2348265_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
APW95018.1|2348401_2350447_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
APW95017.1|2350490_2351009_-	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
APW95016.1|2351286_2351679_+	TIGR00156 family protein	NA	NA	NA	NA	NA
APW95012.1|2353818_2353914_-	hypothetical protein	NA	NA	NA	NA	NA
APW95011.1|2354112_2355036_+|transposase	IS5/IS1182 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.4	2.4e-171
>prophage 7
CP019213	Escherichia coli strain WCHEC050613 chromosome, complete genome	4670066	2486878	2528950	4670066	transposase	Escherichia_phage(25.0%)	37	NA	NA
APW94895.2|2486878_2488087_-|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	92.8	4.6e-207
AWA19771.1|2488156_2488279_+	hypothetical protein	NA	A0A1S5RHE3	Helicobacter_phage	55.0	3.8e-05
AWA19772.1|2488279_2488558_+|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	64.6	1.9e-23
APW94894.1|2488618_2489287_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
APW94893.1|2489589_2490183_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
APW94892.1|2490179_2491172_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
APW94891.1|2491295_2492276_+	hypothetical protein	NA	NA	NA	NA	NA
APW94890.1|2492267_2492807_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
APW94889.1|2492869_2493094_-	DUF465 domain-containing protein	NA	NA	NA	NA	NA
APW94888.1|2493109_2493313_+	hypothetical protein	NA	NA	NA	NA	NA
APW94887.1|2493233_2494889_-	glucan biosynthesis protein D	NA	NA	NA	NA	NA
APW94886.1|2495113_2496457_-	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
APW94885.1|2496673_2497597_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
APW94884.1|2497634_2499275_-	methyl-accepting chemotaxis protein III	NA	NA	NA	NA	NA
APW94883.1|2499673_2499823_+	type I toxin-antitoxin system hok family toxin	NA	NA	NA	NA	NA
APW94882.1|2499894_2500068_-	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
APW94881.1|2500312_2500843_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
APW94880.1|2501031_2502033_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
APW94879.1|2502074_2503514_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
APW94878.1|2503710_2504511_-	DUF218 domain-containing protein	NA	NA	NA	NA	NA
APW94877.1|2504782_2508685_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
APW94876.1|2508885_2509491_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
APW95699.1|2509541_2510834_-	hypothetical protein	NA	NA	NA	NA	NA
APW94874.1|2513448_2514153_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
APW94872.1|2514394_2515255_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
APW95698.1|2515663_2517394_+	cell division protein FtsI	NA	NA	NA	NA	NA
APW94871.1|2517458_2518316_+	class A beta-lactamase LAP-2	NA	Q1MVP3	Enterobacteria_phage	61.1	2.0e-92
APW94870.1|2519912_2520569_+	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
APW94868.1|2521348_2522740_-|transposase	ISKra4 family transposase ISKpn19	transposase	NA	NA	NA	NA
APW94867.1|2522776_2523349_-	recombinase family protein	NA	A0JC18	Ralstonia_phage	38.5	9.9e-19
APW94866.1|2523485_2524076_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
AWA19773.1|2524231_2524771_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
APW94865.1|2524742_2525579_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
APW94864.1|2525578_2526382_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
APW94863.1|2526442_2527258_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
APW94862.1|2527587_2527764_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
APW94861.1|2527945_2528950_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
>prophage 8
CP019213	Escherichia coli strain WCHEC050613 chromosome, complete genome	4670066	2768733	2774845	4670066		Enterobacteria_phage(50.0%)	8	NA	NA
APW94633.1|2768733_2769057_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
APW94632.2|2769159_2769312_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.0	1.4e-20
APW94630.1|2771172_2771391_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	81.4	3.6e-14
APW94629.1|2771383_2772175_-	transcriptional regulator	NA	R4TG31	Halovirus	40.2	2.8e-48
APW94628.1|2772092_2772374_-	hypothetical protein	NA	NA	NA	NA	NA
APW94627.1|2772312_2773770_-	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
APW94626.1|2773966_2774152_-	Spanin from lambdoid prophage Rac, outer membrane subunit	NA	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
APW94625.1|2774368_2774845_-	lysozyme	NA	K7PKV2	Enterobacteria_phage	96.8	1.7e-85
>prophage 9
CP019213	Escherichia coli strain WCHEC050613 chromosome, complete genome	4670066	3064206	3127209	4670066	tRNA,tail,protease,integrase	Salmonella_phage(28.57%)	60	3057169:3057184	3130154:3130169
3057169:3057184	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
APW94349.1|3064206_3065499_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
APW94348.1|3065589_3066933_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
APW94347.1|3066943_3067555_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
APW94346.1|3067709_3071738_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
APW94345.1|3071872_3072367_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
APW94344.1|3072911_3073877_+	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
APW94343.1|3073999_3075766_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	F2Y302	Organic_Lake_phycodnavirus	28.3	9.2e-15
APW94342.1|3075766_3077488_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	4.9e-21
APW94341.1|3077529_3078234_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
APW94340.1|3078518_3078737_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
APW94339.1|3079410_3079686_+	hypothetical protein	NA	NA	NA	NA	NA
APW94338.1|3079600_3081877_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.1e-166
APW94337.1|3081907_3082228_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
APW94336.1|3082550_3082775_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
APW94335.1|3082847_3084794_-	macrolide ABC transporter permease/ATP-binding protein MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
APW94334.1|3084790_3085906_-	MacA family efflux pump subunit	NA	NA	NA	NA	NA
APW94333.1|3086020_3087013_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
APW94332.1|3087009_3088668_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
APW94330.1|3089093_3089789_+	aquaporin	NA	NA	NA	NA	NA
APW94329.1|3090283_3091183_+	transporter	NA	NA	NA	NA	NA
APW94328.1|3091326_3092979_+	hydroxylamine reductase	NA	NA	NA	NA	NA
APW94327.1|3092990_3093959_+	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
APW94326.1|3094091_3095810_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
APW94325.1|3095846_3096848_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
APW94324.1|3096858_3098289_+	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
APW94323.2|3098387_3099401_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
APW94322.1|3099397_3100228_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
APW94321.1|3100224_3100548_-	hypothetical protein	NA	NA	NA	NA	NA
APW94320.1|3100673_3101189_+	lipoprotein	NA	NA	NA	NA	NA
APW94319.1|3101406_3102135_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
APW94318.1|3102152_3102884_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
APW94317.1|3102890_3103607_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
APW94316.1|3103606_3104275_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
APW94315.1|3104565_3105297_+	ABC transporter arginine-binding protein 1	NA	NA	NA	NA	NA
APW94314.1|3105495_3106623_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	6.0e-28
APW94313.1|3106663_3107152_-	DUF2593 domain-containing protein	NA	NA	NA	NA	NA
APW94312.1|3107211_3108057_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
APW94311.1|3108053_3109007_-	putrescine ABC transporter permease	NA	NA	NA	NA	NA
APW94310.1|3109016_3110150_-	putrescine transport ATP-binding protein PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
APW94309.1|3110244_3111357_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
APW94308.1|3111340_3111502_-	putrescine/spermidine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
APW94307.1|3111707_3112184_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
APW94306.1|3112271_3113174_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
APW94305.1|3113234_3113957_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
APW94304.1|3113940_3114228_-	hypothetical protein	NA	NA	NA	NA	NA
APW94303.1|3114387_3114645_+	glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
APW94302.1|3114674_3115052_-	hypothetical protein	NA	NA	NA	NA	NA
APW94301.1|3115321_3117007_+	transporter	NA	NA	NA	NA	NA
APW94300.1|3117242_3117461_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
APW94299.1|3117551_3118652_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	86.3	3.8e-176
APW94298.1|3118648_3119134_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	1.7e-67
APW94297.1|3119130_3122208_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.3	0.0e+00
APW94296.1|3122200_3122320_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
APW94295.1|3122334_3122637_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	1.2e-39
APW94291.1|3123985_3124282_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	4.9e-22
APW94290.1|3124289_3124799_-	hypothetical protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
APW94289.1|3124863_3125067_-	regulator	NA	NA	NA	NA	NA
APW95669.1|3125212_3125782_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	41.9	3.2e-38
APW94288.1|3125797_3125989_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
APW94287.1|3126177_3127209_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	55.8	9.5e-105
3130154:3130169	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 10
CP019213	Escherichia coli strain WCHEC050613 chromosome, complete genome	4670066	3666064	3717577	4670066	transposase,integrase,holin	Shigella_phage(45.0%)	53	3703337:3703392	3713666:3713721
APW93778.1|3666064_3668098_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
APW95650.1|3668094_3668310_-	hypothetical protein	NA	NA	NA	NA	NA
APW93777.1|3668226_3668814_+	transcriptional regulator	NA	NA	NA	NA	NA
APW93776.1|3668827_3670300_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
APW93775.1|3670313_3671984_+|holin	oxygen-dependent choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
APW93774.1|3672196_3672865_+	hypothetical protein	NA	NA	NA	NA	NA
APW93773.1|3672836_3673034_+	universal stress protein	NA	NA	NA	NA	NA
APW93772.1|3672940_3673153_+	hypothetical protein	NA	NA	NA	NA	NA
APW93771.1|3673107_3673803_-	lactate utilization protein C	NA	NA	NA	NA	NA
APW93770.1|3673795_3675223_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
APW93769.1|3675233_3675953_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
APW93768.1|3676479_3677334_-	transcriptional regulator	NA	NA	NA	NA	NA
APW93767.1|3677559_3678885_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
APW93766.1|3678993_3679230_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
APW93765.1|3679241_3679835_+	protein RclC	NA	NA	NA	NA	NA
APW93764.2|3680391_3681276_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
APW93761.1|3687360_3687462_+	hypothetical protein	NA	NA	NA	NA	NA
APW93760.1|3687825_3688089_+	50S ribosomal protein L31 type B	NA	NA	NA	NA	NA
APW93759.1|3688088_3688229_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
APW93758.1|3688263_3688491_-	hypothetical protein	NA	NA	NA	NA	NA
APW93757.1|3688552_3688732_-	hypothetical protein	NA	NA	NA	NA	NA
APW93756.1|3689266_3689857_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
APW93755.1|3689931_3690519_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
APW93754.1|3690576_3691245_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
APW93753.1|3691270_3693796_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
APW93752.1|3693785_3695429_+	fimbria adhesin EcpD	NA	NA	NA	NA	NA
APW93751.1|3695397_3696108_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
APW93750.1|3696420_3696750_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
APW95649.1|3696744_3696924_-	hypothetical protein	NA	NA	NA	NA	NA
APW93749.1|3697722_3697848_+	transporter	NA	NA	NA	NA	NA
APW93748.1|3698027_3698717_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
APW93747.1|3698713_3699670_+	xanthine dehydrogenase	NA	NA	NA	NA	NA
APW93746.1|3699666_3701865_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.5	9.6e-38
APW93745.1|3701874_3702831_+	XdhC family protein	NA	NA	NA	NA	NA
APW93744.1|3702809_3703220_+	hypothetical protein	NA	NA	NA	NA	NA
3703337:3703392	attL	TTGATTTTAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
AWA19797.1|3703457_3703610_-	hypothetical protein	NA	NA	NA	NA	NA
APW93743.1|3704135_3705059_-|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	4.9e-177
APW93742.2|3705173_3706193_-	acyltransferase	NA	NA	NA	NA	NA
APW95648.1|3706534_3707458_-|transposase	IS5/IS1182 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.4	2.4e-171
AWA19798.1|3707520_3707967_-	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.6e-79
APW93741.1|3707885_3708230_-	hypothetical protein	NA	U5P0J5	Shigella_phage	96.5	5.3e-60
APW93740.2|3708138_3708363_-	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	63.1	3.2e-13
APW93739.1|3708435_3708798_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
APW93738.1|3708863_3709688_+	DUF2303 domain-containing protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
APW93737.1|3709815_3710352_+	HD family hydrolase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
APW93736.1|3710342_3710705_+	hypothetical protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
APW93735.1|3710704_3710989_+	hypothetical protein	NA	U5P0J0	Shigella_phage	95.7	3.4e-44
APW93734.2|3711002_3712165_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
APW93732.1|3712270_3712621_+	DNA-binding protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
APW93731.2|3712722_3713661_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.4	1.8e-182
APW93730.1|3713865_3715119_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	7.5e-96
3713666:3713721	attR	TTGATTTTAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
APW93729.1|3715130_3716234_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
APW93728.1|3716521_3717577_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
>prophage 1
CP019214	Escherichia coli strain WCHEC050613 plasmid pMCR_WCHEC050613, complete sequence	289112	59734	203661	289112	integrase,transposase	Escherichia_phage(31.37%)	148	172984:173003	191680:191699
APW96028.1|59734_60709_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
APW95848.1|60904_62530_+	phosphoethanolamine--lipid A transferase MCR-1	NA	NA	NA	NA	NA
APW95847.2|62577_63324_+	PAP2 family protein	NA	NA	NA	NA	NA
APW95846.1|63349_63694_+	hypothetical protein	NA	NA	NA	NA	NA
APW95845.1|63715_64891_-	recombinase	NA	NA	NA	NA	NA
APW95844.1|65061_65274_+	hypothetical protein	NA	NA	NA	NA	NA
APW95843.1|65634_66717_+	hypothetical protein	NA	NA	NA	NA	NA
APW95842.1|66883_68383_-	kinase	NA	NA	NA	NA	NA
APW95841.1|68408_70046_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
APW95840.1|70045_71086_-	VWA domain-containing protein	NA	NA	NA	NA	NA
APW95839.1|71171_71810_-	tellurium resistance protein TerY	NA	NA	NA	NA	NA
APW95838.1|71809_72451_-	tellurium resistance protein TerX	NA	NA	NA	NA	NA
APW95837.1|72473_73112_-	tellurium resistance protein TerY	NA	NA	NA	NA	NA
APW95835.1|73574_74042_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
APW95834.1|74059_75268_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
APW95833.1|75278_76235_-	citrate lyase subunit beta	NA	NA	NA	NA	NA
APW95832.1|76234_77314_-	hypothetical protein	NA	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
APW95831.1|77315_78089_-	hypothetical protein	NA	NA	NA	NA	NA
APW95830.1|78081_79224_-	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.7e-30
APW95829.1|79233_80292_-	carbamoyl-phosphate synthase large chain	NA	NA	NA	NA	NA
APW95828.1|80615_81197_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
APW95827.1|81196_82354_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
APW95826.1|82376_82832_+	Tellurite resistance protein TerB	NA	NA	NA	NA	NA
APW95825.1|82854_83895_+	TerC family protein	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
APW95824.1|83943_84522_+	chemical-damaging agent resistance protein C	NA	A0A2P1N0L4	Streptomyces_phage	40.0	3.3e-06
APW95823.1|84589_85165_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
APW95822.1|85593_86835_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
APW95821.1|87397_87679_-	hypothetical protein	NA	NA	NA	NA	NA
APW95820.1|87728_87920_-	hypothetical protein	NA	NA	NA	NA	NA
APW95819.2|88011_88383_-	hypothetical protein	NA	NA	NA	NA	NA
APW95818.1|88725_89118_+	hypothetical protein	NA	NA	NA	NA	NA
APW95817.1|89096_89408_+	hypothetical protein	NA	NA	NA	NA	NA
APW96027.1|89721_90015_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
APW95816.1|90019_91345_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
APW95815.1|91405_91612_+	hypothetical protein	NA	NA	NA	NA	NA
APW95814.1|91713_92124_+	hypothetical protein	NA	NA	NA	NA	NA
APW95813.1|92136_92952_+	HNH endonuclease	NA	G0X580	Salmonella_phage	35.4	1.9e-15
APW95812.1|93205_93631_+	hypothetical protein	NA	NA	NA	NA	NA
APW95811.1|94179_94488_+	hypothetical protein	NA	NA	NA	NA	NA
APW95810.1|94503_95361_+	HNH endonuclease	NA	G0X580	Salmonella_phage	34.2	3.9e-11
APW95809.1|95422_95671_+	hypothetical protein	NA	NA	NA	NA	NA
AWA19832.1|96209_96635_-	DUF4158 domain-containing protein	NA	A0A1B0V7H9	Salmonella_phage	47.2	7.6e-08
APW95807.1|97334_98468_-	permease	NA	NA	NA	NA	NA
APW95806.1|98573_98897_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
APW95804.2|99439_100144_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
APW95802.2|100243_100960_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	2.4e-139
APW95801.1|101127_101892_+|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AWA19833.1|102082_102439_-	hypothetical protein	NA	NA	NA	NA	NA
APW95799.1|102384_102969_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
APW95798.1|102968_104207_-	MFS transporter	NA	NA	NA	NA	NA
APW95797.1|104203_105109_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
APW95796.2|105230_105935_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
APW95795.1|105925_106114_+	hypothetical protein	NA	NA	NA	NA	NA
APW95794.1|106201_107638_+	glutathione synthase	NA	NA	NA	NA	NA
APW95793.1|108055_109060_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
APW96026.1|109484_110189_-	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	28.7	6.4e-20
APW95791.2|110218_110923_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
APW95790.1|111841_112684_+|transposase	transposase	transposase	NA	NA	NA	NA
APW95789.1|112670_114794_+|transposase	transposase	transposase	NA	NA	NA	NA
APW95788.1|114793_116242_+	ATP-binding protein	NA	NA	NA	NA	NA
APW95787.2|116282_117839_+|transposase	transposase	transposase	NA	NA	NA	NA
APW95786.1|117850_118777_+	hypothetical protein	NA	NA	NA	NA	NA
APW95785.1|119129_119429_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
APW95784.1|119992_121819_+	OLD family endonuclease	NA	E5E3R2	Burkholderia_phage	22.8	4.7e-14
APW95783.1|121987_122338_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	50.5	1.8e-18
APW95782.2|122485_122917_-	silver-binding protein SilE	NA	NA	NA	NA	NA
APW95781.1|123161_124643_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	1.8e-27
APW95780.1|124635_125316_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
APW95779.1|125505_126891_+	hypothetical protein	NA	NA	NA	NA	NA
APW95778.1|126918_127272_+	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
APW95777.1|127385_128678_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
APW95776.1|128688_131835_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.4	2.1e-62
APW95775.1|131921_132362_+	hypothetical protein	NA	NA	NA	NA	NA
APW95774.1|132489_134937_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.4	2.9e-83
APW95773.1|134977_135175_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
APW95772.1|135208_135946_-	peptidase	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	31.9	1.3e-10
APW95770.1|136234_136684_-	copper resistance protein	NA	NA	NA	NA	NA
APW95769.1|136918_138736_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
APW95768.2|138735_139632_+	copper resistance protein B	NA	NA	NA	NA	NA
APW95767.1|139671_140052_+	copper resistance system chaperone PcoC	NA	NA	NA	NA	NA
APW95766.1|140056_140986_+	copper resistance protein D	NA	NA	NA	NA	NA
APW95765.1|141040_141721_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
APW95764.1|141717_143118_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	3.2e-18
APW95763.1|143335_143770_+	copper-binding protein	NA	NA	NA	NA	NA
APW95762.1|144147_144966_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
APW95761.1|144962_146168_+	ATP/GTP-binding protein	NA	NA	NA	NA	NA
APW95760.1|146231_146435_-	hypothetical protein	NA	NA	NA	NA	NA
APW95759.1|146447_147767_-	DUF1173 domain-containing protein	NA	NA	NA	NA	NA
APW95758.1|148017_149445_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
APW95757.1|149659_150175_+	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
APW95756.1|150177_151074_+	hypothetical protein	NA	NA	NA	NA	NA
APW96025.1|151295_151529_+	hypothetical protein	NA	NA	NA	NA	NA
APW95755.1|151574_151829_+	hypothetical protein	NA	NA	NA	NA	NA
APW95754.1|151866_152154_+	hypothetical protein	NA	NA	NA	NA	NA
APW95753.1|152190_152421_+	hypothetical protein	NA	NA	NA	NA	NA
APW95752.1|152757_153219_+	hypothetical protein	NA	NA	NA	NA	NA
APW95751.1|153248_153656_+	hypothetical protein	NA	NA	NA	NA	NA
APW96024.1|153706_154024_-	hypothetical protein	NA	NA	NA	NA	NA
APW96023.1|154400_154751_-	hypothetical protein	NA	NA	NA	NA	NA
APW95750.1|156440_157145_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
APW95748.1|157447_158323_+	class A extended-spectrum beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
APW95747.1|158934_159351_+	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
APW95746.2|159355_159874_-	hypothetical protein	NA	NA	NA	NA	NA
APW95745.1|159873_160620_-	winged helix family transcriptional regulator	NA	NA	NA	NA	NA
APW95744.1|160625_161330_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
APW95743.1|161443_162220_+	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
APW95742.1|162240_162462_+	hypothetical protein	NA	NA	NA	NA	NA
APW95740.1|163770_164523_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
APW95739.1|166333_166819_+	phenol hydroxylase	NA	NA	NA	NA	NA
AWA19834.1|167015_168106_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
APW95737.1|168195_169011_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
APW95736.1|169097_169400_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
APW95735.1|169293_169545_-	hypothetical protein	NA	NA	NA	NA	NA
APW95734.1|170469_171174_+|transposase	IS6 family transposase IS1006	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
APW95733.1|171258_171648_-	hypothetical protein	NA	NA	NA	NA	NA
AWA19835.1|171912_172917_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
172984:173003	attL	AAATAAAGCACGCTAAGCCG	NA	NA	NA	NA
AWA19836.1|172995_175947_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
APW96021.1|175949_176510_-	DNA resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AWA19837.1|176635_177250_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
APW96018.1|177188_178202_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
APW96017.1|178346_178844_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
APW96039.2|178955_179246_+	hypothetical protein	NA	NA	NA	NA	NA
APW96016.1|179251_180043_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
APW96015.1|180304_181564_+	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
APW96014.1|181656_182448_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
APW96013.1|182617_182950_+	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
APW96012.1|183089_183275_+	hypothetical protein	NA	NA	NA	NA	NA
APW96010.1|184129_184921_-	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
APW96037.1|185400_186375_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
APW96009.1|186461_186707_-	hypothetical protein	NA	NA	NA	NA	NA
APW96008.1|186744_187608_-	KR domain-containing protein	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
APW96007.1|187838_188543_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
APW96035.1|189042_189966_+|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	4.9e-177
APW96005.2|190005_190575_+	aminoglycoside 3'-phosphotransferase	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	5.6e-107
APW96004.1|190764_191469_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
APW96002.1|191693_191897_-	hypothetical protein	NA	NA	NA	NA	NA
191680:191699	attR	CGGCTTAGCGTGCTTTATTT	NA	NA	NA	NA
APW96001.1|191915_192095_+	hypothetical protein	NA	NA	NA	NA	NA
APW96000.1|192024_192864_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
APW95999.1|193044_193209_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AWA19838.1|194599_195304_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AWA19839.1|195249_195429_-	hypothetical protein	NA	Q1MVP5	Enterobacteria_phage	85.7	7.3e-05
APW95998.1|195497_195884_+	bleomycin binding protein	NA	NA	NA	NA	NA
APW95997.1|196203_196596_-	NimC/NimA family protein	NA	NA	NA	NA	NA
APW95995.2|196930_197635_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
APW95994.1|197954_199130_+	multidrug efflux RND transporter periplasmic adaptor subunit OqxA2	NA	NA	NA	NA	NA
APW95993.1|199153_202306_+	multidrug efflux RND transporter permease subunit OqxB2	NA	NA	NA	NA	NA
APW95992.1|202375_202855_-	transcriptional regulator	NA	NA	NA	NA	NA
APW95991.1|202956_203661_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 1
CP019216	Escherichia coli strain WCHEC050613 plasmid pP_WCHEC050613, complete sequence	78444	0	75861	78444	transposase,plate	Escherichia_phage(60.87%)	58	NA	NA
APW96176.1|2337_2469_-	replication protein RepA4	NA	NA	NA	NA	NA
APW96178.1|2721_2973_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
APW96179.1|2969_3257_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	4.5e-20
APW96180.1|3546_3747_-	DUF839 domain-containing protein	NA	NA	NA	NA	NA
APW96181.1|4116_7650_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	36.8	3.2e-99
APW96185.2|10593_11756_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
APW96187.1|11875_12316_+	peptide-binding protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
APW96188.1|12312_12561_+	modulator protein	NA	Q71TG0	Escherichia_phage	98.8	4.0e-41
APW96189.1|12597_13725_-	GTP pyrophosphokinase	NA	A0A1B0VBT5	Salmonella_phage	74.4	2.0e-156
APW96190.1|13827_14469_-	maturation control protein	NA	A0A077SK30	Escherichia_phage	95.8	2.3e-109
APW96191.1|14624_15374_-	DUF4145 domain-containing protein	NA	A0A1S6L018	Salmonella_phage	49.0	1.3e-66
APW96192.1|15460_16021_-	recombinase	NA	Q5QBN4	Enterobacteria_phage	95.7	2.8e-95
APW96193.1|16266_16578_-	lysogeny establishment protein	NA	A0A077SK03	Escherichia_phage	97.1	8.8e-46
APW96194.1|16814_18392_-	PAS domain S-box protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.2e-95
APW96195.1|18701_19262_+|transposase	transposase	transposase	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
AWA19848.1|19265_22232_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
APW96196.1|22273_23305_-	recombinase	NA	A0A077SLE7	Escherichia_phage	99.1	1.9e-193
APW96197.1|23312_23534_-	creatininase	NA	Q5QBN7	Enterobacteria_phage	97.3	4.2e-34
APW96198.1|23945_24059_+	peptidase	NA	Q5XLQ7	Enterobacteria_phage	100.0	3.2e-14
APW96199.1|24077_24173_+	peptidase	NA	Q38402	Escherichia_phage	100.0	2.8e-11
APW96200.1|24138_24348_+	c1 repressor inactivator	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
APW96201.1|24458_25310_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.3	1.0e-157
APW96202.1|25342_25654_-	phage antirepressor Ant	NA	A0A077SLR9	Escherichia_phage	98.0	2.9e-49
APW96203.1|25956_27000_-	DUF968 domain-containing protein	NA	A0A077SLM1	Escherichia_phage	98.6	1.5e-203
APW96204.1|27027_27207_-	PdcA protein	NA	Q71TH5	Escherichia_phage	98.3	1.2e-23
APW96205.1|27211_27592_-	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	99.2	9.7e-63
APW96206.1|27591_27813_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	A0A222YXU1	Escherichia_phage	98.6	3.3e-31
APW96209.1|29190_30453_-	hypothetical protein	NA	Q1MVG4	Enterobacteria_phage	99.0	3.9e-233
APW96210.1|30454_30673_-	hypothetical protein	NA	Q71TI9	Escherichia_phage	98.6	2.9e-35
APW96211.1|30754_31456_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	97.4	4.3e-141
APW96213.1|32419_33154_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
APW96215.1|34161_37635_-	cellulose biosynthesis protein BcsC	NA	NA	NA	NA	NA
APW96216.1|40763_42914_-	cellulose synthase regulator BcsB	NA	NA	NA	NA	NA
APW96217.1|42977_45083_-	UDP-forming cellulose synthase catalytic subunit	NA	NA	NA	NA	NA
APW96220.1|45907_47083_-	lipoprotein YliF	NA	NA	NA	NA	NA
AWA19852.1|50464_50818_+	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	94.9	2.0e-38
APW96226.1|50857_51280_+	ppfA	NA	Q71TL5	Escherichia_phage	97.1	9.4e-59
APW96227.1|51455_51848_+	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	97.7	7.6e-71
APW96228.1|52183_53068_+	RepB family plasmid replication initiator protein	NA	A0A077SLP3	Escherichia_phage	100.0	2.1e-161
APW96229.1|53360_54170_+	helicase	NA	A0A077SK46	Escherichia_phage	97.8	1.6e-155
APW96230.1|54338_55535_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
APW96231.1|55551_56553_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
AWA19849.1|56778_58485_+	hypothetical protein	NA	Q71TM1	Escherichia_phage	99.8	0.0e+00
APW96154.2|58900_60173_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
APW96155.1|60198_61470_+	hypothetical protein	NA	A0A1B0V7E4	Salmonella_phage	97.9	3.0e-241
APW96156.1|61479_62295_+	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	94.8	3.0e-109
APW96157.1|62330_62912_+	hypothetical protein	NA	Q71TM4	Escherichia_phage	96.9	1.8e-100
APW96158.1|62923_63433_+|plate	baseplate protein	plate	Q1MVJ9	Enterobacteria_phage	99.4	6.6e-91
AWA19850.1|63592_64705_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
APW96159.1|64898_65054_-	type I toxin-antitoxin system hok family toxin	NA	A0A1I9LJU7	Stx_converting_phage	90.2	4.0e-15
APW96160.2|65517_66730_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.0	5.1e-166
APW96161.1|66696_66894_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.5e-06
APW96163.1|69235_70108_-	hypothetical protein	NA	NA	NA	NA	NA
APW96233.1|70283_70748_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
APW96164.2|70890_71588_-|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	94.0	5.1e-126
AWA19851.1|71725_71917_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.4e-06
APW96167.2|72280_73654_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
APW96170.2|75163_75861_-|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	92.7	3.3e-125
