The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP031885	Klebsiella pneumoniae strain WCHKP095845 chromosome, complete genome	5239924	1190460	1247072	5239924	capsid,head,integrase,plate,tRNA,portal,tail,lysis	Salmonella_phage(74.0%)	70	1200092:1200136	1235700:1235744
AXU01555.1|1190460_1192794_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	84.4	0.0e+00
AXU01556.1|1192808_1193129_-	hypothetical protein	NA	NA	NA	NA	NA
AXU01557.1|1193125_1193353_-	hypothetical protein	NA	NA	NA	NA	NA
AXU01558.1|1193349_1193901_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	70.4	3.0e-33
AXU01559.1|1194713_1195451_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	66.1	6.9e-81
AXU01560.1|1195447_1195693_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	77.8	3.7e-31
AXU01561.1|1195709_1196276_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	1.5e-56
AXU01562.1|1196317_1196425_-	acetyl xylan esterase	NA	NA	NA	NA	NA
AXU01563.1|1196790_1198683_+	hypothetical protein	NA	NA	NA	NA	NA
AXU01564.1|1198719_1199907_-	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	51.0	2.4e-107
1200092:1200136	attL	TGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AXU01565.1|1200268_1201789_-	hypothetical protein	NA	NA	NA	NA	NA
AXU01566.1|1201801_1202815_-|integrase	integrase	integrase	E5G6L0	Salmonella_phage	95.5	7.7e-192
AXU01567.1|1202816_1203449_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	91.0	8.1e-107
AXU01568.1|1203568_1203817_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	71.6	3.4e-24
AXU01569.1|1203849_1204359_+	hypothetical protein	NA	E5G6L3	Salmonella_phage	96.4	3.5e-84
AXU05240.1|1204366_1204567_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
AXU01570.1|1204530_1204872_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
AXU01571.1|1204939_1205173_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
AXU01572.1|1205172_1205400_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AXU01573.1|1205396_1206254_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.5	1.6e-161
AXU01574.1|1206250_1208665_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.0	0.0e+00
AXU01575.1|1208818_1209007_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
AXU01576.1|1208945_1209251_+	DinI family protein	NA	E5G6M1	Salmonella_phage	88.3	1.1e-32
AXU01577.1|1209491_1210640_+	DUF4297 domain-containing protein	NA	NA	NA	NA	NA
AXU01578.1|1210629_1212288_+	AAA family ATPase	NA	NA	NA	NA	NA
AXU01579.1|1212328_1213360_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.7	1.3e-170
AXU01580.1|1213359_1215126_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.1	0.0e+00
AXU01581.1|1215268_1216102_+|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	89.2	1.7e-123
AXU01582.1|1216118_1217177_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.8e-181
AXU01583.1|1217180_1217831_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	96.3	8.7e-112
AXU01584.1|1217926_1218391_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
AXU01585.1|1218390_1218591_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	91.0	7.4e-30
AXU01586.1|1218594_1218810_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AXU05241.1|1218829_1219303_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AXU01587.1|1219304_1219682_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	3.9e-16
AXU01588.1|1219678_1220107_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.9	7.1e-46
AXU01589.1|1220036_1220240_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	1.8e-23
AXU01590.1|1220202_1220634_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AXU01591.1|1220626_1221073_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AXU01592.1|1221141_1221720_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	2.1e-93
AXU01593.1|1221716_1222076_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	4.7e-51
AXU01594.1|1222062_1222971_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	5.9e-143
AXU01595.1|1222963_1223569_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	2.0e-110
AXU01596.1|1223565_1225116_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	71.3	3.4e-199
AXU01597.1|1225115_1225718_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	2.5e-97
AXU01598.1|1225689_1226130_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	68.0	2.3e-52
AXU01599.1|1226132_1226531_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	38.3	1.3e-12
AXU01600.1|1226558_1227125_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	85.7	4.2e-86
AXU01601.1|1227267_1228440_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	89.7	1.9e-202
AXU01602.1|1228449_1228965_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	4.8e-89
AXU01603.1|1229019_1229322_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
AXU01604.1|1229336_1229456_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AXU01605.1|1229448_1232526_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.2	0.0e+00
AXU01606.1|1232522_1233008_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	1.7e-67
AXU01607.1|1233004_1234105_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.2	5.5e-175
AXU01608.1|1234195_1234414_+	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AXU01609.1|1234817_1235591_+	reverse transcriptase	NA	NA	NA	NA	NA
AXU01610.1|1236206_1236689_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
1235700:1235744	attR	TGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AXU01611.1|1236799_1237276_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AXU01612.1|1237265_1237556_+	RnfH family protein	NA	NA	NA	NA	NA
AXU01613.1|1237622_1237964_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AXU01614.1|1238111_1239773_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AXU01615.1|1239859_1240738_-	NAD(+) kinase	NA	NA	NA	NA	NA
AXU01616.1|1240862_1241453_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AXU01617.1|1241572_1242859_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AXU01618.1|1242878_1243670_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AXU01619.1|1243833_1245198_+	signal recognition particle protein	NA	NA	NA	NA	NA
AXU01620.1|1245457_1245706_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AXU01621.1|1245724_1246273_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AXU01622.1|1246304_1247072_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 2
CP031885	Klebsiella pneumoniae strain WCHKP095845 chromosome, complete genome	5239924	1351820	1395036	5239924	transposase,holin,integrase,tail,terminase	Salmonella_phage(33.33%)	54	1349247:1349262	1376655:1376670
1349247:1349262	attL	CGCTGCTGGCGCCGCC	NA	NA	NA	NA
AXU01711.1|1351820_1353287_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
AXU01712.1|1353354_1354932_+	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
AXU01713.1|1355123_1356374_+|integrase	site-specific integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.1	6.8e-206
AXU01714.1|1356390_1356582_-	hypothetical protein	NA	NA	NA	NA	NA
AXU01715.1|1356578_1357172_-	adenine methylase	NA	T1SA14	Salmonella_phage	91.4	3.7e-109
AXU01716.1|1357168_1357327_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	80.8	5.1e-18
AXU01717.1|1357319_1357613_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	8.9e-32
AXU01718.1|1357722_1357971_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
AXU01719.1|1358019_1358901_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	84.3	6.8e-136
AXU01720.1|1358897_1359719_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	80.6	6.2e-131
AXU01721.1|1359718_1360003_-	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	44.0	2.4e-10
AXU01722.1|1359999_1360299_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	4.7e-20
AXU05244.1|1360306_1361338_-	hypothetical protein	NA	A0A1B0VN89	Pseudomonas_phage	51.4	3.6e-35
AXU01723.1|1361738_1362320_-	XRE family transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	2.1e-64
AXU01724.1|1362473_1362707_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
AXU01725.1|1362853_1363063_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.4e-26
AXU01726.1|1363062_1363824_+	primosomal protein	NA	A0A193GZ86	Enterobacter_phage	90.2	1.6e-136
AXU01727.1|1363820_1364606_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
AXU01728.1|1364725_1365073_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	83.5	1.7e-50
AXU05245.1|1365265_1365805_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	41.9	1.5e-08
AXU01729.1|1366081_1366843_+	ead/Ea22-like family protein	NA	C6ZR30	Salmonella_phage	65.2	6.8e-07
AXU01730.1|1366839_1367019_+	hypothetical protein	NA	NA	NA	NA	NA
AXU01731.1|1367015_1367759_+	hypothetical protein	NA	K7P7E4	Enterobacteria_phage	56.6	3.3e-14
AXU01732.1|1367843_1368083_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	51.7	1.9e-08
AXU01733.1|1368082_1368319_+	hypothetical protein	NA	NA	NA	NA	NA
AXU01734.1|1368311_1368650_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	88.2	1.9e-49
AXU05246.1|1368724_1368982_+	lF-82	NA	NA	NA	NA	NA
AXU01735.1|1369059_1369644_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	89.1	1.3e-90
AXU01736.1|1369640_1371116_+|terminase	terminase	terminase	Q858H3	Salmonella_phage	92.5	1.9e-279
AXU01737.1|1371127_1371400_-	hypothetical protein	NA	NA	NA	NA	NA
AXU01738.1|1371485_1371851_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	95.9	5.1e-61
AXU01739.1|1372342_1372531_+	hypothetical protein	NA	NA	NA	NA	NA
AXU01740.1|1372550_1372757_+	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
AXU01741.1|1372771_1374454_+|tail	phage tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.4	2.5e-264
AXU01742.1|1374450_1374747_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	9.6e-34
AXU01743.1|1374749_1375439_+	peptidase	NA	G9L6C4	Escherichia_phage	69.6	2.9e-65
AXU01744.1|1375453_1376440_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	93.6	3.3e-179
AXU01745.1|1376493_1376931_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.7	1.3e-66
1376655:1376670	attR	CGCTGCTGGCGCCGCC	NA	NA	NA	NA
AXU01746.1|1376941_1377283_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	71.9	1.1e-36
AXU01747.1|1377333_1377657_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
AXU01748.1|1377656_1378262_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	79.0	3.3e-89
AXU01749.1|1378261_1380739_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.2	0.0e+00
AXU01750.1|1380738_1381203_+	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
AXU01751.1|1381202_1381742_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	79.4	3.0e-70
AXU01752.1|1381752_1384566_+	hypothetical protein	NA	T1SBJ1	Salmonella_phage	93.3	0.0e+00
AXU01753.1|1384562_1386368_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	73.3	1.7e-237
AXU01754.1|1386371_1388846_+	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	87.0	0.0e+00
AXU01755.1|1389044_1389341_+	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	94.8	4.4e-47
AXU01756.1|1389375_1389528_-	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	83.7	3.3e-14
AXU05247.1|1389626_1389887_-	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	64.0	2.1e-24
AXU01757.1|1389986_1391207_+|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
AXU01758.1|1393755_1394004_+	hypothetical protein	NA	NA	NA	NA	NA
AXU01759.1|1394339_1394744_+	hypothetical protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
AXU01760.1|1394730_1395036_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	80.4	7.8e-39
>prophage 3
CP031885	Klebsiella pneumoniae strain WCHKP095845 chromosome, complete genome	5239924	1737542	1744449	5239924		Planktothrix_phage(33.33%)	6	NA	NA
AXU05260.1|1737542_1738406_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.0	4.8e-09
AXU02054.1|1738416_1739190_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
AXU05261.1|1739432_1740326_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
AXU02055.1|1740571_1741933_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
AXU02056.1|1742251_1742974_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AXU02057.1|1742970_1744449_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 4
CP031885	Klebsiella pneumoniae strain WCHKP095845 chromosome, complete genome	5239924	1786013	1794409	5239924		Enterobacteria_phage(28.57%)	7	NA	NA
AXU02084.1|1786013_1787420_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.9	1.6e-38
AXU02085.1|1787661_1788726_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.1	6.4e-104
AXU02086.1|1788752_1789622_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	67.0	7.5e-111
AXU02087.1|1789653_1790544_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	3.7e-28
AXU02088.1|1790558_1791113_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
AXU02089.1|1791293_1792460_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
AXU02090.1|1793404_1794409_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.0e-31
>prophage 5
CP031885	Klebsiella pneumoniae strain WCHKP095845 chromosome, complete genome	5239924	1899951	1984416	5239924	capsid,holin,head,tRNA,portal,tail,protease,terminase	Enterobacteria_phage(21.05%)	100	NA	NA
AXU02187.1|1899951_1901685_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.8	1.4e-87
AXU02188.1|1901920_1902490_+	VOC family protein	NA	NA	NA	NA	NA
AXU02189.1|1902566_1903310_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AXU02190.1|1903391_1904396_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AXU02191.1|1904392_1905136_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.1e-25
AXU02192.1|1905175_1905571_-	hypothetical protein	NA	NA	NA	NA	NA
AXU02193.1|1905623_1906403_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	82.7	1.1e-60
AXU02194.1|1906399_1907659_-	DUF3596 domain-containing protein	NA	A0A286S1S8	Klebsiella_phage	90.2	2.1e-223
AXU02195.1|1907701_1907947_-	excisionase	NA	A0A286S2A4	Klebsiella_phage	92.1	1.4e-35
AXU02196.1|1908080_1908374_-	hypothetical protein	NA	A0A1U8QJU8	Salmonella_virus	58.3	9.8e-23
AXU02197.1|1908370_1909018_-	hypothetical protein	NA	R9VWB9	Serratia_phage	52.6	5.1e-56
AXU02198.1|1909010_1909355_-	hypothetical protein	NA	NA	NA	NA	NA
AXU02199.1|1909351_1909576_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	60.8	1.5e-18
AXU02200.1|1909572_1909800_-	hypothetical protein	NA	A0A291LBA3	Klebsiella_phage	46.8	8.1e-09
AXU02201.1|1910101_1910395_-	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
AXU02202.1|1910585_1910774_-	hypothetical protein	NA	NA	NA	NA	NA
AXU02203.1|1911447_1912080_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	36.9	6.4e-35
AXU02204.1|1912178_1912400_+	helix-turn-helix domain-containing protein	NA	Q716D6	Shigella_phage	55.7	8.2e-14
AXU02205.1|1912439_1912760_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	68.9	5.0e-36
AXU02206.1|1912955_1913210_+	hypothetical protein	NA	NA	NA	NA	NA
AXU02207.1|1913206_1914256_+	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	51.5	2.7e-30
AXU02208.1|1914282_1914678_+	hypothetical protein	NA	NA	NA	NA	NA
AXU02209.1|1914677_1914899_+	hypothetical protein	NA	NA	NA	NA	NA
AXU02210.1|1914891_1915683_+	hypothetical protein	NA	A4JX52	Burkholderia_virus	51.7	5.3e-63
AXU02211.1|1915675_1916308_+	ead/Ea22-like family protein	NA	K7PJQ4	Enterobacteria_phage	40.2	9.0e-05
AXU02212.1|1916471_1917071_+	DUF551 domain-containing protein	NA	G9L6B4	Escherichia_phage	59.5	2.7e-19
AXU05272.1|1917070_1917259_+	hypothetical protein	NA	R9TNE4	Aeromonas_phage	72.9	4.7e-18
AXU02213.1|1917331_1917601_+	hypothetical protein	NA	H6WRY4	Salmonella_phage	80.7	3.5e-35
AXU02214.1|1917842_1918151_+	DUF968 domain-containing protein	NA	Q6V7S4	Burkholderia_virus	57.6	1.6e-23
AXU02215.1|1918143_1918788_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	81.0	3.6e-102
AXU02216.1|1918784_1919384_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	58.4	1.1e-65
AXU02217.1|1920086_1920356_+|holin	holin	holin	K7P6H9	Enterobacteria_phage	78.3	2.8e-32
AXU05273.1|1920333_1920831_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	83.6	9.6e-79
AXU02218.1|1920827_1921217_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	50.0	1.5e-23
AXU02219.1|1921209_1921359_+	Rz1 lytic protein	NA	S5FXQ4	Shigella_phage	71.4	1.1e-09
AXU02220.1|1921482_1921803_+	hypothetical protein	NA	NA	NA	NA	NA
AXU02221.1|1921805_1922156_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	80.2	1.2e-51
AXU02222.1|1922313_1922811_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	72.1	1.1e-61
AXU02223.1|1922810_1924568_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	91.1	0.0e+00
AXU02224.1|1924578_1924764_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	61.7	6.2e-15
AXU02225.1|1924763_1925993_+|portal	phage portal protein	portal	U5P411	Shigella_phage	82.4	8.2e-204
AXU02226.1|1925979_1926633_+|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	87.9	7.1e-106
AXU02227.1|1926647_1927856_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	84.8	2.2e-193
AXU02228.1|1927894_1928098_+	hypothetical protein	NA	M1FN89	Enterobacteria_phage	42.4	2.3e-07
AXU02229.1|1928094_1928415_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	39.8	1.7e-15
AXU02230.1|1928423_1928762_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	74.1	1.4e-41
AXU02231.1|1928758_1929208_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	81.9	9.7e-62
AXU02232.1|1929204_1929552_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	62.8	8.0e-32
AXU02233.1|1929608_1930313_+|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	66.9	5.5e-80
AXU02234.1|1930343_1930748_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	57.7	8.5e-33
AXU02235.1|1930750_1931056_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
AXU02236.1|1931129_1931363_+	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
AXU02237.1|1931423_1934810_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.9	1.5e-303
AXU02238.1|1934830_1935304_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	61.4	1.6e-54
AXU02239.1|1935290_1935776_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	66.2	3.0e-53
AXU02240.1|1935785_1936166_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	80.2	2.1e-57
AXU02241.1|1936162_1939237_+	kinase	NA	A0A286S259	Klebsiella_phage	70.6	0.0e+00
AXU02242.1|1941381_1941633_+	hypothetical protein	NA	NA	NA	NA	NA
AXU02243.1|1941894_1943436_+	hypothetical protein	NA	NA	NA	NA	NA
AXU02244.1|1943443_1944667_-	hypothetical protein	NA	NA	NA	NA	NA
AXU02245.1|1945044_1945284_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	63.3	3.0e-22
AXU02246.1|1945508_1946075_-	hydrolase	NA	NA	NA	NA	NA
AXU02247.1|1946342_1948130_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.2	1.3e-11
AXU02248.1|1948131_1948575_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
AXU02249.1|1948602_1949343_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AXU02250.1|1949377_1949899_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	3.4e-10
AXU02251.1|1949978_1950590_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AXU02252.1|1950598_1951609_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.3	1.4e-07
AXU02253.1|1951672_1952458_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
AXU02254.1|1952457_1953210_-	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.4	6.7e-15
AXU02255.1|1953288_1954233_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
AXU02256.1|1954248_1955568_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	38.2	5.3e-15
AXU02257.1|1955685_1956660_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
AXU02258.1|1956700_1958143_-	pyruvate kinase	NA	NA	NA	NA	NA
AXU05274.1|1958268_1959138_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AXU02259.1|1959173_1959362_-	hypothetical protein	NA	NA	NA	NA	NA
AXU02260.1|1959333_1959483_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
AXU02261.1|1959493_1960969_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.8	3.2e-77
AXU02262.1|1961191_1963003_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
AXU02263.1|1963041_1963683_+	keto-hydroxyglutarate-aldolase/keto-deoxy- phosphogluconate aldolase	NA	NA	NA	NA	NA
AXU02264.1|1963740_1964919_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
AXU02265.1|1965063_1965411_+	LexA family transcriptional regulator	NA	NA	NA	NA	NA
AXU02266.1|1965550_1966210_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
AXU02267.1|1966330_1968391_+	oligopeptidase B	NA	NA	NA	NA	NA
AXU02268.1|1968394_1969054_-	exodeoxyribonuclease X	NA	A0A0H4IT92	Pseudoalteromonas_phage	31.2	4.9e-14
AXU02269.1|1969132_1969363_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	57.4	5.9e-15
AXU02270.1|1969475_1969850_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AXU02271.1|1969853_1970723_+	hypothetical protein	NA	NA	NA	NA	NA
AXU05275.1|1970736_1971078_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AXU02272.1|1971962_1972967_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
AXU02273.1|1973087_1973741_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.0e-56
AXU02274.1|1973737_1973929_-	DUF1482 family protein	NA	NA	NA	NA	NA
AXU02275.1|1974026_1974266_-	DUF1480 family protein	NA	NA	NA	NA	NA
AXU02276.1|1974381_1975815_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
AXU02277.1|1975938_1978572_-	PqiB family protein	NA	NA	NA	NA	NA
AXU02278.1|1978540_1979824_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
AXU02279.1|1979956_1980454_+	GAF domain-containing protein	NA	NA	NA	NA	NA
AXU02280.1|1980551_1981229_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
AXU02281.1|1981248_1983297_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.3	3.0e-86
AXU02282.1|1983531_1984416_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 6
CP031885	Klebsiella pneumoniae strain WCHKP095845 chromosome, complete genome	5239924	2743058	2753946	5239924		Escherichia_phage(87.5%)	9	NA	NA
AXU02996.1|2743058_2746166_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
AXU02997.1|2747516_2748605_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	99.4	2.0e-209
AXU02998.1|2748691_2748952_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
AXU02999.1|2749249_2750110_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
AXU03000.1|2750130_2750892_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AXU03001.1|2750882_2751116_+	hypothetical protein	NA	NA	NA	NA	NA
AXU03002.1|2751153_2752056_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	98.3	2.5e-157
AXU03003.1|2752067_2753333_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.0	1.5e-232
AXU03004.1|2753325_2753946_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 7
CP031885	Klebsiella pneumoniae strain WCHKP095845 chromosome, complete genome	5239924	3407765	3417229	5239924	tRNA,protease	Brazilian_cedratvirus(16.67%)	9	NA	NA
AXU03604.1|3407765_3409487_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
AXU03605.1|3409531_3410233_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AXU03606.1|3410586_3410805_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AXU03607.1|3410925_3413205_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AXU03608.1|3413235_3413553_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AXU03609.1|3413878_3414100_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AXU03610.1|3414054_3414237_-	hypothetical protein	NA	NA	NA	NA	NA
AXU03611.1|3414176_3416117_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	7.2e-37
AXU03612.1|3416113_3417229_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 8
CP031885	Klebsiella pneumoniae strain WCHKP095845 chromosome, complete genome	5239924	4594103	4606135	5239924		Enterobacteria_phage(71.43%)	11	NA	NA
AXU04636.1|4594103_4595369_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	40.3	5.8e-80
AXU04637.1|4596111_4598445_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.7	0.0e+00
AXU04638.1|4598458_4598779_-	hypothetical protein	NA	NA	NA	NA	NA
AXU04639.1|4598775_4599003_-	hypothetical protein	NA	NA	NA	NA	NA
AXU04640.1|4598999_4599551_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	66.7	4.9e-31
AXU04641.1|4600374_4601112_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	60.1	1.9e-70
AXU04642.1|4601108_4601354_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	59.3	5.0e-20
AXU04643.1|4601371_4601938_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	3.9e-60
AXU04644.1|4602003_4602219_+	hypothetical protein	NA	NA	NA	NA	NA
AXU04645.1|4602334_4604743_-	hypothetical protein	NA	NA	NA	NA	NA
AXU04646.1|4604863_4606135_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	40.7	3.1e-73
>prophage 1
CP031883	Klebsiella pneumoniae strain WCHKP095845 plasmid pMCR8_095845, complete sequence	110966	5114	50402	110966	integrase,transposase	Escherichia_phage(46.15%)	45	NA	NA
AXU00185.1|5114_6038_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
AXU00186.1|6144_6888_+	DUF3471 domain-containing protein	NA	NA	NA	NA	NA
AXU00187.1|7174_7645_-	DNA gyrase inhibitor	NA	NA	NA	NA	NA
AXU00188.1|8116_9049_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
AXU00305.1|9123_10149_+	class A beta-lactamase-related serine hydrolase	NA	NA	NA	NA	NA
AXU00189.1|10168_10525_+	hypothetical protein	NA	NA	NA	NA	NA
AXU00190.1|10548_11082_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
AXU00191.1|11083_11293_+	transcriptional regulator	NA	NA	NA	NA	NA
AXU00192.1|11490_12390_+	glycosyl transferase	NA	NA	NA	NA	NA
AXU00193.1|12837_13227_-	diacylglycerol kinase	NA	NA	NA	NA	NA
AXU00194.1|13340_14570_-	sensor histidine kinase	NA	NA	NA	NA	NA
AXU00195.1|14591_15287_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	32.0	1.7e-25
AXU00306.1|15323_16531_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	7.5e-101
AXU00196.1|16738_18436_+	phosphoethanolamine--lipid A transferase MCR-8.2	NA	NA	NA	NA	NA
AXU00197.1|19481_20462_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	3.0e-185
AXU00307.1|20500_20647_-	ABC transporter	NA	NA	NA	NA	NA
AXU00308.1|20903_21584_-	hypothetical protein	NA	NA	NA	NA	NA
AXU00198.1|21877_22906_-	hypothetical protein	NA	NA	NA	NA	NA
AXU00199.1|23066_23648_-	hypothetical protein	NA	NA	NA	NA	NA
AXU00200.1|24190_24541_+	hypothetical protein	NA	NA	NA	NA	NA
AXU00201.1|24591_25335_+	hypothetical protein	NA	NA	NA	NA	NA
AXU00202.1|25331_26108_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
AXU00203.1|26165_26423_-	hypothetical protein	NA	NA	NA	NA	NA
AXU00204.1|27185_28052_+	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
AXU00205.1|28228_28498_-	hypothetical protein	NA	NA	NA	NA	NA
AXU00206.1|28912_30118_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
AXU00207.1|30114_31092_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.1	5.0e-87
AXU00208.1|31173_32445_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.7	5.4e-150
AXU00209.1|32444_32876_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
AXU00210.1|33033_33285_+	hypothetical protein	NA	NA	NA	NA	NA
AXU00211.1|36023_36503_+	hypothetical protein	NA	NA	NA	NA	NA
AXU00212.1|36578_36878_+	hypothetical protein	NA	NA	NA	NA	NA
AXU00213.1|37235_38159_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.4	1.8e-171
AXU00214.1|38298_38685_-	hypothetical protein	NA	NA	NA	NA	NA
AXU00309.1|41286_41679_+	cysteine hydrolase	NA	NA	NA	NA	NA
AXU00215.1|41816_42701_+	EamA family transporter	NA	NA	NA	NA	NA
AXU00216.1|42732_43932_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AXU00217.1|44010_44688_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AXU00218.1|44719_44962_-	relaxase	NA	NA	NA	NA	NA
AXU00219.1|45267_46104_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AXU00220.1|46103_46907_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AXU00221.1|46967_47783_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
AXU00222.1|48090_48942_-	replication protein	NA	NA	NA	NA	NA
AXU00223.1|48928_49636_-	hypothetical protein	NA	NA	NA	NA	NA
AXU00224.1|49697_50402_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
CP031883	Klebsiella pneumoniae strain WCHKP095845 plasmid pMCR8_095845, complete sequence	110966	70542	77617	110966	integrase	Escherichia_phage(50.0%)	7	68938:68950	75722:75734
68938:68950	attL	TGATGAACTGCCT	NA	NA	NA	NA
AXU00249.1|70542_71337_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
AXU00250.1|71800_71980_-	Par-like protein	NA	NA	NA	NA	NA
AXU00251.1|72099_72726_-	cobyrinic acid ac-diamide synthase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
AXU00252.1|73422_74298_-	replication initiation protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
AXU00253.1|74709_75981_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.0	5.2e-153
75722:75734	attR	AGGCAGTTCATCA	NA	NA	NA	NA
AXU00254.1|75980_76412_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
AXU00255.1|76645_77617_+	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
>prophage 1
CP031884	Klebsiella pneumoniae strain WCHKP095845 plasmid pNDM1_095845, complete sequence	105259	50768	103274	105259	bacteriocin,transposase,coat	Escherichia_phage(18.18%)	60	NA	NA
AXU00359.1|50768_51473_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AXU00418.1|51502_51778_+	hypothetical protein	NA	NA	NA	NA	NA
AXU00360.1|51833_52028_+	hypothetical protein	NA	NA	NA	NA	NA
AXU00361.1|51988_53518_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AXU00362.1|53706_55347_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	62.1	8.2e-175
AXU00363.1|55402_55693_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.8	2.1e-17
AXU00364.1|55886_56216_+	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
AXU00365.1|56220_57252_+	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
AXU00366.1|57262_57901_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
AXU00367.1|57905_58271_-	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
AXU00368.1|58274_59087_-	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
AXU00419.1|59340_59463_+	sugar kinase	NA	Q6QLL3	Human_immunodeficiency_virus	97.2	2.5e-12
AXU00369.1|59500_60517_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
AXU00370.1|66313_66499_-	hypothetical protein	NA	NA	NA	NA	NA
AXU00420.1|66456_66669_-	hypothetical protein	NA	NA	NA	NA	NA
AXU00371.1|66731_67007_-	hypothetical protein	NA	NA	NA	NA	NA
AXU00372.1|67024_67279_-	hypothetical protein	NA	NA	NA	NA	NA
AXU00373.1|67388_68210_-	sprT domain-containing protein	NA	NA	NA	NA	NA
AXU00374.1|68206_68386_-	hypothetical protein	NA	NA	NA	NA	NA
AXU00375.1|68658_69309_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
AXU00376.1|69346_69802_-	DNA-binding protein	NA	NA	NA	NA	NA
AXU00377.1|69813_72141_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	28.1	8.6e-37
AXU00378.1|72144_73407_-	ATP-binding protein	NA	A0A1V0SKF8	Klosneuvirus	31.4	1.3e-07
AXU00379.1|73489_73984_-	micrococcal nuclease	NA	A0A0R6PHV6	Moraxella_phage	37.3	8.0e-17
AXU00380.1|73980_74307_-	hypothetical protein	NA	NA	NA	NA	NA
AXU00381.1|74392_74707_-	hypothetical protein	NA	NA	NA	NA	NA
AXU00382.1|74794_75187_-	conjugal transfer protein	NA	NA	NA	NA	NA
AXU00383.1|75183_77025_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AXU00384.1|77021_78056_-	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
AXU00385.1|78052_78250_-	DNA-binding protein	NA	NA	NA	NA	NA
AXU00386.1|78251_79466_-	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
AXU00387.1|79462_80392_-	conjugal transfer protein	NA	NA	NA	NA	NA
AXU00388.1|80397_81126_-	pilus assembly protein	NA	NA	NA	NA	NA
AXU00389.1|81320_82376_-	type IV secretion system protein	NA	NA	NA	NA	NA
AXU00390.1|82387_82645_-	hypothetical protein	NA	NA	NA	NA	NA
AXU00391.1|82654_83425_-	pilus assembly protein	NA	NA	NA	NA	NA
AXU00392.1|83434_86188_-	conjugal transfer protein	NA	NA	NA	NA	NA
AXU00393.1|86212_86503_-	hypothetical protein	NA	NA	NA	NA	NA
AXU00394.1|86486_87131_-	transglycosylase	NA	NA	NA	NA	NA
AXU00395.1|87176_87413_-	hypothetical protein	NA	NA	NA	NA	NA
AXU00396.1|87363_87873_-	transcription termination factor NusG	NA	NA	NA	NA	NA
AXU00397.1|88225_89386_-|coat	spore coat protein CotH	coat	NA	NA	NA	NA
AXU00421.1|89388_89934_-	DNA distortion polypeptide 1	NA	NA	NA	NA	NA
AXU00398.1|90178_90394_+	hypothetical protein	NA	NA	NA	NA	NA
AXU00399.1|90767_91106_-	hypothetical protein	NA	NA	NA	NA	NA
AXU00400.1|91199_91442_-	hypothetical protein	NA	NA	NA	NA	NA
AXU00401.1|91431_91644_-	hypothetical protein	NA	NA	NA	NA	NA
AXU00402.1|91709_92261_-	hypothetical protein	NA	NA	NA	NA	NA
AXU00403.1|92320_92557_-	hypothetical protein	NA	NA	NA	NA	NA
AXU00404.1|92615_93131_-	molecular chaperone DnaJ	NA	A0A2K9L588	Tupanvirus	39.8	3.3e-05
AXU00405.1|94483_95497_+	replication initiation protein	NA	NA	NA	NA	NA
AXU00422.1|95505_95949_+	hypothetical protein	NA	NA	NA	NA	NA
AXU00423.1|96136_96490_+	DNA distortion polypeptide 3	NA	NA	NA	NA	NA
AXU00406.1|96510_96795_-	hypothetical protein	NA	NA	NA	NA	NA
AXU00407.1|96830_97142_-	hypothetical protein	NA	NA	NA	NA	NA
AXU00408.1|97347_97632_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AXU00409.1|97731_98394_-	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
AXU00424.1|98774_99437_+	resolvase	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
AXU00410.1|99525_100746_-|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
AXU00411.1|100952_103274_+|bacteriocin	klebicin B-related nuclease bacteriocin	bacteriocin	NA	NA	NA	NA
