The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP017188	Xanthomonas citri pv. glycines str. 8ra chromosome, complete genome	5364156	439333	463249	5364156	transposase,integrase	Shigella_phage(100.0%)	13	437836:437850	460579:460593
437836:437850	attL	GTTGCGGCACGCGCT	NA	NA	NA	NA
AZB52676.1|439333_440478_-|transposase	IS3-like element ISXac3 family transposase	transposase	U5P429	Shigella_phage	59.6	5.6e-90
AZB52477.1|440814_444819_+	avirulence protein	NA	NA	NA	NA	NA
AOY64698.2|445126_445618_-	hypothetical protein	NA	NA	NA	NA	NA
AOY64697.2|445807_446952_-|transposase	IS3-like element ISXac3 family transposase	transposase	U5P429	Shigella_phage	59.6	5.6e-90
AZB52478.1|447288_450885_+	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
AOY64696.2|451192_451684_-	hypothetical protein	NA	NA	NA	NA	NA
AOY64695.2|451873_453018_-|transposase	IS3-like element ISXac3 family transposase	transposase	U5P429	Shigella_phage	59.6	5.6e-90
AOY64694.1|453354_456849_+	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
AOY64693.2|457156_457648_-	hypothetical protein	NA	NA	NA	NA	NA
AOY64692.2|457837_458982_-|transposase	IS3-like element ISXac3 family transposase	transposase	U5P429	Shigella_phage	59.6	5.6e-90
AOY64691.2|459008_459413_+|integrase	integrase	integrase	NA	NA	NA	NA
AOY64690.1|459664_461503_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
460579:460593	attR	GTTGCGGCACGCGCT	NA	NA	NA	NA
AOY64689.1|461887_463249_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
CP017188	Xanthomonas citri pv. glycines str. 8ra chromosome, complete genome	5364156	1232611	1304519	5364156	integrase,protease,portal,terminase,capsid,tail,plate,head,holin	Stenotrophomonas_phage(57.5%)	77	1225884:1225901	1265293:1265310
1225884:1225901	attL	GGCAAGACCACGCTGCTG	NA	NA	NA	NA
AOY64087.1|1232611_1234693_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
AZB52682.1|1235297_1235366_+	hypothetical protein	NA	NA	NA	NA	NA
AOY64085.1|1235570_1236215_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
AOY64084.1|1236483_1237782_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AOY64083.1|1237849_1238884_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
AOY64082.1|1239097_1239844_+	CvpA family protein	NA	NA	NA	NA	NA
AOY64081.1|1239874_1241341_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	39.9	4.1e-85
AOY64080.1|1241536_1242361_+	DUF455 domain-containing protein	NA	NA	NA	NA	NA
AZB52502.1|1242504_1242714_+	hypothetical protein	NA	NA	NA	NA	NA
AOY64079.1|1244332_1244752_+	hypothetical protein	NA	NA	NA	NA	NA
AOY64078.1|1244937_1245681_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
AOY64077.1|1246160_1246703_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AOY64076.1|1246683_1247820_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AOY64075.1|1248042_1249569_-	exopolyphosphatase	NA	NA	NA	NA	NA
AOY64074.1|1249740_1251843_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
AOY64073.2|1251955_1253299_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	33.3	6.5e-29
AOY64072.1|1253356_1254046_-	phosphate regulon transcriptional regulatory protein PhoB	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
AOY64071.1|1254228_1255875_-	M48 family peptidase	NA	NA	NA	NA	NA
AOY64070.1|1256024_1256333_+	glutaredoxin 3	NA	A0A2L0UZG6	Agrobacterium_phage	43.2	3.6e-07
AOY64069.1|1256329_1256725_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AOY64068.1|1256950_1257958_+	NAD-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
AOY64067.1|1258097_1258859_-	hypothetical protein	NA	NA	NA	NA	NA
AOY64065.2|1260189_1261146_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	55.3	1.7e-92
AZB52503.1|1261370_1261592_-	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	56.3	1.6e-14
AOY64064.1|1261588_1261798_-	hypothetical protein	NA	NA	NA	NA	NA
AOY64063.2|1261794_1261998_-	hypothetical protein	NA	NA	NA	NA	NA
AOY64062.1|1262063_1262288_-	hypothetical protein	NA	NA	NA	NA	NA
AOY64061.1|1262284_1262557_-	hypothetical protein	NA	NA	NA	NA	NA
AOY64060.1|1262549_1262732_-	hypothetical protein	NA	NA	NA	NA	NA
AOY64059.2|1262724_1263099_-	hypothetical protein	NA	V9IQL6	Stenotrophomonas_phage	48.8	1.7e-19
AOY64058.1|1263228_1263501_-	hypothetical protein	NA	NA	NA	NA	NA
AOY64057.1|1263500_1263788_-	hypothetical protein	NA	NA	NA	NA	NA
AOY64056.1|1263784_1264003_-	hypothetical protein	NA	NA	NA	NA	NA
AOY64055.2|1264323_1266996_-	bifunctional DNA primase/helicase	NA	V9IQW5	Stenotrophomonas_phage	69.7	0.0e+00
1265293:1265310	attR	CAGCAGCGTGGTCTTGCC	NA	NA	NA	NA
AOY64054.1|1267028_1267241_-	hypothetical protein	NA	NA	NA	NA	NA
AOY64053.1|1267237_1267516_-	hypothetical protein	NA	NA	NA	NA	NA
AOY64052.1|1267526_1267847_-	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	58.7	2.0e-24
AZB52683.1|1267849_1268098_-	hypothetical protein	NA	NA	NA	NA	NA
AOY64051.1|1268183_1268615_+	transcriptional regulator	NA	E5E3U2	Burkholderia_phage	38.2	1.4e-09
AOY64050.1|1269221_1270208_-	phage late control D family protein	NA	V9IQM7	Stenotrophomonas_phage	55.7	2.8e-93
AOY64049.1|1270204_1270606_-	oxidoreductase	NA	V9IQX3	Stenotrophomonas_phage	61.4	3.5e-39
AOY64048.1|1270618_1273489_-|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	47.1	8.9e-193
AZB52504.1|1273518_1273632_-|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
AOY64047.1|1273640_1273943_-|tail	phage tail assembly protein	tail	V9IQM4	Stenotrophomonas_phage	67.4	2.2e-25
AOY64046.1|1273988_1274498_-|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	81.1	2.1e-73
AOY64045.1|1274527_1275694_-|tail	phage tail protein	tail	E5FFG9	Burkholderia_phage	63.2	1.1e-133
AOY64044.1|1275705_1276065_-|plate	baseplate assembly protein	plate	V9IQW0	Stenotrophomonas_phage	62.7	2.1e-35
AOY64043.1|1276061_1276625_-|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	47.0	8.2e-26
AOY64042.1|1276767_1277442_-	hypothetical protein	NA	NA	NA	NA	NA
AOY64041.1|1277444_1277738_-	hypothetical protein	NA	NA	NA	NA	NA
AOY64040.1|1277811_1279611_-	hypothetical protein	NA	V9IQX0	Stenotrophomonas_phage	37.6	8.9e-82
AOY64039.1|1279623_1280166_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	56.6	1.1e-51
AOY64038.1|1280158_1281049_-|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	53.0	2.6e-82
AZB52505.1|1281144_1282683_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
AOY64037.1|1282864_1283314_-	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	56.5	6.3e-37
AOY64036.1|1283301_1283721_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	65.2	1.1e-40
AOY64035.1|1283717_1284206_-	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	52.6	1.2e-28
AOY64034.2|1284205_1284847_-	lysozyme	NA	V9IQK6	Stenotrophomonas_phage	60.4	2.7e-49
AOY64033.1|1284843_1285119_-|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	59.8	1.3e-21
AOY64032.1|1285111_1285468_-	hypothetical protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	3.5e-22
AOY64031.1|1285472_1285682_-|tail	phage tail protein	tail	K4PAW7	Burkholderia_phage	59.4	7.0e-15
AOY64030.1|1285681_1286149_-|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	49.7	4.6e-30
AOY64029.1|1286247_1286967_-|terminase	terminase	terminase	Q9ZXM2	Pseudomonas_virus	63.8	5.3e-70
AOY64028.1|1286970_1287984_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	71.4	9.3e-137
AOY64027.1|1288030_1288873_-|capsid	phage capsid protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	53.5	3.4e-68
AOY64026.1|1288994_1290779_+|terminase	terminase	terminase	V9IQL5	Stenotrophomonas_phage	76.5	7.3e-270
AOY64025.1|1290778_1291792_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	71.9	5.8e-139
AZB52506.1|1291817_1292063_+	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	51.2	7.0e-14
AOY64023.1|1291980_1292682_+	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	75.5	2.1e-103
AZB52507.1|1292854_1293271_-	N-acetyltransferase	NA	NA	NA	NA	NA
AOY64982.1|1294198_1295098_-	hypothetical protein	NA	NA	NA	NA	NA
AOY64022.2|1296239_1297361_-	(p)ppGpp synthetase	NA	A0A1B0VBT5	Salmonella_phage	29.4	1.9e-29
AOY64021.1|1298368_1298698_+	hypothetical protein	NA	NA	NA	NA	NA
AOY64020.1|1298883_1299081_-	hypothetical protein	NA	NA	NA	NA	NA
AOY64018.1|1301095_1302388_+	trigger factor	NA	NA	NA	NA	NA
AOY64017.1|1302480_1303107_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
AOY64016.1|1303232_1304519_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	5.3e-137
>prophage 3
CP017188	Xanthomonas citri pv. glycines str. 8ra chromosome, complete genome	5364156	2036778	2047615	5364156	tRNA	Micromonas_pusilla_virus(16.67%)	13	NA	NA
AOY63442.1|2036778_2038455_+	2-polyprenylphenol 6-hydroxylase	NA	G8DDN0	Micromonas_pusilla_virus	29.4	1.9e-41
AOY63441.1|2038540_2039182_+	LexA family transcriptional regulator	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
AOY63440.1|2039354_2040389_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	61.3	5.1e-114
AOY63439.1|2040700_2041189_+	regulatory protein RecX	NA	NA	NA	NA	NA
AOY63438.1|2041290_2043939_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	40.0	1.7e-84
AOY63437.1|2044078_2044291_+	carbon storage regulator	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
AOY64935.2|2044511_2044736_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AOY64934.1|2044722_2044944_-	hypothetical protein	NA	NA	NA	NA	NA
AOY63436.1|2045077_2045296_-	hypothetical protein	NA	NA	NA	NA	NA
AOY63435.1|2045292_2045736_-	hypothetical protein	NA	NA	NA	NA	NA
AOY63434.1|2045732_2045951_-	hypothetical protein	NA	NA	NA	NA	NA
AOY63433.1|2045947_2046703_-	hypothetical protein	NA	NA	NA	NA	NA
AOY63432.1|2046706_2047615_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	33.9	3.1e-43
>prophage 4
CP017188	Xanthomonas citri pv. glycines str. 8ra chromosome, complete genome	5364156	2067695	2094171	5364156	integrase,portal,terminase,capsid,tail,head	Xanthomonas_phage(21.43%)	28	2090366:2090380	2097050:2097064
AOY63401.1|2067695_2068352_+	DNA primase	NA	A0A248XCW5	Klebsiella_phage	44.5	2.4e-37
AOY63400.1|2068348_2068852_+	hypothetical protein	NA	Q2NPA5	Xanthomonas_phage	40.0	1.6e-20
AOY63399.1|2068848_2069127_+	hypothetical protein	NA	NA	NA	NA	NA
AOY63397.1|2070633_2072721_+|terminase	terminase	terminase	A5LH27	Enterobacteria_phage	42.5	2.3e-153
AOY63396.1|2072722_2072938_+	hypothetical protein	NA	B7SYD5	Stenotrophomonas_phage	41.9	8.0e-06
AOY63395.1|2072930_2074433_+|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	48.3	4.2e-109
AOY63394.1|2074422_2075826_+	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	45.9	1.2e-41
AOY63393.1|2075828_2076500_+|head	head decoration protein	head	NA	NA	NA	NA
AOY63392.1|2076571_2077576_+|capsid	minor capsid protein E	capsid	A0A2H4J890	uncultured_Caudovirales_phage	40.8	1.6e-56
AOY63391.1|2077623_2078400_+	hypothetical protein	NA	A0A291AUT0	Sinorhizobium_phage	34.9	7.3e-25
AOY63390.1|2078396_2078717_+	hypothetical protein	NA	NA	NA	NA	NA
AOY63389.1|2078709_2079141_+	hypothetical protein	NA	NA	NA	NA	NA
AOY63388.1|2079180_2079924_+	hypothetical protein	NA	NA	NA	NA	NA
AOY63387.1|2079920_2080400_+	hypothetical protein	NA	NA	NA	NA	NA
AOY63386.1|2080561_2083279_+|tail	phage tail tape measure protein	tail	C4ML16	Xanthomonas_virus	34.0	2.4e-94
AOY63385.1|2083278_2083635_+	hypothetical protein	NA	Q52PL1	Xanthomonas_phage	44.4	1.6e-19
AOY63384.1|2083631_2084099_+	DUF1833 domain-containing protein	NA	Q52PL0	Xanthomonas_phage	46.5	8.0e-35
AOY63383.1|2084098_2084491_+	hypothetical protein	NA	Q2NPH1	Xanthomonas_virus	52.8	4.1e-32
AOY63382.1|2084481_2088882_+	hypothetical protein	NA	C4ML20	Xanthomonas_virus	50.7	0.0e+00
AOY63381.1|2088878_2089190_+	hypothetical protein	NA	NA	NA	NA	NA
AOY63380.2|2089227_2089869_+	hypothetical protein	NA	NA	NA	NA	NA
AOY63379.1|2089870_2090521_+	hypothetical protein	NA	NA	NA	NA	NA
2090366:2090380	attL	ATCGCCGACCTGATC	NA	NA	NA	NA
AOY63378.1|2090537_2090984_-	hypothetical protein	NA	NA	NA	NA	NA
AOY63377.1|2091243_2091447_-	hypothetical protein	NA	NA	NA	NA	NA
AOY63376.1|2091507_2091732_+	hypothetical protein	NA	NA	NA	NA	NA
AOY63375.1|2091741_2092677_+	DUF159 family protein	NA	NA	NA	NA	NA
AZB52532.1|2092807_2093041_+	hypothetical protein	NA	NA	NA	NA	NA
AOY63373.1|2092992_2094171_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	43.7	4.5e-82
2097050:2097064	attR	GATCAGGTCGGCGAT	NA	NA	NA	NA
>prophage 5
CP017188	Xanthomonas citri pv. glycines str. 8ra chromosome, complete genome	5364156	2592935	2600887	5364156	capsid,coat	Xanthomonas_phage(63.64%)	15	NA	NA
AOY63036.2|2592935_2593625_+	hypothetical protein	NA	A0A1D6ZIU8	Xanthomonas_phage	44.1	3.8e-25
AOY63035.2|2593629_2593992_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	37.7	8.2e-11
AZB52557.1|2594381_2594870_-	hypothetical protein	NA	A0A077JCZ5	Xanthomonas_phage	94.6	8.0e-62
AOY63033.1|2594997_2595222_+	hypothetical protein	NA	A0A1W6DXK4	Xanthomonas_phage	89.9	8.0e-25
AOY63032.1|2595384_2595564_+	hypothetical protein	NA	NA	NA	NA	NA
AOY63031.1|2595556_2596663_+	replication protein	NA	S0F3I3	Stenotrophomonas_phage	75.1	1.0e-160
AOY63030.1|2596659_2596956_+	single-stranded DNA-binding protein	NA	B1NI78	Stenotrophomonas_phage	65.6	1.5e-26
AZB52558.1|2596987_2597119_+|coat	coat protein	coat	NA	NA	NA	NA
AZB52559.1|2597094_2597211_+	hypothetical protein	NA	NA	NA	NA	NA
AOY63028.1|2597239_2597368_+|capsid	capsid protein	capsid	NA	NA	NA	NA
AOY63026.1|2598256_2598496_+	hypothetical protein	NA	Q9XJ91	Xanthomonas_phage	97.5	7.4e-37
AOY63025.1|2598506_2598827_+|coat	phage coat protein	coat	Q4LAU3	Stenotrophomonas_phage	46.2	1.5e-21
AOY63024.1|2598828_2600151_+	hypothetical protein	NA	Q4LAU4	Stenotrophomonas_phage	55.2	2.4e-129
AOY63023.1|2600170_2600482_-	chloride channel protein	NA	A0A1W6DXV7	Xanthomonas_phage	89.3	2.1e-47
AOY63022.1|2600548_2600887_-	hypothetical protein	NA	Q38057	Xanthomonas_phage	81.2	7.1e-49
>prophage 6
CP017188	Xanthomonas citri pv. glycines str. 8ra chromosome, complete genome	5364156	2715515	2755284	5364156	transposase,integrase,plate	uncultured_Caudovirales_phage(50.0%)	34	2722664:2722680	2756637:2756653
AOY62945.1|2715515_2716478_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AZB52566.1|2716946_2718215_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AZB52567.1|2718208_2718871_+	N-acetyltransferase	NA	NA	NA	NA	NA
AZB52568.1|2718873_2719290_+	NUDIX domain-containing protein	NA	A0A1Q2U351	Vibrio_phage	52.7	1.2e-05
AZB52569.1|2719286_2719892_+	hypothetical protein	NA	NA	NA	NA	NA
AZB52570.1|2719911_2721258_+	MFS transporter	NA	NA	NA	NA	NA
AOY62944.1|2721418_2721865_+	TIGR03757 family integrating conjugative element protein	NA	NA	NA	NA	NA
AOY62943.1|2721861_2722818_+	TIGR03756 family integrating conjugative element protein	NA	NA	NA	NA	NA
2722664:2722680	attL	CGCTGTCCTCGTCCTGC	NA	NA	NA	NA
AOY62942.1|2722828_2724223_+	integrating conjugative element protein	NA	NA	NA	NA	NA
AOY62941.1|2724219_2724567_+	hypothetical protein	NA	NA	NA	NA	NA
AOY62940.1|2724582_2726100_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AOY62939.1|2726111_2726477_-	DUF3742 domain-containing protein	NA	NA	NA	NA	NA
AOY62938.1|2726562_2727195_-	hypothetical protein	NA	NA	NA	NA	NA
AOY62937.2|2727207_2727834_-|integrase	integrase	integrase	NA	NA	NA	NA
AOY62936.1|2728149_2730075_+	hypothetical protein	NA	NA	NA	NA	NA
AOY62935.1|2730119_2730518_-	hypothetical protein	NA	NA	NA	NA	NA
AOY62934.1|2730519_2731551_-	hypothetical protein	NA	NA	NA	NA	NA
AOY62933.1|2731865_2732738_-	hypothetical protein	NA	NA	NA	NA	NA
AZB52571.1|2732712_2734905_-	Rhs element Vgr protein	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.0	2.1e-24
AOY62932.1|2734907_2735804_-	hypothetical protein	NA	NA	NA	NA	NA
AOY64891.1|2735811_2736423_-	hypothetical protein	NA	NA	NA	NA	NA
AOY64890.2|2739088_2740036_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AOY62931.1|2740048_2742802_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.0	1.1e-38
AOY62930.1|2742894_2743248_-	hypothetical protein	NA	NA	NA	NA	NA
AOY62929.1|2743279_2746018_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	29.6	1.2e-90
AOY62928.1|2746103_2747195_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AOY62927.1|2747158_2748994_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AOY62926.1|2748996_2749485_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AOY62925.1|2749632_2750130_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AOY62924.1|2750271_2751768_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AOY62923.1|2751771_2752272_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AOY64889.1|2752317_2752806_-	hypothetical protein	NA	NA	NA	NA	NA
AOY62922.1|2753188_2753797_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AOY62921.1|2753949_2755284_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
2756637:2756653	attR	GCAGGACGAGGACAGCG	NA	NA	NA	NA
>prophage 7
CP017188	Xanthomonas citri pv. glycines str. 8ra chromosome, complete genome	5364156	3807151	3926117	5364156	integrase,portal,transposase,tRNA,terminase,capsid,tail,plate,head,holin	Stenotrophomonas_phage(44.68%)	117	3848144:3848188	3886171:3886215
AOY62149.1|3807151_3807871_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AOY62148.1|3807884_3809909_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.0	6.7e-94
AOY62147.1|3810182_3810707_-	hypothetical protein	NA	NA	NA	NA	NA
AOY62146.1|3810720_3813165_-	penicillin-binding protein 1B	NA	NA	NA	NA	NA
AOY62145.1|3813404_3815489_+	glycosyl transferase	NA	NA	NA	NA	NA
AZB52605.1|3815497_3815830_-	hypothetical protein	NA	NA	NA	NA	NA
AOY62144.1|3815845_3817288_-	hypothetical protein	NA	NA	NA	NA	NA
AOY64837.1|3817549_3819736_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
AZB52606.1|3820026_3820107_+	pyrroloquinoline quinone precursor peptide PqqA	NA	NA	NA	NA	NA
AOY62143.1|3820190_3821090_+	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
AOY62142.1|3821086_3821839_+	pyrroloquinoline-quinone synthase	NA	NA	NA	NA	NA
AOY62141.1|3821835_3822114_+	pyrroloquinoline quinone biosynthesis protein PqqD	NA	NA	NA	NA	NA
AOY62140.1|3822110_3823229_+	coenzyme PQQ synthesis protein E	NA	NA	NA	NA	NA
AOY62139.1|3823291_3823804_+	hypothetical protein	NA	NA	NA	NA	NA
AOY62138.1|3824240_3825755_+	PhoPQ-regulated protein	NA	NA	NA	NA	NA
AOY62137.1|3826055_3827090_+	glucokinase	NA	NA	NA	NA	NA
AOY62136.1|3827190_3829827_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AOY62135.1|3830043_3834165_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SDF7	Indivirus	28.4	2.0e-44
AOY62134.1|3834267_3834816_+	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	32.4	1.5e-16
AZB52607.1|3834920_3835106_-	hypothetical protein	NA	NA	NA	NA	NA
AOY62133.1|3835296_3837093_+	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.3	1.5e-81
AOY62132.1|3837231_3837729_+	hypothetical protein	NA	NA	NA	NA	NA
AOY62131.1|3837807_3838212_+	response regulator	NA	NA	NA	NA	NA
AOY62130.1|3839477_3839588_+	hypothetical protein	NA	NA	NA	NA	NA
AOY62129.1|3839679_3840390_-	RNA-binding protein	NA	NA	NA	NA	NA
AOY62128.1|3840598_3840805_+	hypothetical protein	NA	NA	NA	NA	NA
AZB52608.1|3840956_3841271_-	hypothetical protein	NA	NA	NA	NA	NA
AOY62127.1|3841315_3843484_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
AOY64836.1|3843849_3844476_-	amino acid transporter	NA	NA	NA	NA	NA
AOY62126.1|3844577_3845480_+	LysR family transcriptional regulator ArgP	NA	NA	NA	NA	NA
AOY62125.1|3845752_3846112_-	response regulator	NA	NA	NA	NA	NA
AOY62124.1|3846108_3847116_-	PAS domain S-box protein	NA	NA	NA	NA	NA
AOY62123.1|3847390_3848065_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A088F6S9	Vibrio_phage	33.8	4.1e-24
3848144:3848188	attL	CTTTTAATCTTTTGGTCGATGGTTCGAATCCATCACGGCCCACCA	NA	NA	NA	NA
AOY62122.1|3848333_3849533_-|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	53.5	2.3e-118
AOY62121.2|3849532_3849793_-	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	58.3	2.2e-18
AOY62120.1|3849750_3849957_-	hypothetical protein	NA	NA	NA	NA	NA
AOY62119.1|3849953_3850226_-	hypothetical protein	NA	NA	NA	NA	NA
AOY62118.1|3850222_3850468_-	hypothetical protein	NA	NA	NA	NA	NA
AOY62117.1|3850464_3850740_-	hypothetical protein	NA	NA	NA	NA	NA
AOY62116.1|3850901_3851312_-	hypothetical protein	NA	NA	NA	NA	NA
AOY62115.1|3851390_3851654_-	hypothetical protein	NA	NA	NA	NA	NA
AOY62114.2|3851650_3851875_-	hypothetical protein	NA	NA	NA	NA	NA
AOY62113.1|3851925_3852144_-	hypothetical protein	NA	NA	NA	NA	NA
AOY62112.2|3852437_3855101_-	bifunctional DNA primase/helicase	NA	V9IQW5	Stenotrophomonas_phage	69.9	0.0e+00
AOY62111.1|3855128_3855368_-	hypothetical protein	NA	NA	NA	NA	NA
AZB52703.1|3855364_3855490_-	hypothetical protein	NA	NA	NA	NA	NA
AZB52609.1|3855668_3855980_-	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	57.0	5.0e-25
AZB52610.1|3855986_3856241_-	DNA-binding protein	NA	A0A1B0VRL1	Pseudomonas_phage	46.7	2.2e-07
AOY62109.1|3856307_3856736_+	XRE family transcriptional regulator	NA	A4JWR8	Burkholderia_virus	42.8	1.4e-17
AZB52611.1|3857042_3857507_-	hypothetical protein	NA	NA	NA	NA	NA
AZB52612.1|3857511_3857850_-	DUF4325 domain-containing protein	NA	A0A2H4J4X6	uncultured_Caudovirales_phage	32.0	1.8e-07
AZB52613.1|3857815_3858763_-	hypothetical protein	NA	NA	NA	NA	NA
AOY62108.1|3859049_3860036_-	phage late control D family protein	NA	V9IQM7	Stenotrophomonas_phage	55.1	4.0e-92
AOY62107.1|3860032_3860434_-	oxidoreductase	NA	V9IQX3	Stenotrophomonas_phage	59.1	2.5e-37
AOY62106.1|3860446_3863317_-|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	46.6	5.2e-185
AZB52614.1|3863346_3863460_-|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
AOY62105.1|3863468_3863771_-|tail	phage tail assembly protein	tail	V9IQM4	Stenotrophomonas_phage	66.3	1.4e-24
AOY62104.1|3863816_3864326_-|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	78.1	5.8e-71
AOY62103.1|3864356_3865523_-|tail	phage tail protein	tail	E5FFG9	Burkholderia_phage	64.5	2.6e-135
AOY62102.1|3865534_3865894_-|plate	baseplate assembly protein	plate	V9IQW0	Stenotrophomonas_phage	64.4	1.6e-35
AOY62101.1|3865890_3866454_-|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	48.6	7.4e-27
AOY62100.2|3866532_3866808_-	hypothetical protein	NA	NA	NA	NA	NA
AOY62099.1|3866761_3867967_-|tail	phage tail protein	tail	A0A1S5NTG6	Burkholderia_phage	46.2	9.6e-32
AOY62098.2|3867970_3868519_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	52.6	7.9e-50
AOY62097.1|3868511_3869402_-|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	53.7	4.7e-84
AZB52615.1|3869808_3870111_-	hypothetical protein	NA	NA	NA	NA	NA
AZB52616.1|3870293_3871118_-	hypothetical protein	NA	NA	NA	NA	NA
AOY62096.1|3871290_3871746_-	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	59.0	1.3e-37
AOY62095.1|3871733_3872153_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	64.4	7.4e-40
AOY62094.1|3872149_3872638_-	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	52.4	5.8e-28
AOY62093.2|3872637_3873279_-	lysozyme	NA	V9IQK6	Stenotrophomonas_phage	60.9	1.3e-48
AOY62092.1|3873275_3873551_-|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	59.8	1.3e-21
AOY62091.1|3873543_3873900_-	hypothetical protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	5.9e-22
AOY62090.1|3873904_3874114_-|tail	phage tail protein	tail	K4PAW7	Burkholderia_phage	59.4	7.0e-15
AOY62089.1|3874113_3874581_-|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	50.3	1.4e-31
AOY62088.1|3874679_3875399_-|terminase	terminase	terminase	Q9ZXM2	Pseudomonas_virus	62.5	1.0e-68
AOY62087.1|3875402_3876419_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	71.1	8.4e-138
AOY62086.1|3876465_3877308_-|capsid	phage capsid protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	52.7	1.4e-66
AOY62085.1|3877429_3879214_+|terminase	terminase	terminase	V9IQL5	Stenotrophomonas_phage	76.8	6.6e-271
AOY62084.1|3879213_3880236_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	71.8	3.1e-140
AZB52617.1|3880261_3880507_+	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	51.2	4.1e-14
AOY62082.1|3880424_3881120_+	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	77.8	1.1e-107
AOY62081.2|3881151_3881619_-	DUF4411 domain-containing protein	NA	NA	NA	NA	NA
AOY62080.1|3881618_3882845_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
AOY62079.1|3884851_3885337_-	peptidase S24	NA	A0A218MND2	uncultured_virus	38.7	1.1e-13
AZB52618.1|3885680_3886016_+	hypothetical protein	NA	NA	NA	NA	NA
AOY62078.1|3886452_3887136_-	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	41.0	3.0e-38
3886171:3886215	attR	CTTTTAATCTTTTGGTCGATGGTTCGAATCCATCACGGCCCACCA	NA	NA	NA	NA
AOY62077.1|3887178_3887997_-	tol-pal system protein YbgF	NA	NA	NA	NA	NA
AOY62076.1|3888003_3888522_-	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
AOY62075.1|3888579_3889899_-	protein TolB	NA	NA	NA	NA	NA
AOY62074.1|3890084_3891125_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
AOY62073.1|3891114_3891564_-	protein TolR	NA	NA	NA	NA	NA
AOY62072.1|3891721_3892501_-	protein TolQ	NA	NA	NA	NA	NA
AOY62071.1|3892512_3892971_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
AOY62070.1|3893023_3894064_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	28.2	2.7e-06
AZB52619.1|3894103_3894334_-	hypothetical protein	NA	NA	NA	NA	NA
AOY62069.1|3894336_3896241_-	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	33.7	3.7e-78
AOY62068.1|3896437_3897022_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AOY62067.1|3897140_3897665_-	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
AOY62066.1|3897794_3898523_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AOY62065.1|3898612_3899290_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AOY62064.1|3899387_3899915_-	N-acetyltransferase	NA	NA	NA	NA	NA
AOY62063.1|3900337_3902104_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AOY62062.1|3902262_3903006_+	DUF3011 domain-containing protein	NA	NA	NA	NA	NA
AOY62061.1|3903954_3904239_+	hypothetical protein	NA	NA	NA	NA	NA
AOY64835.1|3904396_3904936_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	34.9	9.6e-24
AOY62060.2|3905208_3906311_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	7.7e-44
AOY62059.2|3907324_3908469_-|transposase	IS3-like element ISXac3 family transposase	transposase	U5P429	Shigella_phage	59.6	5.6e-90
AOY64832.2|3909018_3909414_-	NYN domain-containing protein	NA	NA	NA	NA	NA
AOY62058.1|3909799_3913294_+	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
AOY62057.1|3913601_3914132_-	hypothetical protein	NA	NA	NA	NA	NA
AOY62056.2|3914282_3915427_-|transposase	IS3-like element ISXac3 family transposase	transposase	U5P429	Shigella_phage	59.6	5.6e-90
AOY64830.2|3915976_3916372_-	NYN domain-containing protein	NA	NA	NA	NA	NA
AOY62055.2|3916757_3919946_+	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
AOY62054.2|3920253_3920745_-	hypothetical protein	NA	NA	NA	NA	NA
AZB52704.1|3922308_3923856_-	outer protein C	NA	NA	NA	NA	NA
AOY62051.1|3925154_3926117_+|transposase	IS1595-like element IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 8
CP017188	Xanthomonas citri pv. glycines str. 8ra chromosome, complete genome	5364156	4447792	4459562	5364156		Enterobacteria_phage(37.5%)	11	NA	NA
AOY61711.1|4447792_4449139_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	27.1	7.5e-33
AOY61710.1|4449185_4450589_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.0	6.5e-48
AOY61709.1|4450871_4452038_-	nucleotide sugar dehydrogenase	NA	M1HZB2	Paramecium_bursaria_Chlorella_virus	58.1	2.7e-116
AOY61708.1|4452378_4453278_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.7	4.1e-27
AOY61707.1|4453274_4453832_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	48.9	6.6e-44
AOY61706.1|4453828_4454716_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	57.5	8.5e-94
AOY61705.1|4454767_4455823_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.4	8.0e-83
AOY61704.1|4456042_4456789_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
AOY61703.1|4456788_4457733_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
AOY61702.1|4457896_4458625_+	hypothetical protein	NA	NA	NA	NA	NA
AOY61701.1|4458605_4459562_+	glycosyltransferase	NA	A0A192Y8W7	Salmonella_phage	27.1	1.8e-25
