The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP017038	Tannerella sp. oral taxon BU063, complete genome	2973544	1881750	1963740	2973544	integrase	unidentified_phage(38.46%)	59	1894064:1894087	1964822:1964845
AOH41014.1|1881750_1882980_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	31.6	4.7e-26
AOH41015.1|1882992_1884207_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AOH41016.1|1885572_1887930_+	T9SS C-terminal target domain-containing protein	NA	A0A2H4PQH1	Staphylococcus_phage	23.5	8.5e-08
AOH41941.1|1888348_1888795_-	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
AOH41017.1|1888947_1889256_-	DNA-binding protein	NA	NA	NA	NA	NA
AOH41018.1|1889259_1889529_-	DNA-binding protein	NA	NA	NA	NA	NA
AOH41019.1|1890312_1890717_+	hypothetical protein	NA	NA	NA	NA	NA
AOH41020.1|1890700_1891696_+	mobilization protein	NA	NA	NA	NA	NA
AWB15238.1|1892911_1893136_-	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
AOH41022.1|1893370_1893640_+	DNA-binding protein	NA	NA	NA	NA	NA
1894064:1894087	attL	TCGCTATTCTTTGATCCGCCCGCA	NA	NA	NA	NA
AOH41942.1|1894096_1894534_+	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
AOH41024.1|1895470_1895770_-	hypothetical protein	NA	NA	NA	NA	NA
AOH41025.1|1895901_1896849_-	hypothetical protein	NA	NA	NA	NA	NA
AOH41026.1|1902591_1903806_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	30.5	1.1e-19
AOH41027.1|1903822_1905052_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	33.2	3.9e-28
AOH41028.1|1905607_1906687_+	mannose-1-phosphate guanylyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	1.1e-29
AOH41029.1|1906739_1907972_+	hypothetical protein	NA	NA	NA	NA	NA
AOH41030.1|1907971_1908436_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
AOH41032.2|1908972_1909518_+	hypothetical protein	NA	NA	NA	NA	NA
AOH41033.1|1910091_1910409_+	hypothetical protein	NA	NA	NA	NA	NA
AOH41943.1|1910610_1911549_+	nitronate monooxygenase	NA	NA	NA	NA	NA
AOH41034.1|1911795_1912410_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
AOH41035.1|1912421_1912643_-	hypothetical protein	NA	NA	NA	NA	NA
AOH41036.1|1912782_1914237_+	aminoacyl-histidine dipeptidase	NA	NA	NA	NA	NA
AOH41944.1|1914299_1915823_+	hypothetical protein	NA	NA	NA	NA	NA
AWB15188.1|1915958_1916231_+	hypothetical protein	NA	NA	NA	NA	NA
AOH41037.1|1916526_1917813_-	MFS transporter	NA	NA	NA	NA	NA
AOH41038.1|1917954_1919451_-	sodium:solute symporter	NA	NA	NA	NA	NA
AOH41945.2|1919447_1920767_-	SpoIID/LytB domain-containing protein	NA	NA	NA	NA	NA
AOH41040.1|1921774_1923097_-	TolC family protein	NA	NA	NA	NA	NA
AOH41041.1|1923093_1924236_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AOH41042.1|1924436_1925693_-	ABC transporter permease	NA	NA	NA	NA	NA
AOH41043.1|1925782_1927048_-	multidrug ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AOH41044.1|1927153_1927822_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.2	4.8e-33
AOH41045.1|1928032_1928929_-	hypothetical protein	NA	NA	NA	NA	NA
AOH41046.1|1929102_1930623_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	29.6	6.3e-12
AOH41047.1|1931288_1933559_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	36.3	8.0e-96
AOH41048.1|1933625_1934297_+	NYN domain-containing protein	NA	NA	NA	NA	NA
AOH41049.1|1934392_1934716_+	hypothetical protein	NA	NA	NA	NA	NA
AOH41946.2|1934854_1935487_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AOH41050.1|1936185_1937031_+	hypothetical protein	NA	NA	NA	NA	NA
AOH41051.2|1937507_1937846_+	hypothetical protein	NA	NA	NA	NA	NA
AOH41947.2|1938084_1940904_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AOH41052.1|1940925_1942197_+	hypothetical protein	NA	NA	NA	NA	NA
AOH41053.1|1942695_1943139_+	hypothetical protein	NA	NA	NA	NA	NA
AOH41054.1|1943297_1943810_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	C7F482	Cyanophage	32.1	1.7e-09
AOH41055.1|1943825_1944368_+	DUF488 domain-containing protein	NA	A0A2K9L455	Tupanvirus	47.2	9.6e-32
AOH41056.1|1944454_1947256_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AOH41057.1|1947497_1947956_+	hypothetical protein	NA	NA	NA	NA	NA
AOH41058.1|1948425_1949763_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	36.4	5.3e-55
AOH41059.2|1950041_1953158_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AOH41060.2|1953174_1954614_+	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
AOH41061.1|1955057_1957097_-	HDIG domain-containing protein	NA	NA	NA	NA	NA
AOH41062.1|1957518_1958505_-	mobilization protein	NA	NA	NA	NA	NA
AWB15189.1|1960482_1960614_-	hypothetical protein	NA	NA	NA	NA	NA
AWB15190.1|1960656_1960866_-	hypothetical protein	NA	NA	NA	NA	NA
AOH41063.2|1960821_1961061_+	hypothetical protein	NA	NA	NA	NA	NA
AOH41064.1|1961202_1962456_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	32.9	7.9e-29
AOH41065.1|1962468_1963740_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	32.3	1.2e-16
1964822:1964845	attR	TCGCTATTCTTTGATCCGCCCGCA	NA	NA	NA	NA
>prophage 2
CP017038	Tannerella sp. oral taxon BU063, complete genome	2973544	2895715	2933878	2973544	transposase,protease,integrase	unidentified_phage(42.86%)	29	2901786:2901804	2941725:2941743
AWB15218.1|2895715_2896507_+|protease	serine protease	protease	NA	NA	NA	NA
AWB15219.1|2896779_2897028_-|transposase	transposase	transposase	NA	NA	NA	NA
AWB15220.1|2897517_2897745_+	hypothetical protein	NA	NA	NA	NA	NA
AOH41756.1|2897961_2899161_-	MFS transporter	NA	NA	NA	NA	NA
AOH41757.1|2899277_2900066_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AWB15221.1|2900282_2901026_+	T9SS C-terminal target domain-containing protein	NA	NA	NA	NA	NA
AOH42006.1|2901456_2901897_-	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
2901786:2901804	attL	CTGCGGGCGGATCAAAGAA	NA	NA	NA	NA
AOH41758.1|2902049_2902358_-	DNA-binding protein	NA	NA	NA	NA	NA
AOH41759.1|2902361_2902631_-	DNA-binding protein	NA	NA	NA	NA	NA
AOH41760.1|2903045_2904317_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	31.7	5.4e-17
AOH41761.1|2904332_2905586_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	33.3	2.7e-29
AOH41762.1|2906352_2909703_-	hypothetical protein	NA	A0A248SL14	Klebsiella_phage	27.2	1.3e-46
AOH41763.1|2910027_2911095_-	DUF4099 domain-containing protein	NA	NA	NA	NA	NA
AOH41764.1|2911240_2911501_-	hypothetical protein	NA	NA	NA	NA	NA
AOH41765.1|2912591_2913293_-	hypothetical protein	NA	NA	NA	NA	NA
AOH41766.1|2913420_2914173_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AWB15222.1|2915044_2916043_-	mobilization protein	NA	NA	NA	NA	NA
AOH42007.1|2916003_2917824_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.9	2.5e-31
AOH41768.1|2918692_2920378_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	48.0	7.2e-142
AWB15223.1|2921010_2921934_-	hypothetical protein	NA	NA	NA	NA	NA
AOH41769.1|2923480_2923861_-	hypothetical protein	NA	NA	NA	NA	NA
AOH42008.1|2924430_2925219_+	ParA family protein	NA	NA	NA	NA	NA
AOH41770.1|2925215_2925737_+	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
AOH42009.1|2925757_2926432_+	hypothetical protein	NA	NA	NA	NA	NA
AOH42010.2|2926612_2926891_+	DUF4134 domain-containing protein	NA	NA	NA	NA	NA
AOH41771.1|2926890_2927226_+	DUF4133 domain-containing protein	NA	NA	NA	NA	NA
AWB15224.1|2928431_2928617_-	hypothetical protein	NA	NA	NA	NA	NA
AOH41773.1|2928662_2930345_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	50.4	2.5e-142
AOH41774.1|2932639_2933878_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	30.0	2.1e-26
2941725:2941743	attR	CTGCGGGCGGATCAAAGAA	NA	NA	NA	NA
