The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP012375	Microcystis aeruginosa NIES-2481, complete genome	4293006	3583463	3642238	4293006	transposase	Bodo_saltans_virus(25.0%)	55	NA	NA
AOC54379.1|3583463_3584048_-|transposase	transposase	transposase	NA	NA	NA	NA
AOC54380.1|3584067_3584223_-|transposase	transposase	transposase	NA	NA	NA	NA
AOC54381.1|3584271_3584430_-|transposase	transposase	transposase	NA	NA	NA	NA
AOC54382.1|3584736_3586131_-	hypothetical protein	NA	NA	NA	NA	NA
AOC54383.1|3586570_3588274_-	Sulfate permease	NA	NA	NA	NA	NA
AOC54384.1|3588573_3590538_-	Lycopene cyclase, CruA type	NA	NA	NA	NA	NA
AOC54385.1|3590683_3590926_+	hypothetical protein	NA	NA	NA	NA	NA
AOC54386.1|3590933_3591749_+	hypothetical protein	NA	NA	NA	NA	NA
AOC54387.1|3592745_3593807_-	Putative transport system permease protein	NA	NA	NA	NA	NA
AOC54388.1|3594009_3594318_+	Cytochrome c, class I	NA	NA	NA	NA	NA
AOC54389.1|3594657_3596811_+	hypothetical protein	NA	NA	NA	NA	NA
AOC54390.1|3596828_3598994_+	hypothetical protein	NA	NA	NA	NA	NA
AOC54391.1|3599006_3599540_+	hypothetical protein	NA	NA	NA	NA	NA
AOC54392.1|3599578_3600022_+	Mobile element protein	NA	NA	NA	NA	NA
AOC54393.1|3599976_3600471_+	Mobile element protein	NA	A0A2H4UV16	Bodo_saltans_virus	34.9	1.4e-13
AOC54394.1|3600794_3602021_-	Transposase	NA	A9YX10	Burkholderia_phage	26.8	1.6e-26
AOC54395.1|3604511_3604670_+	hypothetical protein	NA	NA	NA	NA	NA
AOC54396.1|3607558_3607690_+	hypothetical protein	NA	NA	NA	NA	NA
AOC54397.1|3607916_3609065_-	Mobile element protein	NA	NA	NA	NA	NA
AOC54398.1|3610024_3611521_+|transposase	transposase	transposase	NA	NA	NA	NA
AOC54399.1|3612664_3612799_+	hypothetical protein	NA	NA	NA	NA	NA
AOC54400.1|3613727_3614000_-	CRISPR-associated protein Cas2	NA	NA	NA	NA	NA
AOC54401.1|3614012_3615017_-	CRISPR-associated protein Cas1	NA	NA	NA	NA	NA
AOC54402.1|3615022_3615616_-	CRISPR-associated RecB family exonuclease Cas4	NA	NA	NA	NA	NA
AOC54403.1|3615618_3616452_-	CRISPR repeat RNA endoribonuclease Cas6	NA	NA	NA	NA	NA
AOC54404.1|3616451_3617018_-	Protein of unknown function DUF820	NA	NA	NA	NA	NA
AOC54405.1|3617058_3619794_-	CRISPR-associated helicase Cas3	NA	NA	NA	NA	NA
AOC54406.1|3619786_3620476_-	hypothetical protein	NA	NA	NA	NA	NA
AOC54407.1|3620614_3621508_-	hypothetical protein	NA	NA	NA	NA	NA
AOC54408.1|3621510_3624042_-	hypothetical protein	NA	NA	NA	NA	NA
AOC54409.1|3624129_3624294_-	hypothetical protein	NA	NA	NA	NA	NA
AOC54410.1|3624829_3625687_+	hypothetical protein	NA	NA	NA	NA	NA
AOC54411.1|3625795_3626158_+	Mobile element protein	NA	NA	NA	NA	NA
AOC54412.1|3626177_3626762_+|transposase	transposase	transposase	NA	NA	NA	NA
AOC54413.1|3626853_3627276_+	Pterin-binding family	NA	NA	NA	NA	NA
AOC54414.1|3627561_3628425_-	High-affinity branched-chain amino acid transport system permease protein LivH	NA	NA	NA	NA	NA
AOC54415.1|3628695_3629205_+	pentapeptide repeat protein	NA	NA	NA	NA	NA
AOC54416.1|3629204_3630329_+	Phosphoribosylaminoimidazole carboxylase ATPase subunit	NA	NA	NA	NA	NA
AOC54417.1|3630464_3631403_-	hypothetical protein	NA	NA	NA	NA	NA
AOC54418.1|3631544_3632657_-	Mobile element protein	NA	A0A0R8V9X2	Thermobifida_phage	61.0	1.1e-122
AOC54419.1|3632767_3632902_+	hypothetical protein	NA	NA	NA	NA	NA
AOC54420.1|3632858_3632984_-	hypothetical protein	NA	NA	NA	NA	NA
AOC54421.1|3633284_3635276_+	sensory transduction histidine kinase	NA	A0A1V0SGX0	Hokovirus	31.2	8.8e-22
AOC54422.1|3635546_3636752_+	Argininosuccinate synthase	NA	NA	NA	NA	NA
AOC54423.1|3636947_3637067_+	fdxN element excision controlling factor protein	NA	NA	NA	NA	NA
AOC54424.1|3637147_3637363_+	FdxN element excision controlling factor protein	NA	NA	NA	NA	NA
AOC54425.1|3637350_3637692_+	XisI protein-like	NA	NA	NA	NA	NA
AOC54426.1|3637841_3638228_+	hypothetical protein	NA	NA	NA	NA	NA
AOC54427.1|3638493_3638649_-	hypothetical protein	NA	NA	NA	NA	NA
AOC54428.1|3638700_3639396_+	hypothetical protein	NA	NA	NA	NA	NA
AOC54429.1|3639507_3639708_+	hypothetical protein	NA	NA	NA	NA	NA
AOC54430.1|3640042_3640186_-	hypothetical protein	NA	NA	NA	NA	NA
AOC54431.1|3640184_3640994_+	GMP synthase	NA	NA	NA	NA	NA
AOC54432.1|3641099_3641717_-	Mobile element protein	NA	NA	NA	NA	NA
AOC54433.1|3641788_3642238_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
CP025929	Microcystis aeruginosa NIES-2481 plasmid p1, complete sequence	147539	95205	143606	147539	transposase,integrase	Thalassomonas_phage(13.33%)	50	129921:129949	142222:142250
AUS35910.1|95205_96354_+|transposase	transposase	transposase	NA	NA	NA	NA
AUS35911.1|96334_97954_+	hypothetical protein	NA	E7DNC5	Pneumococcus_phage	29.7	1.2e-24
AUS35912.1|97950_98214_-	hypothetical protein	NA	NA	NA	NA	NA
AUS35913.1|98203_98551_-	hypothetical protein	NA	NA	NA	NA	NA
AUS35914.1|98771_99677_+	hypothetical protein	NA	NA	NA	NA	NA
AUS35915.1|99828_103542_+	hypothetical protein	NA	NA	NA	NA	NA
AUS35916.1|103767_104319_+	hypothetical protein	NA	NA	NA	NA	NA
AUS35917.1|104333_105062_+	hypothetical protein	NA	NA	NA	NA	NA
AUS35918.1|107220_109008_-|transposase	transposase	transposase	A0A2H4PB66	Aphanizomenon_phage	34.9	5.4e-55
AUS35919.1|109150_109300_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AUS35920.1|109432_110119_+	hypothetical protein	NA	NA	NA	NA	NA
AUS35921.1|110124_110316_+	hypothetical protein	NA	NA	NA	NA	NA
AUS35922.1|110567_110750_-	hypothetical protein	NA	NA	NA	NA	NA
AUS35923.1|110828_111497_-	hypothetical protein	NA	NA	NA	NA	NA
AUS35924.1|111658_111877_+	hypothetical protein	NA	NA	NA	NA	NA
AUS35925.1|112166_112508_+	hypothetical protein	NA	U5XK15	Phormidium_phage	40.4	1.2e-16
AUS35926.1|112579_113662_+	hypothetical protein	NA	NA	NA	NA	NA
AUS35927.1|113724_114096_+	hypothetical protein	NA	NA	NA	NA	NA
AUS35928.1|114649_115000_+	hypothetical protein	NA	A0A2I7S0C0	Vibrio_phage	51.8	1.4e-28
AUS35929.1|115458_115932_+	hypothetical protein	NA	NA	NA	NA	NA
AUS35930.1|116112_116778_+	hypothetical protein	NA	NA	NA	NA	NA
AUS35931.1|117281_117548_+	hypothetical protein	NA	NA	NA	NA	NA
AUS35932.1|117614_118514_+	hypothetical protein	NA	A0A1V0EEV1	Caulobacter_phage	32.1	1.4e-35
AUS35933.1|118639_119311_+	hypothetical protein	NA	A0A2H4GYA3	Pseudomonas_phage	42.3	8.0e-44
AUS35934.1|119434_120262_+	SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	40.4	1.4e-18
AUS35935.1|120252_121425_-|transposase	transposase	transposase	A0A7P9	Microcystis_virus	97.4	4.4e-215
AUS35936.1|121402_122011_-	MerR family DNA-binding transcriptional regulator	NA	A0A7Q0	Microcystis_virus	98.5	4.6e-107
AUS35937.1|122073_122328_+	hypothetical protein	NA	A8HNV9	Thalassomonas_phage	39.3	1.3e-10
AUS35938.1|122474_122804_+	hypothetical protein	NA	NA	NA	NA	NA
AUS35939.1|123123_123501_+	hypothetical protein	NA	NA	NA	NA	NA
AUS35940.1|123621_123840_+	hypothetical protein	NA	NA	NA	NA	NA
AUS35941.1|124173_124533_+	hypothetical protein	NA	NA	NA	NA	NA
AUS35942.1|124638_124818_+	hypothetical protein	NA	NA	NA	NA	NA
AUS35943.1|125021_125543_+	prepilin-type cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
AUS35944.1|125603_125867_+	hypothetical protein	NA	NA	NA	NA	NA
AUS35945.1|126414_127548_-|transposase	transposase	transposase	A0A1L2BWN4	Bacteriophage	56.9	1.5e-114
AUS35946.1|127761_128235_+	DUF29 domain-containing protein	NA	A0JC30	Ralstonia_phage	38.4	1.8e-18
AUS35947.1|128237_128840_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AUS35948.1|129043_129481_-	VapC toxin family PIN domain ribonuclease	NA	NA	NA	NA	NA
AUS35949.1|129477_129762_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
129921:129949	attL	GAACGCAAAGCGCTCGCTACGCGAGATCG	NA	NA	NA	NA
AUS35950.1|130432_133246_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	29.1	2.9e-10
AUS35951.1|133404_133746_-	transcriptional regulator	NA	NA	NA	NA	NA
AUS35952.1|134084_134381_-	hypothetical protein	NA	NA	NA	NA	NA
AUS35953.1|134367_134676_-	nucleotidyltransferase	NA	NA	NA	NA	NA
AUS35954.1|134853_135978_-|integrase	integrase	integrase	A0A1P8DJ76	Virus_Rctr85	30.8	7.9e-12
AUS35955.1|136057_136501_-	hypothetical protein	NA	NA	NA	NA	NA
AUS35956.1|136642_137605_+	NYN domain-containing protein	NA	NA	NA	NA	NA
AUS35957.1|137679_139356_-	hypothetical protein	NA	NA	NA	NA	NA
AUS35958.1|140334_142620_+	kinase	NA	U5J9W1	Bacillus_phage	34.2	1.0e-13
142222:142250	attR	GAACGCAAAGCGCTCGCTACGCGAGATCG	NA	NA	NA	NA
AUS35959.1|142616_143606_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
