The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027053	Klebsiella pneumoniae strain 2_GR_12 chromosome, complete genome	5466424	347	17153	5466424	holin,tail	Salmonella_phage(42.86%)	16	NA	NA
AZH96094.1|347_2846_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	61.2	6.4e-288
AZH96095.1|2842_4648_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	72.4	2.2e-234
AZH96096.1|4651_7126_+	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	87.0	0.0e+00
AZH96097.1|7324_7621_+	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	92.7	4.4e-47
AZH96098.1|7655_7808_-	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	85.7	1.9e-14
AZH96099.1|7897_8296_-	hypothetical protein	NA	NA	NA	NA	NA
AZH96100.1|8300_8483_-	hypothetical protein	NA	NA	NA	NA	NA
AZH96101.1|9750_9948_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M4RCZ9	Salmonella_phage	69.8	2.0e-19
AZH96102.1|9951_10209_-	DUF1902 domain-containing protein	NA	A0A0M4R2Z9	Salmonella_phage	54.1	2.3e-12
AZH96103.1|10299_10596_-	hypothetical protein	NA	T1SA06	Salmonella_phage	65.5	6.2e-25
AZH96104.1|10747_13009_+|tail	phage tail protein	tail	A0A0A8J9V7	Klebsiella_phage	35.8	3.7e-69
AZH96105.1|13271_13676_+	hypothetical protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
AZH96106.1|13662_13968_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.4	1.6e-39
AZH96107.1|13957_14587_+	endolysin	NA	Q858F0	Salmonella_phage	76.9	1.8e-90
AZH96108.1|14583_15066_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	76.9	2.8e-59
AZH96109.1|15284_17153_-	phosphatase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
>prophage 2
CP027053	Klebsiella pneumoniae strain 2_GR_12 chromosome, complete genome	5466424	347221	354128	5466424		Planktothrix_phage(33.33%)	6	NA	NA
AZI01154.1|347221_348085_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.0	1.8e-08
AZH96394.1|348095_348869_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	1.5e-25
AZI01155.1|349111_350005_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
AZH96395.1|350250_351612_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.5	2.5e-206
AZH96396.1|351930_352653_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	6.4e-31
AZH96397.1|352649_354128_-	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	28.3	1.1e-29
>prophage 3
CP027053	Klebsiella pneumoniae strain 2_GR_12 chromosome, complete genome	5466424	505030	511862	5466424	transposase	Escherichia_phage(16.67%)	7	NA	NA
AZH96524.1|505030_506011_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AZH96525.1|506174_506837_-	hypothetical protein	NA	NA	NA	NA	NA
AZH96526.1|506830_507322_-	TIR domain-containing protein	NA	A0A2H4J496	uncultured_Caudovirales_phage	45.7	1.4e-05
AZH96527.1|507343_508375_-	hypothetical protein	NA	A0A075E0Y9	Dickeya_phage	31.0	7.0e-39
AZH96528.1|508364_508922_-	adenylate kinase	NA	S6CFB8	Klebsiella_phage	31.1	7.9e-13
AZH96529.1|508918_510004_-	thymidylate synthase	NA	A0A2I7RW46	Vibrio_phage	36.1	4.7e-54
AZH96530.1|510914_511862_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	40.3	1.9e-54
>prophage 4
CP027053	Klebsiella pneumoniae strain 2_GR_12 chromosome, complete genome	5466424	1413385	1424258	5466424		Escherichia_phage(85.71%)	9	NA	NA
AZH97370.1|1413385_1416493_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
AZH97371.1|1416547_1417813_+	MFS transporter	NA	NA	NA	NA	NA
AZH97372.1|1417843_1418932_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
AZH97373.1|1419018_1419279_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
AZH97374.1|1419576_1420437_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AZH97375.1|1420457_1421219_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AZH97376.1|1421209_1421443_+	hypothetical protein	NA	NA	NA	NA	NA
AZH97377.1|1421480_1422383_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AZH97378.1|1423637_1424258_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 5
CP027053	Klebsiella pneumoniae strain 2_GR_12 chromosome, complete genome	5466424	1618585	1733109	5466424	holin,plate,transposase,terminase,lysis,tail,capsid,protease,head	Salmonella_phage(27.84%)	138	NA	NA
AZH97559.1|1618585_1619671_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AZH97560.1|1619634_1621389_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AZH97561.1|1623060_1626486_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
AZH97562.1|1626469_1627609_-	hypothetical protein	NA	NA	NA	NA	NA
AZH97563.1|1627605_1627863_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
AZH97564.1|1627907_1630325_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
AZH97565.1|1630312_1630843_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AZH97566.1|1630910_1631441_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AZH97567.1|1632106_1632637_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AZH97568.1|1632704_1633235_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AZH97569.1|1633298_1634078_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AZH97570.1|1634078_1636457_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.8	9.2e-18
AZH97571.1|1636449_1639104_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	2.5e-96
AZH97572.1|1639368_1639860_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
AZH97573.1|1639864_1641571_-	OmpA family protein	NA	NA	NA	NA	NA
AZH97574.1|1641567_1642257_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AZI01221.1|1642253_1643594_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AZH97575.1|1643606_1645151_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AZH97576.1|1645193_1645685_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AZH97577.1|1646530_1646779_+	damage-inducible protein DinI	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
AZH97578.1|1647001_1647286_-	hypothetical protein	NA	NA	NA	NA	NA
AZH97579.1|1647390_1647600_-	hypothetical protein	NA	NA	NA	NA	NA
AZH97580.1|1647596_1648328_-	hypothetical protein	NA	NA	NA	NA	NA
AZI01222.1|1648338_1649067_-	hypothetical protein	NA	NA	NA	NA	NA
AZH97581.1|1651416_1651614_-	hypothetical protein	NA	NA	NA	NA	NA
AZH97582.1|1651613_1652480_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
AZH97583.1|1652479_1653253_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
AZH97584.1|1653249_1654446_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
AZH97585.1|1654445_1654799_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
AZH97586.1|1654800_1655454_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
AZH97587.1|1655507_1656074_-	hypothetical protein	NA	NA	NA	NA	NA
AZH97588.1|1656110_1656296_+	hypothetical protein	NA	NA	NA	NA	NA
AZH97589.1|1656348_1656690_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
AZH97590.1|1656689_1657712_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
AZH97591.1|1657714_1658017_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
AZH97592.1|1658017_1658617_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
AZH97593.1|1658616_1660620_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
AZH97594.1|1660609_1660762_-	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
AZH97595.1|1660797_1661223_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
AZH97596.1|1661625_1662742_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	43.5	3.3e-50
AZH97597.1|1662683_1662974_-	DUF3277 domain-containing protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	85.5	2.6e-23
AZH97598.1|1662984_1664130_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
AZH97599.1|1664133_1664574_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
AZH97600.1|1664668_1665055_-|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
AZH97601.1|1665054_1665561_-	hypothetical protein	NA	NA	NA	NA	NA
AZH97602.1|1665557_1665977_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
AZH97603.1|1665945_1666227_-	hypothetical protein	NA	NA	NA	NA	NA
AZH97604.1|1666266_1667208_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
AZH97605.1|1667219_1667714_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
AZH97606.1|1667717_1668920_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
AZH97607.1|1668971_1669520_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
AZH97608.1|1669575_1671027_-	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
AZH97609.1|1671264_1672665_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
AZH97610.1|1672615_1673368_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
AZH97611.1|1673469_1673790_-	negative regulator GrlR	NA	NA	NA	NA	NA
AZH97612.1|1674024_1674414_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
AZH97613.1|1674410_1674941_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
AZH97614.1|1674943_1675192_-|lysis	lysis protein	lysis	NA	NA	NA	NA
AZH97615.1|1675597_1676380_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
AZH97616.1|1676376_1676853_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
AZH97617.1|1676849_1677812_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
AZH97618.1|1677813_1679472_-	helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
AZH97619.1|1679780_1680074_-	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	97.6	2.8e-38
AZH97620.1|1680048_1680270_-	XRE family transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
AZH97621.1|1680367_1681036_+	LexA family transcriptional repressor	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
AZI01223.1|1682510_1682597_-	ABC transporter	NA	NA	NA	NA	NA
AZH97622.1|1683589_1683886_+	hypothetical protein	NA	T1SA06	Salmonella_phage	65.5	8.1e-25
AZH97623.1|1684200_1684890_+	anti-repressor protein	NA	G9L6E2	Escherichia_phage	65.2	2.7e-79
AZH97624.1|1685080_1685263_+	hypothetical protein	NA	NA	NA	NA	NA
AZH97625.1|1685267_1685666_+	hypothetical protein	NA	NA	NA	NA	NA
AZH97626.1|1685736_1686135_-	hypothetical protein	NA	G9L6D8	Escherichia_phage	70.0	1.0e-38
AZH97627.1|1686542_1686908_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	83.3	7.2e-15
AZH97628.1|1686888_1687485_+	hypothetical protein	NA	G9L6D5	Escherichia_phage	43.5	4.7e-40
AZH97629.1|1687485_1690374_-	hypothetical protein	NA	G9L6D4	Escherichia_phage	67.7	0.0e+00
AZI01224.1|1690373_1692944_-	lytic transglycosylase	NA	G9L6D3	Escherichia_phage	63.6	0.0e+00
AZH97630.1|1693640_1694111_-	hypothetical protein	NA	Q858G2	Salmonella_phage	55.9	8.6e-45
AZH97631.1|1694112_1696590_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	56.4	2.3e-266
AZH97632.1|1696589_1697201_-	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.8	1.2e-46
AZH97633.1|1697249_1697528_-	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	6.7e-21
AZH97634.1|1697520_1697913_-	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
AZH97635.1|1697922_1698930_-|capsid	phage capsid protein	capsid	T1S9H9	Salmonella_phage	92.5	2.7e-181
AZH97636.1|1698942_1699341_-	peptidase	NA	T1SAP9	Salmonella_phage	59.5	5.6e-37
AZH97637.1|1699382_1699580_-	hypothetical protein	NA	NA	NA	NA	NA
AZH97638.1|1699622_1699928_-	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	1.1e-16
AZH97639.1|1699924_1701604_-|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	58.9	3.4e-192
AZH97640.1|1701607_1701811_-	hypothetical protein	NA	NA	NA	NA	NA
AZH97641.1|1701832_1702021_-	hypothetical protein	NA	NA	NA	NA	NA
AZH97642.1|1702516_1703038_+	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	55.2	7.8e-47
AZH97643.1|1703081_1704557_-|terminase	terminase	terminase	Q858H3	Salmonella_phage	92.7	3.2e-279
AZH97644.1|1704553_1705138_-|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.1	2.4e-89
AZI01225.1|1705215_1705473_-	lF-82	NA	NA	NA	NA	NA
AZH97645.1|1705547_1705886_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	4.7e-45
AZH97646.1|1705885_1706125_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	48.0	4.6e-10
AZH97647.1|1706117_1706786_-	DUF551 domain-containing protein	NA	Q6UAT8	Klebsiella_phage	52.5	1.5e-05
AZH97648.1|1706782_1706995_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
AZH97649.1|1707165_1707909_-	hypothetical protein	NA	A6N3G8	Burkholderia_virus	59.5	1.5e-19
AZH97650.1|1707905_1708331_-	hypothetical protein	NA	NA	NA	NA	NA
AZH97651.1|1708327_1708519_-	hypothetical protein	NA	NA	NA	NA	NA
AZH97652.1|1708502_1708913_-	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	42.2	3.1e-14
AZH97653.1|1709105_1709453_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	5.0e-50
AZH97654.1|1709572_1710358_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.4	8.2e-133
AZH97655.1|1710354_1711122_-	primosomal protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
AZH97656.1|1711121_1711331_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
AZH97657.1|1711477_1711711_-	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
AZH97658.1|1711864_1712446_+	XRE family transcriptional regulator	NA	Q858D7	Salmonella_phage	64.8	1.9e-65
AZI01226.1|1712859_1713762_+	hypothetical protein	NA	A0A059VK18	Pseudomonas_phage	51.6	2.8e-36
AZH97659.1|1713769_1714069_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	53.5	1.8e-19
AZH97660.1|1714065_1714887_+	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	80.2	8.1e-131
AZH97661.1|1714883_1715765_+	recombinase RecT	NA	T1SBJ5	Salmonella_phage	82.3	1.7e-131
AZH97662.1|1715813_1716062_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
AZH97663.1|1716171_1716465_+	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	70.1	1.2e-31
AZH97664.1|1716457_1716616_+	DUF1317 domain-containing protein	NA	T1SAR0	Salmonella_phage	80.4	2.5e-17
AZH97665.1|1716612_1717362_+	hypothetical protein	NA	R9VWB9	Serratia_phage	56.1	3.1e-73
AZH97666.1|1717358_1717952_+	adenine methylase	NA	T1SA14	Salmonella_phage	91.9	2.1e-109
AZH97667.1|1717948_1718140_+	hypothetical protein	NA	NA	NA	NA	NA
AZH97668.1|1718156_1719407_-	DUF4102 domain-containing protein	NA	A0A1X9TCT6	Enterobacter_phage	85.1	1.8e-206
AZH97669.1|1719723_1720206_-	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	76.9	2.8e-59
AZH97670.1|1720202_1720832_-	endolysin	NA	Q858F0	Salmonella_phage	76.9	1.8e-90
AZH97671.1|1720821_1721127_-|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.4	1.6e-39
AZH97672.1|1721113_1721518_-	hypothetical protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
AZH97673.1|1722014_1722995_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AZH97674.1|1723052_1723244_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	3.4e-08
AZH97675.1|1723236_1723425_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
AZH97676.1|1723594_1723960_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
AZH97677.1|1723952_1724207_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
AZH97678.1|1724393_1724819_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
AZH97679.1|1724815_1725010_+	hypothetical protein	NA	NA	NA	NA	NA
AZH97680.1|1725006_1725834_+|protease	serine protease	protease	Q8W654	Enterobacteria_phage	84.0	5.5e-111
AZH97681.1|1725938_1726457_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
AZH97682.1|1726462_1727173_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
AZH97683.1|1727162_1727387_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
AZH97684.1|1727383_1727596_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
AZH97685.1|1727592_1728072_+	hypothetical protein	NA	NA	NA	NA	NA
AZH97686.1|1728250_1728493_+	AlpA family transcriptional regulator	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
AZH97687.1|1728473_1729655_-	DUF4102 domain-containing protein	NA	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
AZH97688.1|1729851_1730400_+|protease	protease	protease	NA	NA	NA	NA
AZH97689.1|1730598_1732131_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
AZH97690.1|1732347_1733109_-	3-oxoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 6
CP027053	Klebsiella pneumoniae strain 2_GR_12 chromosome, complete genome	5466424	1780691	1826155	5466424	holin,transposase,terminase,tail,integrase	Enterobacteria_phage(22.92%)	60	1811324:1811339	1834163:1834178
AZH97730.1|1780691_1783760_-	kinase	NA	A0A286S259	Klebsiella_phage	97.5	0.0e+00
AZH97731.1|1783756_1784137_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
AZH97732.1|1784146_1784629_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	94.4	1.7e-80
AZH97733.1|1784809_1785274_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	6.7e-58
AZH97734.1|1785588_1785924_-	hypothetical protein	NA	NA	NA	NA	NA
AZH97735.1|1786114_1787095_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AZH97736.1|1787206_1790104_-|tail	phage tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.7	1.6e-104
AZI01230.1|1790365_1790557_-	hypothetical protein	NA	S4TR42	Salmonella_phage	78.3	7.8e-05
AZH97737.1|1790781_1791138_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
AZH97738.1|1791214_1791391_-	hypothetical protein	NA	NA	NA	NA	NA
AZH97739.1|1791558_1792041_-	hypothetical protein	NA	NA	NA	NA	NA
AZH97740.1|1792094_1793267_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
AZH97741.1|1793290_1793683_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
AZH97742.1|1793679_1794231_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	1.3e-28
AZH97743.1|1794232_1794616_-	glutamate 5-kinase	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
AZH97744.1|1794602_1794836_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
AZH97745.1|1794845_1795100_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	1.0e-20
AZH97746.1|1795101_1795497_-	protein singed	NA	A0A1B1P9F2	Acinetobacter_phage	38.5	4.3e-13
AZH97747.1|1795818_1796772_-	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
AZH97748.1|1796782_1797568_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.0e-66
AZH97749.1|1798098_1799211_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.1	5.6e-111
AZH97750.1|1799194_1800595_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	1.1e-127
AZH97751.1|1800594_1801902_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
AZH97752.1|1801879_1802884_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.5e-38
AZH97753.1|1803432_1803618_-	hypothetical protein	NA	NA	NA	NA	NA
AZH97754.1|1803746_1803992_-	DUF2560 domain-containing protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
AZH97755.1|1804805_1805000_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	89.1	1.4e-25
AZH97756.1|1804950_1805226_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
AZH97757.1|1805222_1805567_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
AZH97758.1|1805563_1806103_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
AZH97759.1|1806099_1806411_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	3.8e-49
AZH97760.1|1806877_1807924_-|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
AZI01231.1|1808149_1808839_-	antiterminator	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
AZH97761.1|1808838_1808979_-	YlcG family protein	NA	NA	NA	NA	NA
AZH97762.1|1808975_1809614_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
AZH97763.1|1809606_1810275_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
AZH97764.1|1810271_1810439_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
AZH97765.1|1810419_1810887_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
1811324:1811339	attL	CATTTTTTTGCTCGTT	NA	NA	NA	NA
AZH97766.1|1811407_1812436_+	hypothetical protein	NA	NA	NA	NA	NA
AZH97767.1|1812643_1812889_-	hypothetical protein	NA	NA	NA	NA	NA
AZH97768.1|1812944_1813247_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZH97769.1|1813243_1814092_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
AZH97770.1|1814088_1814949_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
AZH97771.1|1815034_1815256_-	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
AZH97772.1|1815296_1815524_-	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
AZH97773.1|1815635_1816334_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
AZI01232.1|1816356_1816476_+	hypothetical protein	NA	NA	NA	NA	NA
AZH97774.1|1816621_1817698_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
AZH97775.1|1817779_1817983_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
AZH97776.1|1818411_1818606_+	hypothetical protein	NA	NA	NA	NA	NA
AZH97777.1|1818694_1818979_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
AZH97778.1|1818994_1819840_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
AZH97779.1|1820125_1820806_+	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
AZH97780.1|1820802_1821231_+	regulator	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
AZH97781.1|1821227_1821890_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
AZH97782.1|1821886_1822201_+	hypothetical protein	NA	K7PM28	Enterobacteria_phage	50.8	1.6e-10
AZH97783.1|1822097_1823285_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
AZH97784.1|1823461_1824352_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
AZH97785.1|1824351_1825344_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
AZH97786.1|1825345_1826155_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
1834163:1834178	attR	AACGAGCAAAAAAATG	NA	NA	NA	NA
>prophage 7
CP027053	Klebsiella pneumoniae strain 2_GR_12 chromosome, complete genome	5466424	2203831	2296781	5466424	plate,portal,tRNA,tail,capsid,integrase,protease,head	Salmonella_phage(57.89%)	96	2259357:2259375	2296856:2296874
AZH98137.1|2203831_2205124_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
AZH98138.1|2205214_2206558_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
AZH98139.1|2206566_2207178_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AZH98140.1|2207300_2211554_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
AZH98141.1|2211689_2212184_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AZH98142.1|2212716_2213685_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
AZH98143.1|2213799_2215566_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
AZH98144.1|2215566_2217288_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
AZI01248.1|2217332_2218034_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AZH98145.1|2218387_2218606_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AZH98146.1|2218726_2221006_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AZH98147.1|2221036_2221354_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AZH98148.1|2221679_2221901_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AZH98149.1|2221855_2222038_-	hypothetical protein	NA	NA	NA	NA	NA
AZH98150.1|2221977_2223918_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AZH98151.1|2223914_2225030_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
AZH98152.1|2225176_2226835_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AZH98153.1|2227254_2227950_+	aquaporin Z	NA	NA	NA	NA	NA
AZH98154.1|2228065_2228965_+	hypothetical protein	NA	NA	NA	NA	NA
AZI01249.1|2229108_2230761_+	hydroxylamine reductase	NA	NA	NA	NA	NA
AZH98155.1|2230771_2231740_+	NADH oxidoreductase	NA	NA	NA	NA	NA
AZH98156.1|2231690_2231894_+	hypothetical protein	NA	NA	NA	NA	NA
AZH98157.1|2231951_2232386_-	DoxX family protein	NA	NA	NA	NA	NA
AZI01250.1|2232537_2234256_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
AZH98158.1|2234294_2235296_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AZH98159.1|2235306_2236749_+	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
AZH98160.1|2236836_2237850_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AZH98161.1|2237846_2238677_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
AZH98162.1|2238708_2239848_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AZH98163.1|2239900_2240080_+	hypothetical protein	NA	NA	NA	NA	NA
AZH98164.1|2240725_2241241_+	lipoprotein	NA	NA	NA	NA	NA
AZH98165.1|2241467_2242196_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
AZI01251.1|2242216_2242948_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZH98166.1|2242954_2243671_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
AZH98167.1|2243670_2244339_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
AZH98168.1|2244522_2245254_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZH98169.1|2245296_2246769_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
AZH98170.1|2246765_2247482_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
AZH98171.1|2247560_2248688_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
AZH98172.1|2248729_2249218_-	DUF2593 domain-containing protein	NA	NA	NA	NA	NA
AZH98173.1|2249275_2250121_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AZH98174.1|2250117_2251071_-	putrescine ABC transporter permease	NA	NA	NA	NA	NA
AZI01252.1|2251081_2252215_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
AZH98175.1|2252378_2253491_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AZH98176.1|2253839_2254319_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AZH98177.1|2254407_2255310_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
AZH98178.1|2256131_2256419_-	hypothetical protein	NA	NA	NA	NA	NA
AZH98179.1|2256621_2256885_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
AZH98180.1|2256891_2257275_-	hypothetical protein	NA	NA	NA	NA	NA
AZI01253.1|2257541_2259227_+	transporter	NA	NA	NA	NA	NA
2259357:2259375	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
AZH98181.1|2259446_2259665_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AZH98182.1|2259756_2260857_-	late control protein D	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
AZH98183.1|2260853_2261339_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
AZH98184.1|2261335_2263963_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
AZH98185.1|2263955_2264075_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AZH98186.1|2264089_2264389_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
AZH98187.1|2264441_2264957_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
AZH98188.1|2264966_2266139_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
AZH98189.1|2266277_2267354_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
AZH98190.1|2267383_2267587_-	hypothetical protein	NA	NA	NA	NA	NA
AZH98191.1|2267583_2268315_-	hypothetical protein	NA	NA	NA	NA	NA
AZH98192.1|2268318_2271270_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
AZH98193.1|2271271_2271871_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
AZH98194.1|2271863_2272772_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
AZH98195.1|2272758_2273121_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
AZH98196.1|2273117_2273690_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
AZH98197.1|2273784_2274477_+	hypothetical protein	NA	NA	NA	NA	NA
AZH98198.1|2274473_2274920_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
AZH98199.1|2274912_2275344_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
AZH98200.1|2275439_2275868_-	hypothetical protein	NA	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
AZH98201.1|2275864_2276248_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
AZH98202.1|2276252_2276762_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
AZH98203.1|2276742_2276958_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
AZH98204.1|2276961_2277165_-|tail	phage tail protein	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
AZH98205.1|2277164_2277629_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
AZH98206.1|2277724_2278375_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	96.3	8.7e-112
AZH98207.1|2278378_2279437_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
AZH98208.1|2279453_2280287_-|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
AZH98209.1|2280429_2282196_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
AZH98210.1|2282195_2283221_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
AZH98211.1|2283282_2285025_-	hypothetical protein	NA	NA	NA	NA	NA
AZH98212.1|2285300_2285978_-	hypothetical protein	NA	NA	NA	NA	NA
AZH98213.1|2286092_2286398_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AZI01254.1|2286336_2286525_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
AZH98214.1|2286678_2289093_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AZH98215.1|2289089_2289947_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
AZH98216.1|2289943_2290171_-	hypothetical protein	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
AZH98217.1|2290170_2290404_-	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
AZH98218.1|2290471_2290813_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
AZH98219.1|2290776_2290977_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
AZH98220.1|2290984_2291494_-	hypothetical protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AZH98221.1|2291526_2291748_-	regulator	NA	NA	NA	NA	NA
AZH98222.1|2291893_2292772_+	Repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
AZH98223.1|2292783_2293728_+	hypothetical protein	NA	NA	NA	NA	NA
AZH98224.1|2295309_2295561_-	hypothetical protein	NA	NA	NA	NA	NA
AZH98225.1|2295728_2296781_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
2296856:2296874	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 8
CP027053	Klebsiella pneumoniae strain 2_GR_12 chromosome, complete genome	5466424	2714700	2788503	5466424	coat,tRNA,terminase,lysis,tail,integrase,head	Escherichia_phage(23.73%)	89	2736441:2736487	2785575:2785621
AZH98589.1|2714700_2716218_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	9.5e-85
AZH98590.1|2716549_2718025_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.0	6.9e-48
AZH98591.1|2718084_2720232_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
AZH98592.1|2720314_2721649_-	lysine:cadaverine antiporter	NA	NA	NA	NA	NA
AZH98593.1|2722014_2723583_-	transcriptional regulator CadC	NA	NA	NA	NA	NA
AZH98594.1|2723875_2724148_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AZH98595.1|2724248_2725169_-	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	40.1	5.4e-51
AZH98596.1|2725679_2726546_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZH98597.1|2726568_2727594_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AZH98598.1|2727595_2730031_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AZH98599.1|2730041_2730737_-	fimbrial chaperone	NA	NA	NA	NA	NA
AZH98600.1|2730795_2731356_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AZH98601.1|2731827_2732490_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AZH98602.1|2732467_2732773_+	hypothetical protein	NA	NA	NA	NA	NA
AZH98603.1|2732825_2734130_-	citrate synthase	NA	NA	NA	NA	NA
AZH98604.1|2734374_2734563_+	hypothetical protein	NA	NA	NA	NA	NA
AZH98605.1|2734640_2734811_+	ATP-NAD kinase	NA	NA	NA	NA	NA
AZH98606.1|2734889_2735291_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AZH98607.1|2735686_2735980_-	hypothetical protein	NA	NA	NA	NA	NA
2736441:2736487	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AZH98608.1|2736642_2736960_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.9	3.7e-23
AZH98609.1|2736959_2737199_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	50.6	6.1e-15
AZH98610.1|2737276_2738761_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AZH98611.1|2738760_2739012_-	hypothetical protein	NA	NA	NA	NA	NA
AZH98612.1|2739213_2739423_-	hypothetical protein	NA	NA	NA	NA	NA
AZH98613.1|2739419_2740151_-	hypothetical protein	NA	NA	NA	NA	NA
AZI01277.1|2740161_2740890_-	hypothetical protein	NA	NA	NA	NA	NA
AZH98614.1|2743228_2745706_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	45.6	2.7e-198
AZH98615.1|2745692_2746088_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
AZH98616.1|2746084_2746555_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
AZI01278.1|2746554_2746974_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	48.5	1.8e-30
AZH98617.1|2747073_2750520_-	hypothetical protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.4e-163
AZH98618.1|2750612_2751116_-	hypothetical protein	NA	NA	NA	NA	NA
AZH98619.1|2751243_2752029_-	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
AZH98620.1|2752094_2752808_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
AZH98621.1|2752797_2752968_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
AZH98622.1|2753067_2753427_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
AZH98623.1|2753443_2753914_-	hypothetical protein	NA	NA	NA	NA	NA
AZH98624.1|2754207_2754462_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
AZH98625.1|2754464_2755220_-	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
AZH98626.1|2755395_2756073_-	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
AZH98627.1|2756125_2756878_-	DNA breaking-rejoining protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
AZH98628.1|2756946_2757339_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	5.1e-35
AZH98629.1|2757335_2757761_-	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
AZH98630.1|2757763_2758126_-	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
AZH98631.1|2758125_2758299_-	50S ribosomal protein L13	NA	I6R0P9	Salmonella_phage	56.1	1.4e-13
AZH98632.1|2758298_2758679_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
AZH98633.1|2758681_2758921_-	hypothetical protein	NA	NA	NA	NA	NA
AZH98634.1|2758931_2760026_-|coat	phage coat protein	coat	F1C5E1	Cronobacter_phage	62.8	1.7e-123
AZH98635.1|2760037_2760466_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
AZH98636.1|2760469_2761855_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
AZH98637.1|2761927_2762404_-	hypothetical protein	NA	NA	NA	NA	NA
AZH98638.1|2762445_2763450_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	9.0e-116
AZH98639.1|2763424_2764846_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
AZH98640.1|2764858_2766331_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
AZH98641.1|2766330_2766933_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
AZH98642.1|2767303_2767633_+	hypothetical protein	NA	NA	NA	NA	NA
AZH98643.1|2767738_2768203_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
AZH98644.1|2768199_2768730_-	lysozyme	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
AZH98645.1|2768732_2768981_-|lysis	lysis protein	lysis	NA	NA	NA	NA
AZH98646.1|2769890_2770580_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
AZH98647.1|2770576_2771107_-	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	5.2e-30
AZH98648.1|2771099_2771237_-	YlcG family protein	NA	NA	NA	NA	NA
AZH98649.1|2771233_2771869_-	NinG family protein	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
AZH98650.1|2771861_2772032_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
AZH98651.1|2772031_2772487_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
AZH98652.1|2772739_2772988_-	hypothetical protein	NA	NA	NA	NA	NA
AZH98653.1|2772987_2773635_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
AZH98654.1|2773807_2774650_-	addiction module toxin RelE	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
AZH98655.1|2774756_2775263_-	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
AZH98656.1|2775259_2775553_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
AZH98657.1|2775552_2776983_-	replicative DNA helicase	NA	Q9MCT4	Escherichia_phage	66.7	2.6e-185
AZH98658.1|2776972_2777872_-	DNA replication protein	NA	F1C5C3	Cronobacter_phage	54.9	5.4e-88
AZH98659.1|2778096_2778318_-	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
AZH98660.1|2778358_2778592_-	transcriptional regulator	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
AZH98661.1|2778719_2779409_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.2	4.3e-61
AZH98662.1|2779759_2779975_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
AZH98663.1|2780074_2780269_+	hypothetical protein	NA	NA	NA	NA	NA
AZH98664.1|2780357_2780642_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
AZH98665.1|2780657_2781503_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.9e-69
AZH98666.1|2781499_2782180_+	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
AZH98667.1|2782176_2782335_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
AZH98668.1|2782331_2782988_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
AZH98669.1|2782984_2783752_+	dcm methylase	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
AZH98670.1|2783748_2783967_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
AZH98671.1|2783968_2784184_+	conjugal transfer protein TraR	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
AZH98672.1|2784397_2785561_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.3	3.3e-202
AZH98673.1|2785991_2786858_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
2785575:2785621	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AZH98674.1|2786859_2787072_+	ribosome-associated protein	NA	NA	NA	NA	NA
AZH98675.1|2787117_2788503_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 9
CP027053	Klebsiella pneumoniae strain 2_GR_12 chromosome, complete genome	5466424	2998039	3009694	5466424	integrase	Enterobacteria_phage(66.67%)	12	2998489:2998503	3021547:3021561
AZH98869.1|2998039_2999143_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
2998489:2998503	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
AZH98870.1|2999153_3000407_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
AZH98871.1|3000759_3001950_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
AZH98872.1|3001937_3002888_+	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
AZH98873.1|3002887_3003313_+	hypothetical protein	NA	NA	NA	NA	NA
AZH98874.1|3003881_3004448_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
AZH98875.1|3004465_3004711_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
AZH98876.1|3005987_3006254_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
AZH98877.1|3006250_3006808_+	Ash-like/host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
AZH98878.1|3006804_3007032_+	hypothetical protein	NA	NA	NA	NA	NA
AZH98879.1|3007028_3007349_+	hypothetical protein	NA	NA	NA	NA	NA
AZH98880.1|3007360_3009694_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
3021547:3021561	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 10
CP027053	Klebsiella pneumoniae strain 2_GR_12 chromosome, complete genome	5466424	4557711	4627090	5466424	head,portal,tRNA,terminase,tail,capsid,integrase,protease	uncultured_Caudovirales_phage(61.11%)	74	4575320:4575337	4591315:4591332
AZI00272.1|4557711_4558659_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
AZI00273.1|4558673_4559183_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
AZI00274.1|4559311_4560436_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
AZI00275.1|4560407_4560881_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
AZI00276.1|4560906_4561449_+	hypothetical protein	NA	NA	NA	NA	NA
AZI00277.1|4561453_4562026_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
AZI00278.1|4562029_4562848_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
AZI00279.1|4562844_4563102_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
AZI01356.1|4563077_4563632_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AZI00280.1|4569428_4569650_-	hypothetical protein	NA	NA	NA	NA	NA
AZI00281.1|4569943_4573054_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
AZI00282.1|4573066_4574206_-	MexX family efflux pump subunit	NA	NA	NA	NA	NA
AZI00283.1|4574584_4575235_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
4575320:4575337	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
AZI00284.1|4575510_4576737_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
AZI00285.1|4576829_4577771_+	hypothetical protein	NA	NA	NA	NA	NA
AZI00286.1|4577952_4578237_+	transcriptional regulator	NA	NA	NA	NA	NA
AZI00287.1|4578247_4579027_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
AZI00288.1|4579150_4579345_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AZI01357.1|4579568_4579748_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.9	2.6e-26
AZI00289.1|4579740_4579929_+	hypothetical protein	NA	NA	NA	NA	NA
AZI00290.1|4579921_4580236_+	hypothetical protein	NA	NA	NA	NA	NA
AZI00291.1|4580232_4580601_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
AZI00292.1|4580597_4580963_+	hypothetical protein	NA	NA	NA	NA	NA
AZI00293.1|4580962_4583098_+	DNA primase	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
AZI00294.1|4583440_4583776_+	hypothetical protein	NA	NA	NA	NA	NA
AZI00295.1|4583824_4584337_-	hypothetical protein	NA	NA	NA	NA	NA
AZI00296.1|4584600_4585767_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
AZI00297.1|4585818_4586379_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
AZI00298.1|4586380_4587622_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
AZI00299.1|4587618_4587954_+|head,tail	head-tail adaptor	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
AZI00300.1|4587950_4588250_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
AZI00301.1|4588249_4588693_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
AZI00302.1|4588819_4589011_+|terminase	terminase	terminase	NA	NA	NA	NA
AZI00303.1|4588968_4589325_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
AZI00304.1|4589308_4590970_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
AZI00305.1|4590972_4591164_+	hypothetical protein	NA	NA	NA	NA	NA
AZI00306.1|4591317_4591614_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
4591315:4591332	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
AZI00307.1|4591638_4592604_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
AZI00308.1|4592761_4592956_-	hypothetical protein	NA	NA	NA	NA	NA
AZI00309.1|4592961_4593843_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AZI00310.1|4593854_4595306_-	sodium/panthothenate symporter	NA	NA	NA	NA	NA
AZI00311.1|4595295_4595538_-	hypothetical protein	NA	NA	NA	NA	NA
AZI00312.1|4595648_4596998_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AZI00313.1|4597008_4597476_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
AZI00314.1|4597498_4597951_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AZI00315.1|4598782_4599784_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
AZI00316.1|4600012_4600204_+	hypothetical protein	NA	NA	NA	NA	NA
AZI00317.1|4600283_4602224_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
AZI00318.1|4602345_4602552_-	hypothetical protein	NA	NA	NA	NA	NA
AZI00319.1|4602529_4603573_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
AZI00320.1|4603643_4604636_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AZI00321.1|4604635_4605124_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AZI00322.1|4605131_4605713_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AZI00323.1|4605715_4607185_+	ribonuclease G	NA	NA	NA	NA	NA
AZI00324.1|4607222_4611020_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
AZI00325.1|4611108_4612554_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AZI00326.1|4612589_4613519_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
AZI00327.1|4613650_4613854_+	protein AaeX	NA	NA	NA	NA	NA
AZI00328.1|4613861_4614794_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
AZI00329.1|4614799_4616767_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
AZI00330.1|4616846_4617122_+	hypothetical protein	NA	NA	NA	NA	NA
AZI00331.1|4617172_4617439_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AZI00332.1|4617537_4617801_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AZI00333.1|4618176_4618647_-	arginine repressor	NA	NA	NA	NA	NA
AZI00334.1|4619061_4620000_+	malate dehydrogenase	NA	NA	NA	NA	NA
AZI00335.1|4620136_4621195_-|protease	serine endoprotease DegS	protease	NA	NA	NA	NA
AZI00336.1|4621282_4622650_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
AZI01358.1|4622823_4623222_-	hypothetical protein	NA	NA	NA	NA	NA
AZI00337.1|4623412_4624540_+	cell division protein ZapE	NA	NA	NA	NA	NA
AZI00338.1|4624805_4625234_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
AZI00339.1|4625249_4625642_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
AZI00340.1|4625751_4625955_-	hypothetical protein	NA	NA	NA	NA	NA
AZI00341.1|4625953_4626592_+	stringent starvation protein A	NA	NA	NA	NA	NA
AZI00342.1|4626595_4627090_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
>prophage 1
CP027055	Klebsiella pneumoniae strain 2_GR_12 plasmid IncAC2	175636	108021	162713	175636	head,integrase,transposase,tail	Salmonella_phage(17.39%)	61	146784:146843	166104:167433
AZI01711.1|108021_108639_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
AZI01712.1|108732_108951_-	hypothetical protein	NA	NA	NA	NA	NA
AZI01713.1|109156_109813_-	hypothetical protein	NA	NA	NA	NA	NA
AZI01714.1|109812_111240_-	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
AZI01715.1|111243_111744_-	hypothetical protein	NA	I3UMJ0	Colwellia_phage	43.3	1.7e-19
AZI01716.1|111752_112085_-	hypothetical protein	NA	NA	NA	NA	NA
AZI01785.1|112069_112501_-	hypothetical protein	NA	NA	NA	NA	NA
AZI01717.1|112568_113243_-	thymidylate kinase	NA	NA	NA	NA	NA
AZI01718.1|113217_113499_-	hypothetical protein	NA	NA	NA	NA	NA
AZI01719.1|113491_113869_-	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	49.6	2.2e-22
AZI01720.1|114422_115058_+	restriction endonuclease subunit M	NA	NA	NA	NA	NA
AZI01721.1|115110_115383_-	hypothetical protein	NA	NA	NA	NA	NA
AZI01722.1|115431_116613_-	chromosome partitioning protein ParB	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
AZI01723.1|116616_117402_-	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
AZI01724.1|117575_117887_-	hypothetical protein	NA	NA	NA	NA	NA
AZI01725.1|118193_119009_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AZI01726.1|119069_119873_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AZI01727.1|119872_120709_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AZI01728.1|121014_121257_+	relaxase	NA	NA	NA	NA	NA
AZI01729.1|121288_121966_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZI01730.1|122044_123244_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AZI01731.1|123609_123834_-	hypothetical protein	NA	NA	NA	NA	NA
AZI01732.1|123830_124568_-	resolvase	NA	NA	NA	NA	NA
AZI01733.1|124674_125166_+	hypothetical protein	NA	NA	NA	NA	NA
AZI01734.1|125199_125904_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZI01735.1|128585_129143_+	recombinase	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
AZI01736.1|129325_130186_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AZI01737.1|130355_131111_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
AZI01738.1|131191_131740_-	sodium:proton antiporter	NA	NA	NA	NA	NA
AZI01739.1|131855_133058_+|transposase	ISL3 family transposase ISAeme19	transposase	A9YX10	Burkholderia_phage	53.2	1.0e-102
AZI01740.1|133072_133465_+	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	58.1	8.5e-22
AZI01741.1|133691_135224_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AZI01742.1|135315_136107_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZI01743.1|136127_137303_-	tetracycline efflux MFS transporter Tet(G)	NA	NA	NA	NA	NA
AZI01744.1|137406_138033_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZI01745.1|138029_138212_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
AZI01746.1|138239_139454_-	chloramphenicol/florfenicol efflux MFS transporter FloR2	NA	S4TR35	Salmonella_phage	23.7	9.8e-16
AZI01747.1|139670_140642_-	Sul1-delta/DUF3363 domain-containing fusion protein	NA	NA	NA	NA	NA
AZI01748.1|140635_140983_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AZI01786.1|141146_141938_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AZI01749.1|141954_142755_-	oxacillin-hydrolyzing class D beta-lactamase OXA-10	NA	NA	NA	NA	NA
AZI01750.1|143019_144279_-	chloramphenicol efflux MFS transporter CmlA5	NA	S4TR35	Salmonella_phage	31.7	1.7e-26
AZI01751.1|144599_145052_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-2	NA	NA	NA	NA	NA
AZI01752.1|145136_145670_-	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
AZI01753.1|145814_146714_-	class A extended-spectrum beta-lactamase VEB-1	NA	NA	NA	NA	NA
146784:146843	attL	CTGAAGAATCCCCTGATGATTTACAAATAAATCATCAAATTAGGGTGGAAGCGCATCTTG	NA	NA	NA	NA
AZI01754.1|146847_148098_+|transposase	IS4-like element IS10A family transposase	transposase	Q9E8P4	Bluetongue_virus	71.4	4.2e-171
AZI01755.1|148222_149236_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AZI01756.1|149174_149495_+|transposase	transposase	transposase	NA	NA	NA	NA
AZI01757.1|149532_150090_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
AZI01758.1|150092_153065_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
AZI01759.1|153143_154148_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AZI01760.1|154329_154509_-	hypothetical protein	NA	NA	NA	NA	NA
AZI01787.1|154883_155231_+	hypothetical protein	NA	A0A1V0SB21	Catovirus	39.4	2.6e-06
AZI01761.1|155230_155791_+	trimethoprim-resistant dihydrofolate reductase DfrA23	NA	A0A076FMI9	Aureococcus_anophage	29.0	1.6e-05
AZI01762.1|156188_156893_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZI01763.1|157894_158377_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	6.6e-16
AZI01764.1|158597_158864_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
AZI01765.1|159006_159771_+|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AZI01766.1|159812_160025_+	resolvase	NA	NA	NA	NA	NA
AZI01767.1|160037_161246_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AZI01768.1|161279_162713_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
166104:167433	attR	CAAGATGCGCTTCCACCCTAATTTGATGATTTATTTGTAAATCATCAGGGGATTCTTCAGCGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCGGTCTTAAACAACTGAACTGGGCTAGCGAAGGAGTGGGGGCAACAGCAGCTGCGCTGGTAGACTTATCCACAGTTGCTGGTAACAAAATCAGCAATCCGCCCTGGGTCAAATTTCAATCGGCAGGGTGGGTCAATTTTCCATCAGCGCCAACAAATGGTGGTTTCGTCGGGGATGCGCTCCAGGTTCAGCCCGGCAAACTGGCGCAGGATCGTGGTTTCGTACAGCGCTTCCTCCATCGCTGGATCGCTGTAGCCGAACCAGTTCTGCAGCAGATGCACACGCAGCATCGCCATCAACGGGTAGGCCGGACGGCCACCTTCACCCTTCGGATAATGTGGCTCGATCAAAGCAATCAAGCCCTTCCACGGCACCACCCGATCCATCTCGATCAGGAACAACTCCTTGCGGGTTTGCTTGCGCTTGCCAGCGTACTCGGCGTCGGCGAAGGTCATCTGCTTCATCGGGAAACTCGGTGGGTGGGGGCGCGGTATTTTGCCAAATCAGAAAGTCTTTTTCAGAGTTTCCCTAGGCTGACAAGCCAAGCGCTGGATCGCAACCATCCATCACCTTATCCAGCTAGATCTGCCTCCTCCAATAAGTGCCGCACAAATCCCGGCGGGTGCAGATTTCCGGGAGGTTTGCGCCAGATCAGTTGGAGACGCTTTTCAAGCCCCGGGATGGGAAGAGCTACCAGCGCGCCACTGCGAACTTCGTCTTGTACTGCGGAAGCCATCACCAACGACACGCCGAGTCCCGCCCTCACTGCTTGTTTGACTGCCTCGGTGCTGCCTAGCTGCATACCGCTGCGAGGCACGCCCAGTTCGCCAAAGTATTCGGTCAGAAGCCGTCCGGTACCGCTACCCGGTTCACCTCCCAGCATCGGCAGGTCCACCAGACGATCACGTTCTATGCACCCTGCTTCAGCCAGCGCATGGTCGGGGCTGACGATAAGCACCAGCGGCTCGACCCGCCAGAGGCGGTGTTCGAA	NA	NA	NA	NA
>prophage 1
CP027056	Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB	95481	3721	37605	95481	transposase,integrase	Escherichia_phage(25.0%)	33	12039:12056	46803:46820
AZI01793.1|3721_5437_-|integrase	integrase	integrase	NA	NA	NA	NA
AZI01794.1|5546_8576_+|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
AZI01795.1|8682_9708_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
AZI01796.1|9704_10484_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
AZI01797.1|10480_10720_+	hypothetical protein	NA	NA	NA	NA	NA
AZI01798.1|10771_11653_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AZI01799.1|11902_13222_-|transposase	IS1182 family transposase ISKpn6	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
12039:12056	attL	ATCGACTTGCGCCGGCGG	NA	NA	NA	NA
AZI01800.1|13498_14683_-|transposase	ISAs1-like element ISKpn31 family transposase	transposase	NA	NA	NA	NA
AZI01801.1|15186_15546_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	62.0	3.6e-19
AZI01802.1|16711_17332_-	serine recombinase	NA	A0A219Y912	Aeromonas_phage	31.5	2.0e-09
AZI01803.1|17420_20318_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.7	2.7e-181
AZI01804.1|20390_21095_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZI01805.1|22838_23699_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AZI01806.1|24266_25571_-|integrase	integrase	integrase	NA	NA	NA	NA
AZI01807.1|25609_26317_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AZI01808.1|26313_26550_-	mercury resistance protein	NA	NA	NA	NA	NA
AZI01809.1|26546_26909_-	transcriptional regulator	NA	NA	NA	NA	NA
AZI01810.1|26926_28621_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AZI01901.1|28672_29095_-	mercury transport protein MerC	NA	NA	NA	NA	NA
AZI01902.1|29130_29256_-	mercury transporter	NA	NA	NA	NA	NA
AZI01811.1|29987_30698_-	AAA family ATPase	NA	NA	NA	NA	NA
AZI01812.1|30771_31188_-	PIN domain nuclease	NA	NA	NA	NA	NA
AZI01813.1|31184_31415_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AZI01814.1|31398_31833_+	hypothetical protein	NA	NA	NA	NA	NA
AZI01815.1|32067_32274_+	hypothetical protein	NA	NA	NA	NA	NA
AZI01816.1|32319_32628_+	hypothetical protein	NA	NA	NA	NA	NA
AZI01817.1|32655_32985_+	hypothetical protein	NA	NA	NA	NA	NA
AZI01818.1|33052_33409_+	hypothetical protein	NA	NA	NA	NA	NA
AZI01819.1|33415_33748_+	hypothetical protein	NA	NA	NA	NA	NA
AZI01820.1|33747_34530_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	4.6e-51
AZI01821.1|35384_35579_-	hypothetical protein	NA	NA	NA	NA	NA
AZI01822.1|35743_36217_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
AZI01823.1|36336_37605_-|transposase	ISL3 family transposase ISKpn25	transposase	Q6V7R1	Burkholderia_virus	34.7	5.2e-60
46803:46820	attR	ATCGACTTGCGCCGGCGG	NA	NA	NA	NA
>prophage 2
CP027056	Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB	95481	42180	54272	95481		Enterobacteria_phage(25.0%)	13	NA	NA
AZI01826.1|42180_44208_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	26.6	2.1e-26
AZI01827.1|44319_44535_-	hypothetical protein	NA	NA	NA	NA	NA
AZI01828.1|44759_45092_-	hypothetical protein	NA	NA	NA	NA	NA
AZI01829.1|45111_45297_-	hypothetical protein	NA	NA	NA	NA	NA
AZI01830.1|45468_46443_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	62.3	1.4e-105
AZI01831.1|46439_47645_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.0	7.3e-205
AZI01832.1|47966_48863_-	replication initiation protein	NA	Q71TL8	Escherichia_phage	53.8	3.3e-69
AZI01833.1|49263_50535_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.7	3.6e-154
AZI01834.1|50534_50966_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	52.5	1.0e-28
AZI01835.1|51197_52169_+	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
AZI01836.1|52171_52843_+	Mediator of plasmid stability	NA	NA	NA	NA	NA
AZI01837.1|52903_53134_+	hypothetical protein	NA	NA	NA	NA	NA
AZI01838.1|53570_54272_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
>prophage 1
CP027054	Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII	197872	9591	58169	197872	integrase,protease,transposase	Escherichia_phage(22.22%)	47	17014:17029	61642:61657
AZI01393.1|9591_9759_+|integrase	integrase	integrase	NA	NA	NA	NA
AZI01394.1|10043_11171_+	regulator	NA	NA	NA	NA	NA
AZI01395.1|11167_11761_+	response regulator	NA	NA	NA	NA	NA
AZI01396.1|11757_12606_+	ABC transporter permease	NA	NA	NA	NA	NA
AZI01397.1|12605_13526_+	ABC transporter permease	NA	NA	NA	NA	NA
AZI01398.1|13538_15143_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZI01399.1|15187_16135_+	acetamidase	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
AZI01400.1|16142_17876_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
17014:17029	attL	GCGGCGACGGCCTGCG	NA	NA	NA	NA
AZI01401.1|21698_22046_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.0e-59
AZI01571.1|22042_22420_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	91.3	1.6e-57
AZI01402.1|22976_23612_-	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
AZI01403.1|23608_24721_-	His-Xaa-Ser system radical SAM maturase HxsC	NA	S5WIP3	Leptospira_phage	33.8	1.5e-47
AZI01404.1|24713_26102_-	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	29.0	6.3e-51
AZI01405.1|26101_26332_-	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
AZI01406.1|27064_27256_-	hypothetical protein	NA	NA	NA	NA	NA
AZI01407.1|27309_27969_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
AZI01408.1|28169_28547_-	N-acetyltransferase	NA	NA	NA	NA	NA
AZI01409.1|28613_31580_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.4	0.0e+00
AZI01410.1|31582_32143_-	DNA resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AZI01411.1|32268_32883_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AZI01412.1|32821_33835_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AZI01413.1|33979_34477_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
AZI01414.1|34884_35676_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AZI01415.1|35839_36187_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AZI01416.1|36180_37020_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AZI01417.1|36949_37129_-	hypothetical protein	NA	NA	NA	NA	NA
AZI01418.1|37147_37351_+	hypothetical protein	NA	NA	NA	NA	NA
AZI01419.1|37506_38712_+	chromate transporter	NA	NA	NA	NA	NA
AZI01420.1|38722_39028_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AZI01421.1|39043_39226_-	resolvase	NA	NA	NA	NA	NA
AZI01422.1|39254_40019_+|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AZI01423.1|40209_40566_-	hypothetical protein	NA	NA	NA	NA	NA
AZI01424.1|40511_41096_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZI01425.1|41095_42334_-	MFS transporter	NA	NA	NA	NA	NA
AZI01426.1|42330_43236_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AZI01427.1|43357_44062_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZI01428.1|44212_45028_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
AZI01573.1|45581_45908_-	hypothetical protein	NA	NA	NA	NA	NA
AZI01572.1|45959_46046_+	ABC transporter	NA	NA	NA	NA	NA
AZI01429.1|46084_47065_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AZI01574.1|49051_49333_+	DNA-binding protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
AZI01430.1|49367_49937_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AZI01431.1|50051_52847_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	41.0	5.2e-129
AZI01432.1|52846_53044_+	hypothetical protein	NA	NA	NA	NA	NA
AZI01433.1|53281_54031_+	diguanylate cyclase	NA	NA	NA	NA	NA
AZI01434.1|54017_54980_+|protease	Zn-dependent protease	protease	NA	NA	NA	NA
AZI01575.1|56822_58169_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
61642:61657	attR	GCGGCGACGGCCTGCG	NA	NA	NA	NA
>prophage 1
CP027057	Klebsiella pneumoniae strain 2_GR_12 plasmid IncX3, complete sequence	43380	0	2435	43380		Escherichia_phage(25.0%)	4	NA	NA
AZI01904.1|44_401_-	sOS mutagenesis and repair protein UmuD	NA	A0A222YZE2	Escherichia_phage	46.6	5.5e-20
AZI01905.1|403_643_-	DNA polymerase V	NA	I6PD82	Cronobacter_phage	55.1	4.4e-21
AZI01953.1|729_1392_-	resolvase	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
AZI01906.1|1772_2435_+	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
>prophage 2
CP027057	Klebsiella pneumoniae strain 2_GR_12 plasmid IncX3, complete sequence	43380	7035	7551	43380		Tupanvirus(100.0%)	1	NA	NA
AZI01911.1|7035_7551_+	molecular chaperone DnaJ	NA	A0A2K9L588	Tupanvirus	39.8	3.3e-05
>prophage 3
CP027057	Klebsiella pneumoniae strain 2_GR_12 plasmid IncX3, complete sequence	43380	26182	30353	43380		Moraxella_phage(33.33%)	3	NA	NA
AZI01936.1|26182_26677_+	micrococcal nuclease	NA	A0A0R6PHV6	Moraxella_phage	37.3	8.0e-17
AZI01937.1|26759_28022_+	ATP-binding protein	NA	A0A1V0SKF8	Klosneuvirus	31.4	1.3e-07
AZI01938.1|28025_30353_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	28.1	8.6e-37
>prophage 4
CP027057	Klebsiella pneumoniae strain 2_GR_12 plasmid IncX3, complete sequence	43380	35517	42550	43380	transposase	Escherichia_phage(75.0%)	5	NA	NA
AZI01946.1|35517_38535_+|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
AZI01947.1|39743_40646_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AZI01948.1|40683_40917_-	hypothetical protein	NA	NA	NA	NA	NA
AZI01949.1|40907_41669_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AZI01950.1|41689_42550_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
