The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP032279	Acinetobacter sp. WCHAc010034 chromosome, complete genome	3630637	525989	537995	3630637	holin	uncultured_Caudovirales_phage(57.14%)	9	NA	NA
AYA02090.1|525989_526577_-	DUF3380 domain-containing protein	NA	U5PZP0	Acinetobacter_phage	56.8	7.4e-54
AYA02091.1|526804_527098_-|holin	holin	holin	NA	NA	NA	NA
AYA02092.1|527142_528027_-	hypothetical protein	NA	NA	NA	NA	NA
AYA02093.1|528023_531083_-	hypothetical protein	NA	A0A2H4J328	uncultured_Caudovirales_phage	45.3	7.0e-212
AYA02094.1|531075_531258_-	hypothetical protein	NA	A0A1X9IAJ5	Xanthomonas_phage	44.6	3.0e-06
AYA02095.1|531254_531506_-	hypothetical protein	NA	A0A2H4J8S6	uncultured_Caudovirales_phage	58.8	1.5e-16
AYA02096.1|531514_532366_-	DUF2163 domain-containing protein	NA	A0A2H4J3E9	uncultured_Caudovirales_phage	53.8	3.8e-91
AYA02097.1|532362_533574_-	hypothetical protein	NA	A0A2H4J3F5	uncultured_Caudovirales_phage	74.9	5.3e-179
AYA02098.1|534023_537995_-	tape measure protein	NA	A0A0D4DC37	Acinetobacter_phage	43.0	1.4e-249
>prophage 2
CP032279	Acinetobacter sp. WCHAc010034 chromosome, complete genome	3630637	541515	561247	3630637	terminase,coat,head	Acinetobacter_phage(77.27%)	30	NA	NA
AYA02104.1|541515_541704_-	hypothetical protein	NA	A0A1B1P9F7	Acinetobacter_phage	48.3	2.6e-08
AYA02105.1|541790_542261_-	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	65.1	6.0e-46
AYA02106.1|542299_543235_-	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	32.9	1.7e-39
AYA02107.1|543317_543539_-	hypothetical protein	NA	NA	NA	NA	NA
AYA02108.1|543535_543790_-	hypothetical protein	NA	NA	NA	NA	NA
AYA02109.1|543793_544201_-	hypothetical protein	NA	A0A1B1P9D6	Acinetobacter_phage	37.3	2.3e-17
AYA02110.1|544197_544575_-	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	40.7	3.9e-16
AYA02111.1|544756_545074_-	hypothetical protein	NA	NA	NA	NA	NA
AYA04743.1|545140_545518_-	glutamate 5-kinase	NA	A0A1B1P9E3	Acinetobacter_phage	46.2	2.4e-21
AYA02112.1|545517_545892_-	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	62.0	1.7e-35
AYA02113.1|545896_546292_-	hypothetical protein	NA	A0A0D4DBW4	Acinetobacter_phage	38.8	1.7e-06
AYA02114.1|546340_547480_-|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	47.0	1.4e-85
AYA02115.1|547501_548260_-	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	66.4	4.1e-73
AYA02116.1|548635_549781_-|head	phage head morphogenesis protein	head	A0A0P0IR98	Acinetobacter_phage	49.9	1.8e-96
AYA02117.1|549783_551202_-	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	50.0	6.7e-133
AYA02118.1|551198_552494_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	89.1	2.2e-223
AYA02119.1|552432_552975_-	DUF2280 domain-containing protein	NA	A0A1B1P9C2	Acinetobacter_phage	67.1	4.6e-58
AYA02120.1|553089_553446_-	hypothetical protein	NA	NA	NA	NA	NA
AYA02121.1|553573_554215_-	hypothetical protein	NA	A0A2H4JE07	uncultured_Caudovirales_phage	91.5	4.1e-114
AYA02122.1|554174_554651_-	hypothetical protein	NA	A0A0P0IRI6	Acinetobacter_phage	69.7	9.9e-57
AYA02123.1|554692_554932_-	hypothetical protein	NA	NA	NA	NA	NA
AYA02124.1|555182_555368_-	hypothetical protein	NA	NA	NA	NA	NA
AYA02125.1|556594_557014_-	hypothetical protein	NA	NA	NA	NA	NA
AYA02126.1|557135_557576_-	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	61.0	4.1e-49
AYA02127.1|557585_557990_-	DUF1064 domain-containing protein	NA	A0A0R6PJ28	Moraxella_phage	47.5	1.1e-21
AYA02128.1|558087_559464_-	replicative DNA helicase	NA	A0A068CDC8	Acinetobacter_phage	35.3	8.9e-74
AYA02129.1|559456_560269_-	helix-turn-helix domain-containing protein	NA	A0A190XCE7	Acinetobacter_phage	60.8	2.6e-28
AYA02130.1|560398_560698_-	hypothetical protein	NA	NA	NA	NA	NA
AYA02131.1|560747_561023_-	hypothetical protein	NA	A0A1B1P9I3	Acinetobacter_phage	73.9	7.8e-30
AYA02132.1|561031_561247_-	hypothetical protein	NA	A0A0P0IY81	Acinetobacter_phage	70.4	2.1e-22
>prophage 3
CP032279	Acinetobacter sp. WCHAc010034 chromosome, complete genome	3630637	683088	704346	3630637	capsid,head	Acinetobacter_phage(29.41%)	29	NA	NA
AYA02237.1|683088_684168_-|capsid	phage capsid protein	capsid	V5Q8X6	Xylella_phage	26.2	2.2e-19
AYA02238.1|684170_684542_-	hypothetical protein	NA	NA	NA	NA	NA
AYA02239.1|684545_685517_-	hypothetical protein	NA	NA	NA	NA	NA
AYA02240.1|685739_686945_-|head	phage head morphogenesis protein	head	B7SDN5	Haemophilus_phage	35.2	1.2e-21
AYA02241.1|686947_688435_-	DUF935 family protein	NA	A0A2H4JHL1	uncultured_Caudovirales_phage	44.0	2.1e-105
AYA02242.1|688445_689981_-	helicase	NA	Q6XQD9	Escherichia_phage	37.8	1.0e-86
AYA02243.1|689981_690452_-	DUF2280 domain-containing protein	NA	A0A2H4JI35	uncultured_Caudovirales_phage	67.1	4.1e-47
AYA02244.1|690503_691145_-	hypothetical protein	NA	A0A2H4JE07	uncultured_Caudovirales_phage	91.1	2.7e-113
AYA02245.1|691104_691581_-	hypothetical protein	NA	A0A0P0IRI6	Acinetobacter_phage	69.0	1.7e-56
AYA02246.1|692615_693026_-	antitermination protein	NA	NA	NA	NA	NA
AYA02247.1|693036_693450_-	hypothetical protein	NA	A0A0P0HSP6	Acinetobacter_phage	70.1	8.1e-47
AYA02248.1|693446_693986_-	hypothetical protein	NA	NA	NA	NA	NA
AYA02249.1|693976_694231_-	hypothetical protein	NA	NA	NA	NA	NA
AYA02250.1|694227_695595_-	DNA cytosine methyltransferase	NA	A0A1I9KFW0	Aeromonas_phage	46.0	4.5e-134
AYA02251.1|695692_696412_-	hypothetical protein	NA	A0A2H4JAS6	uncultured_Caudovirales_phage	66.4	4.3e-88
AYA02252.1|696392_697448_-	hypothetical protein	NA	NA	NA	NA	NA
AYA02253.1|697449_697776_-	hypothetical protein	NA	A0A0D4DBI9	Acinetobacter_phage	71.6	1.4e-30
AYA02254.1|697772_698075_-	hypothetical protein	NA	NA	NA	NA	NA
AYA02255.1|698124_698616_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYA02256.1|698675_698906_-	hypothetical protein	NA	A0A125RNS7	Pseudomonas_phage	54.1	1.1e-08
AYA02257.1|699030_699702_+	helix-turn-helix transcriptional regulator	NA	A0A1B1P9J5	Acinetobacter_phage	53.1	2.9e-62
AYA02258.1|699831_700095_+	type II toxin-antitoxin system HicA family toxin	NA	K7PH44	Enterobacterial_phage	40.9	2.0e-06
AYA02259.1|700091_700601_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	40.7	1.7e-17
AYA02260.1|700622_700928_+	hypothetical protein	NA	NA	NA	NA	NA
AYA02261.1|700959_701235_+	SinR family protein	NA	A0A1J0MF70	Staphylococcus_phage	46.7	1.4e-07
AYA04754.1|701218_701440_-	hypothetical protein	NA	NA	NA	NA	NA
AYA02262.1|701794_702325_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
AYA02263.1|702628_703213_+	hypothetical protein	NA	NA	NA	NA	NA
AYA02264.1|703224_704346_+	ATP-binding protein	NA	A0A0D4DBX7	Acinetobacter_phage	81.8	5.4e-178
>prophage 4
CP032279	Acinetobacter sp. WCHAc010034 chromosome, complete genome	3630637	724359	791540	3630637	integrase,terminase,head,capsid,plate,portal,tail,tRNA,holin	uncultured_Caudovirales_phage(30.77%)	79	719261:719277	789826:789842
719261:719277	attL	CCTGAATCAGCTGTTTC	NA	NA	NA	NA
AYA04756.1|724359_725088_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
AYA02285.1|725190_725970_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
AYA02286.1|726417_726984_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYA02287.1|727221_728061_+	hypothetical protein	NA	NA	NA	NA	NA
AYA02288.1|728761_729550_+	DUF2071 domain-containing protein	NA	NA	NA	NA	NA
AYA02289.1|729633_730092_-	hypothetical protein	NA	NA	NA	NA	NA
AYA02290.1|730198_730828_-	cation transporter	NA	NA	NA	NA	NA
AYA02291.1|730896_731334_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AYA02292.1|731345_732050_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	70.9	4.8e-92
AYA04757.1|732159_733206_-	arsenical-resistance protein	NA	NA	NA	NA	NA
AYA02293.1|733216_733690_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	48.1	7.6e-33
AYA02294.1|733705_734029_-	ArsR family transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	52.9	1.5e-24
AYA02295.1|734191_735589_+	U32 family peptidase	NA	Q6DW11	Phage_TP	64.3	1.4e-130
AYA02296.1|735590_735845_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	44.8	1.0e-15
AYA02297.1|736024_736366_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AYA02298.1|736462_737398_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYA02299.1|737608_739174_-	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JK46	Lactococcus_phage	29.9	1.1e-24
AYA02300.1|739396_740314_-	hypothetical protein	NA	NA	NA	NA	NA
AYA02301.1|740368_741502_-	toxic anion resistance protein	NA	K4F9M7	Cronobacter_phage	26.6	3.0e-27
AYA02302.1|741519_742308_-	tellurium resistance protein	NA	NA	NA	NA	NA
AYA02303.1|742599_743004_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
AYA02304.1|743165_744419_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.1	6.8e-97
AYA02305.1|744575_745871_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
AYA04758.1|746222_746921_+	3'-5' exonuclease	NA	A0A059VJT9	Pseudomonas_phage	42.0	3.4e-37
AYA02306.1|747006_747636_+	hypothetical protein	NA	NA	NA	NA	NA
AYA02307.1|747864_748230_+	hypothetical protein	NA	NA	NA	NA	NA
AYA04759.1|748402_748609_-	hypothetical protein	NA	NA	NA	NA	NA
AYA02308.1|749271_749940_-	hypothetical protein	NA	A0A2H4J8A2	uncultured_Caudovirales_phage	40.8	1.1e-40
AYA02309.1|750644_751805_-|integrase	site-specific integrase	integrase	Q76UT6	Pseudomonas_virus	45.4	2.1e-52
AYA02310.1|751893_752634_-	3'-5' exonuclease	NA	A0A0S0NDC6	Pseudomonas_phage	33.0	5.9e-24
AYA02311.1|752630_752993_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
AYA02312.1|752992_753688_-	hypothetical protein	NA	NA	NA	NA	NA
AYA02313.1|753691_754006_-	hypothetical protein	NA	NA	NA	NA	NA
AYA02314.1|754009_754528_-	hypothetical protein	NA	NA	NA	NA	NA
AYA02315.1|754524_755019_-	hypothetical protein	NA	NA	NA	NA	NA
AYA02316.1|755783_758501_-	DUF927 domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	39.8	6.7e-190
AYA02317.1|758514_758694_-	hypothetical protein	NA	NA	NA	NA	NA
AYA02318.1|758699_758933_-	hypothetical protein	NA	NA	NA	NA	NA
AYA02319.1|758946_759141_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AYA04760.1|759224_759575_+	hypothetical protein	NA	NA	NA	NA	NA
AYA04761.1|759619_760180_-	hypothetical protein	NA	NA	NA	NA	NA
AYA02320.1|760201_760405_-	hypothetical protein	NA	NA	NA	NA	NA
AYA02321.1|760729_761476_+	hypothetical protein	NA	NA	NA	NA	NA
AYA02322.1|761478_761694_+	hypothetical protein	NA	NA	NA	NA	NA
AYA04762.1|762888_763356_+	hypothetical protein	NA	A0A0R6PJ56	Moraxella_phage	36.1	1.6e-11
AYA02323.1|763534_763900_-	hypothetical protein	NA	NA	NA	NA	NA
AYA02324.1|763886_764156_-	hypothetical protein	NA	NA	NA	NA	NA
AYA02325.1|764341_765829_-	DNA primase	NA	A0A2H4JAV0	uncultured_Caudovirales_phage	46.8	6.4e-94
AYA02326.1|765828_766254_-|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	44.0	1.9e-27
AYA02327.1|766266_769200_-|tail	phage tail tape measure protein	tail	A4PE52	Ralstonia_virus	45.9	7.0e-153
AYA02328.1|769196_769358_-|tail	GpE family phage tail protein	tail	Q858U8	Yersinia_virus	50.0	6.0e-06
AYA02329.1|769324_769708_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AYA02330.1|769778_770294_-|tail	phage major tail tube protein	tail	A0A2H4J916	uncultured_Caudovirales_phage	57.6	1.5e-50
AYA02331.1|770315_771488_-|tail	phage tail sheath protein	tail	Q9ZXK4	Pseudomonas_virus	68.8	8.7e-155
AYA02332.1|771592_771877_-|tail	phage tail protein	tail	A0A088FV63	Escherichia_phage	63.6	8.1e-22
AYA02333.1|771887_773228_-|tail	phage tail protein	tail	D5LGZ0	Escherichia_phage	48.1	2.1e-112
AYA02334.1|773229_775662_-	SGNH/GDSL hydrolase family protein	NA	A0A2I7RES9	Vibrio_phage	27.1	1.3e-64
AYA02335.1|775661_776261_-|tail	phage tail protein I	tail	A0A1X9SH73	Bradyrhizobium_phage	34.0	1.0e-10
AYA02336.1|776257_777172_-|plate	baseplate J family protein	plate	A0A088FQL4	Escherichia_phage	46.6	5.0e-65
AYA02337.1|777168_777513_-|plate	baseplate assembly protein	plate	Q9ZXK9	Pseudomonas_virus	42.9	1.4e-20
AYA02338.1|777512_778139_-|plate	phage baseplate assembly protein V	plate	A0A2H4JFJ8	uncultured_Caudovirales_phage	37.1	7.5e-28
AYA02339.1|778211_778664_-	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	49.3	7.0e-28
AYA02340.1|778677_779172_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	55.4	7.7e-44
AYA02341.1|779155_779344_-	hypothetical protein	NA	NA	NA	NA	NA
AYA02342.1|779291_779711_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
AYA02343.1|779707_780562_-	DUF3380 domain-containing protein	NA	A0A2H4JGJ9	uncultured_Caudovirales_phage	38.9	1.0e-43
AYA02344.1|780558_780831_-|holin	phage holin family protein	holin	NA	NA	NA	NA
AYA02345.1|780827_781178_-	hypothetical protein	NA	NA	NA	NA	NA
AYA02346.1|781185_781398_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	63.6	1.5e-17
AYA02347.1|781405_781639_-	hypothetical protein	NA	NA	NA	NA	NA
AYA02348.1|781635_782085_-|head	head completion protein	head	A0A2H4JCS4	uncultured_Caudovirales_phage	32.7	2.3e-15
AYA02349.1|782205_783009_-|terminase	terminase	terminase	Q9ZXM2	Pseudomonas_virus	43.6	5.8e-41
AYA02350.1|783013_784018_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	59.9	6.4e-106
AYA02351.1|784060_784909_-|capsid	capsid protein	capsid	Q9ZXM4	Pseudomonas_virus	60.1	2.9e-59
AYA04763.1|785094_786864_+|terminase	terminase	terminase	Q9ZXM5	Pseudomonas_virus	64.5	3.8e-218
AYA02352.1|786860_787922_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	60.9	6.1e-115
AYA04764.1|789019_789955_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.4	8.3e-23
789826:789842	attR	CCTGAATCAGCTGTTTC	NA	NA	NA	NA
AYA02353.1|789951_790725_+	ABC transporter permease	NA	NA	NA	NA	NA
AYA02354.1|790724_791540_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	36.0	3.0e-37
>prophage 5
CP032279	Acinetobacter sp. WCHAc010034 chromosome, complete genome	3630637	813086	819561	3630637		Acinetobacter_phage(83.33%)	8	NA	NA
AYA02377.1|813086_813671_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	92.3	1.7e-103
AYA04770.1|813688_814735_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	86.2	3.9e-162
AYA02378.1|814753_815560_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	83.2	5.7e-121
AYA02379.1|816011_816245_-	hypothetical protein	NA	NA	NA	NA	NA
AYA02380.1|816328_817012_+	DNA mismatch repair protein MutS	NA	A0A0P0IDT4	Acinetobacter_phage	69.9	5.9e-79
AYA02381.1|817100_817655_+	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	95.7	1.4e-94
AYA04771.1|817818_818178_+	DUF861 domain-containing protein	NA	NA	NA	NA	NA
AYA02382.1|818193_819561_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.1	2.6e-17
>prophage 6
CP032279	Acinetobacter sp. WCHAc010034 chromosome, complete genome	3630637	2733909	2792304	3630637	transposase	Acinetobacter_phage(23.08%)	50	NA	NA
AYA03939.1|2733909_2734899_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AYA03940.1|2735747_2736197_+	hypothetical protein	NA	NA	NA	NA	NA
AYA03941.1|2736266_2737169_+	TIGR01777 family protein	NA	NA	NA	NA	NA
AYA03942.1|2737301_2738426_-	glycine oxidase ThiO	NA	NA	NA	NA	NA
AYA03943.1|2738447_2739461_-	porphobilinogen synthase	NA	NA	NA	NA	NA
AYA03944.1|2739564_2740065_+	thioesterase family protein	NA	NA	NA	NA	NA
AYA03945.1|2740317_2741469_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYA03946.1|2741475_2743005_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
AYA03947.1|2742950_2743205_+	hypothetical protein	NA	NA	NA	NA	NA
AYA03948.1|2743210_2744695_-	glycerol kinase	NA	NA	NA	NA	NA
AYA04942.1|2745366_2746506_+	DUF4102 domain-containing protein	NA	A0A2H4J339	uncultured_Caudovirales_phage	38.6	1.3e-70
AYA03949.1|2746773_2749080_+	hypothetical protein	NA	NA	NA	NA	NA
AYA03950.1|2749143_2749443_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AYA03951.1|2749397_2750132_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	84.0	2.8e-106
AYA03952.1|2750195_2751360_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	85.2	3.0e-139
AYA03953.1|2751466_2752417_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AYA03954.1|2753213_2753498_+	hypothetical protein	NA	NA	NA	NA	NA
AYA03955.1|2753508_2753820_+	hypothetical protein	NA	NA	NA	NA	NA
AYA03956.1|2753855_2754476_+	hypothetical protein	NA	NA	NA	NA	NA
AYA03957.1|2754722_2755766_+	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	38.9	6.1e-59
AYA04943.1|2755890_2756925_+	YqaJ-like viral recombinase	NA	A0A139ZPJ9	Marinitoga_camini_virus	41.6	2.0e-41
AYA03958.1|2757043_2757973_+	hydrolase or metal-binding protein	NA	NA	NA	NA	NA
AYA03959.1|2758068_2758299_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AYA03960.1|2758580_2758814_+	hypothetical protein	NA	NA	NA	NA	NA
AYA03961.1|2759039_2761493_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	36.5	4.2e-74
AYA03962.1|2761492_2762773_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AYA03963.1|2762801_2764652_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AYA03964.1|2764676_2767769_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	29.1	4.2e-55
AYA03965.1|2767765_2768470_+	M48 family peptidase	NA	NA	NA	NA	NA
AYA03966.1|2768493_2768883_+	hypothetical protein	NA	NA	NA	NA	NA
AYA03967.1|2769115_2771803_-	hypothetical protein	NA	NA	NA	NA	NA
AYA03968.1|2771812_2773234_-	hypothetical protein	NA	NA	NA	NA	NA
AYA03969.1|2773243_2774140_-	WYL domain-containing protein	NA	A0A0R6PH67	Moraxella_phage	31.7	5.5e-40
AYA03970.1|2774597_2775329_-	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	27.7	2.2e-10
AYA03971.1|2775491_2776169_-	anti-sigma factor	NA	NA	NA	NA	NA
AYA03972.1|2776368_2777367_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	26.1	2.3e-07
AYA03973.1|2777806_2779036_+	DUF4102 domain-containing protein	NA	A0A2H4JAT5	uncultured_Caudovirales_phage	40.0	2.5e-75
AYA04944.1|2779947_2780145_+	hypothetical protein	NA	NA	NA	NA	NA
AYA04945.1|2780258_2780474_+	transcriptional regulator	NA	NA	NA	NA	NA
AYA03974.1|2780476_2781169_+	hypothetical protein	NA	A0A0P0IDX3	Acinetobacter_phage	48.1	2.0e-26
AYA03975.1|2781174_2781513_+	hypothetical protein	NA	NA	NA	NA	NA
AYA03976.1|2781808_2782108_+	hypothetical protein	NA	NA	NA	NA	NA
AYA03977.1|2782104_2784552_+	DUF927 domain-containing protein	NA	NA	NA	NA	NA
AYA03978.1|2784985_2785849_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AYA03979.1|2786014_2787961_-	hypothetical protein	NA	NA	NA	NA	NA
AYA03980.1|2788381_2788591_-	hypothetical protein	NA	NA	NA	NA	NA
AYA03981.1|2788675_2789233_-	hypothetical protein	NA	NA	NA	NA	NA
AYA03982.1|2789286_2789601_-	hypothetical protein	NA	NA	NA	NA	NA
AYA03983.1|2789769_2790474_-	hypothetical protein	NA	NA	NA	NA	NA
AYA03984.1|2791602_2792304_+|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	55.8	3.4e-37
>prophage 7
CP032279	Acinetobacter sp. WCHAc010034 chromosome, complete genome	3630637	2798243	2804478	3630637	tail	uncultured_Caudovirales_phage(75.0%)	8	NA	NA
AYA03988.1|2798243_2799233_-	hypothetical protein	NA	A0A2H4JAG0	uncultured_Caudovirales_phage	82.0	3.7e-146
AYA03989.1|2799229_2799658_-|tail	phage tail protein	tail	A0A2H4J8N8	uncultured_Caudovirales_phage	79.3	7.8e-61
AYA03990.1|2799672_2801640_-|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	50.6	3.0e-107
AYA03991.1|2801618_2802197_-|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	42.4	5.1e-15
AYA03992.1|2802219_2802333_-|tail	GpE family phage tail protein	tail	Q9ZXK1	Pseudomonas_virus	56.8	7.8e-05
AYA03993.1|2802332_2802686_-|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	41.2	1.3e-08
AYA03994.1|2802724_2803231_-|tail	phage major tail tube protein	tail	A0A2H4JCA8	uncultured_Caudovirales_phage	85.1	5.6e-82
AYA03995.1|2803851_2804478_-	hypothetical protein	NA	A0A2H4JFB5	uncultured_Caudovirales_phage	71.0	8.7e-77
>prophage 8
CP032279	Acinetobacter sp. WCHAc010034 chromosome, complete genome	3630637	3083567	3137769	3630637	transposase	uncultured_virus(50.0%)	45	NA	NA
AYA04242.1|3083567_3084557_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AYA04243.1|3085453_3086545_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
AYA04244.1|3086656_3087316_-	ABC transporter permease	NA	NA	NA	NA	NA
AYA04245.1|3087296_3088367_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.8	4.5e-33
AYA04246.1|3088378_3089215_-	methionine transporter	NA	NA	NA	NA	NA
AYA04247.1|3089227_3090058_-	methionine transporter	NA	NA	NA	NA	NA
AYA04248.1|3090097_3091516_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
AYA04249.1|3091515_3092733_-	SfnB family sulfur acquisition oxidoreductase	NA	NA	NA	NA	NA
AYA04965.1|3092744_3093947_-	SfnB family sulfur acquisition oxidoreductase	NA	NA	NA	NA	NA
AYA04966.1|3094322_3095087_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
AYA04250.1|3095383_3095857_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AYA04251.1|3095912_3096662_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AYA04252.1|3096767_3097337_-	acyltransferase	NA	NA	NA	NA	NA
AYA04253.1|3098720_3099608_-	hypothetical protein	NA	NA	NA	NA	NA
AYA04254.1|3099743_3099953_+	DNA-binding protein	NA	NA	NA	NA	NA
AYA04967.1|3100175_3100676_+	transporter	NA	NA	NA	NA	NA
AYA04255.1|3100666_3101368_+|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	55.8	3.4e-37
AYA04256.1|3101428_3103771_+	hypothetical protein	NA	NA	NA	NA	NA
AYA04257.1|3103781_3107387_+	hypothetical protein	NA	NA	NA	NA	NA
AYA04258.1|3108508_3108799_+	hypothetical protein	NA	NA	NA	NA	NA
AYA04968.1|3108894_3109194_+	hypothetical protein	NA	NA	NA	NA	NA
AYA04259.1|3109349_3110051_+|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	55.8	3.4e-37
AYA04260.1|3110165_3111330_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	85.2	3.0e-139
AYA04261.1|3111407_3112379_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.3	1.1e-20
AYA04262.1|3112566_3113229_-	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
AYA04263.1|3113457_3113898_-	peptide-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
AYA04969.1|3113929_3114166_-	glutaredoxin	NA	M4R2D4	Vibrio_phage	42.9	2.3e-06
AYA04264.1|3114193_3114682_-	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
AYA04265.1|3114804_3115740_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYA04266.1|3115784_3117056_-	hypothetical protein	NA	NA	NA	NA	NA
AYA04267.1|3118143_3118698_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AYA04268.1|3118835_3119351_+	DUF417 family protein	NA	NA	NA	NA	NA
AYA04269.1|3120211_3121384_-	acetyl-CoA C-acyltransferase FadA	NA	NA	NA	NA	NA
AYA04270.1|3121396_3123550_-	fatty acid oxidation complex subunit alpha FadB	NA	NA	NA	NA	NA
AYA04271.1|3124029_3124245_+	hypothetical protein	NA	NA	NA	NA	NA
AYA04272.1|3124209_3124911_-|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	55.8	3.4e-37
AYA04970.1|3127527_3129399_+	DNA helicase	NA	NA	NA	NA	NA
AYA04273.1|3129402_3129690_+	hypothetical protein	NA	NA	NA	NA	NA
AYA04274.1|3129694_3130609_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
AYA04275.1|3130996_3132397_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
AYA04276.1|3132703_3134503_+	NTPase KAP	NA	NA	NA	NA	NA
AYA04277.1|3134516_3135311_+	hypothetical protein	NA	NA	NA	NA	NA
AYA04278.1|3135332_3135716_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AYA04279.1|3135658_3136048_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AYA04280.1|3136122_3137769_+|transposase	IS66-like element ISAba16 family transposase	transposase	A0A218MNE7	uncultured_virus	54.4	1.5e-144
>prophage 9
CP032279	Acinetobacter sp. WCHAc010034 chromosome, complete genome	3630637	3455801	3464219	3630637	tRNA	Moumouvirus(16.67%)	10	NA	NA
AYA04538.1|3455801_3457223_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	29.5	2.3e-48
AYA04539.1|3457564_3458542_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.1	4.0e-36
AYA04540.1|3458545_3459085_+	HAD-IIIA family hydrolase	NA	NA	NA	NA	NA
AYA04541.1|3459125_3459668_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AYA04542.1|3459657_3460224_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
AYA04543.1|3460223_3460970_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.0	2.1e-21
AYA04544.1|3461200_3461800_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	34.2	8.5e-21
AYA04999.1|3461792_3462410_+	acyltransferase	NA	NA	NA	NA	NA
AYA04545.1|3462576_3463419_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	33.8	3.6e-33
AYA04546.1|3463553_3464219_-	O-methyltransferase	NA	S5YRC3	Mycobacterium_phage	37.3	8.5e-30
>prophage 10
CP032279	Acinetobacter sp. WCHAc010034 chromosome, complete genome	3630637	3528098	3549354	3630637	portal,integrase	Acinetobacter_phage(52.63%)	27	3526026:3526067	3541093:3541134
3526026:3526067	attL	TTTTTTATTGCCTGCAGAAAGCCAATTTGCAGAACATGCCTT	NA	NA	NA	NA
AYA04597.1|3528098_3529223_-|integrase	integrase	integrase	A0A0U4JIT5	Pseudomonas_phage	30.9	9.9e-31
AYA04598.1|3529226_3529430_-	hypothetical protein	NA	NA	NA	NA	NA
AYA04599.1|3529426_3529615_-	hypothetical protein	NA	NA	NA	NA	NA
AYA04600.1|3529754_3530912_-	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	39.1	8.3e-57
AYA04601.1|3530927_3531635_-	Essential recombination function protein	NA	Q6JM07	Lactococcus_phage	56.7	9.6e-32
AYA04602.1|3531655_3532240_-	hypothetical protein	NA	NA	NA	NA	NA
AYA04603.1|3532239_3532668_-	hypothetical protein	NA	A0A0N7IRE9	Acinetobacter_phage	39.7	4.8e-18
AYA04604.1|3533009_3533351_-	hypothetical protein	NA	NA	NA	NA	NA
AYA04605.1|3533446_3534391_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.3	4.9e-15
AYA04606.1|3534568_3534784_-	KTSC domain-containing protein	NA	A0A0D4DBY2	Acinetobacter_phage	77.5	1.4e-23
AYA05008.1|3534868_3535540_-	LexA family transcriptional regulator	NA	A0A0D4DBI5	Acinetobacter_phage	62.3	2.9e-17
AYA04607.1|3535672_3535906_+	hypothetical protein	NA	A0A0D4DBS7	Acinetobacter_phage	76.3	7.5e-26
AYA04608.1|3535915_3536236_+	XRE family transcriptional regulator	NA	A0A0P0HSE9	Acinetobacter_phage	70.8	1.9e-35
AYA04609.1|3536293_3536593_+	hypothetical protein	NA	NA	NA	NA	NA
AYA04610.1|3536722_3537535_+	helix-turn-helix domain-containing protein	NA	A0A190XCE7	Acinetobacter_phage	60.8	2.6e-28
AYA04611.1|3537527_3538904_+	replicative DNA helicase	NA	A0A068CDC8	Acinetobacter_phage	35.5	3.1e-74
AYA04612.1|3539001_3539292_+	hypothetical protein	NA	NA	NA	NA	NA
AYA04613.1|3539288_3539807_+	hypothetical protein	NA	A0A077SLQ8	Escherichia_phage	45.5	3.4e-10
AYA04614.1|3540167_3540581_+	hypothetical protein	NA	A0A0P0HSP6	Acinetobacter_phage	70.1	8.1e-47
AYA04615.1|3540591_3541002_+	antitermination protein	NA	NA	NA	NA	NA
AYA04616.1|3542036_3542513_+	hypothetical protein	NA	A0A0P0IRI6	Acinetobacter_phage	69.0	1.7e-56
3541093:3541134	attR	TTTTTTATTGCCTGCAGAAAGCCAATTTGCAGAACATGCCTT	NA	NA	NA	NA
AYA04617.1|3542472_3543114_+	hypothetical protein	NA	A0A2H4JE07	uncultured_Caudovirales_phage	91.1	2.7e-113
AYA04618.1|3543165_3543633_+	DUF2280 domain-containing protein	NA	A0A2H4JI35	uncultured_Caudovirales_phage	79.7	4.7e-51
AYA04619.1|3543629_3545084_+	DNA packaging protein	NA	Q2A0C1	Sodalis_phage	60.2	1.2e-177
AYA04620.1|3545087_3547346_+|portal	portal protein p19	portal	I3PUX6	Vibrio_phage	34.1	1.0e-82
AYA04621.1|3547335_3548154_+	hypothetical protein	NA	NA	NA	NA	NA
AYA04622.1|3548157_3549354_+	hypothetical protein	NA	C8CLI7	Xylella_phage	44.1	3.2e-72
>prophage 1
CP032268	Acinetobacter sp. WCHAc010034 plasmid p1_010034, complete sequence	66814	570	56961	66814	integrase,transposase	Vibrio_phage(22.22%)	57	7458:7476	62873:62891
AYA01420.1|570_1233_+|transposase	IS1595-like element ISAcra1 family transposase	transposase	NA	NA	NA	NA
AYA01421.1|1558_2011_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
AYA01422.1|2681_3833_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYA01423.1|3829_5038_+	ABC transporter permease	NA	NA	NA	NA	NA
AYA01424.1|5041_5746_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.4	7.6e-29
AYA01425.1|5909_6116_-	hypothetical protein	NA	NA	NA	NA	NA
AYA01426.1|6634_7054_+	hypothetical protein	NA	NA	NA	NA	NA
7458:7476	attL	TAATTGAGCCAAATTTAAG	NA	NA	NA	NA
AYA01427.1|7471_8404_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	42.6	9.0e-62
AYA01428.1|8639_8987_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AYA01429.1|9326_9803_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
AYA01480.1|10057_10318_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYA01430.1|10436_10736_+	dinitrogenase iron-molybdenum cofactor	NA	NA	NA	NA	NA
AYA01431.1|11046_11790_-	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.0	5.4e-17
AYA01432.1|11858_12479_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AYA01433.1|12508_12844_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AYA01481.1|12896_13292_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AYA01434.1|13531_14314_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
AYA01435.1|14385_15258_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AYA01436.1|15260_15677_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
AYA01437.1|15678_16095_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
AYA01482.1|16217_16529_+	transcriptional regulator	NA	NA	NA	NA	NA
AYA01438.1|17218_17440_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYA01483.1|17634_17886_+	hypothetical protein	NA	NA	NA	NA	NA
AYA01439.1|18132_18354_-	antitoxin HicB	NA	NA	NA	NA	NA
AYA01440.1|18387_19587_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	28.6	1.4e-38
AYA01441.1|19980_20694_-	recombinase	NA	A0A0R6PHM5	Moraxella_phage	41.7	3.9e-41
AYA01442.1|21183_21558_-	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
AYA01443.1|21552_22263_+	hypothetical protein	NA	NA	NA	NA	NA
AYA01444.1|22275_23382_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	26.5	8.3e-30
AYA01445.1|23628_24270_+	DUF159 family protein	NA	A0A218MNF5	uncultured_virus	52.8	2.9e-51
AYA01446.1|24381_25008_+	LexA family transcriptional regulator	NA	A0A2H4J538	uncultured_Caudovirales_phage	41.6	4.1e-26
AYA01447.1|25022_26318_+	Y-family DNA polymerase	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	51.3	2.0e-128
AYA01448.1|26322_26541_+	hypothetical protein	NA	NA	NA	NA	NA
AYA01449.1|26853_30054_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AYA01484.1|32409_32832_-	hypothetical protein	NA	NA	NA	NA	NA
AYA01450.1|33801_34062_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
AYA01451.1|34051_35881_+	ferrous iron transporter B	NA	NA	NA	NA	NA
AYA01452.1|36002_36959_-	arsenic resistance protein	NA	NA	NA	NA	NA
AYA01453.1|36969_37536_-	recombinase family protein	NA	Q2A092	Sodalis_phage	37.8	4.1e-25
AYA01454.1|38091_38427_+	hypothetical protein	NA	NA	NA	NA	NA
AYA01455.1|38463_38727_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
AYA01456.1|38710_38974_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
AYA01457.1|39490_39724_+	hypothetical protein	NA	NA	NA	NA	NA
AYA01458.1|39726_40275_+	hypothetical protein	NA	NA	NA	NA	NA
AYA01459.1|40271_40505_+	hypothetical protein	NA	NA	NA	NA	NA
AYA01460.1|40495_41008_+	hypothetical protein	NA	NA	NA	NA	NA
AYA01461.1|41035_41968_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	42.8	2.6e-61
AYA01462.1|42156_42357_-	hypothetical protein	NA	NA	NA	NA	NA
AYA01463.1|42359_43292_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	42.8	2.6e-61
AYA01464.1|43333_44392_+	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
AYA01465.1|44645_46220_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	57.7	1.5e-157
AYA01466.1|46219_47470_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	27.8	1.1e-25
AYA01467.1|48664_49366_-|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	55.8	3.4e-37
AYA01468.1|52088_52388_-	hypothetical protein	NA	NA	NA	NA	NA
AYA01469.1|52390_53029_-	chromosome partitioning protein ParA	NA	J9Q7R7	Salmonella_phage	49.0	3.4e-44
AYA01470.1|53386_54370_+	RepB family plasmid replication initiator protein	NA	A0A218MNI2	uncultured_virus	38.8	2.2e-42
AYA01471.1|56028_56961_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	42.0	1.6e-58
62873:62891	attR	TAATTGAGCCAAATTTAAG	NA	NA	NA	NA
