The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029760	Riemerella anatipestifer strain RCAD0133 chromosome, complete genome	2509140	259227	319357	2509140	integrase,transposase,tRNA	Riemerella_phage(33.33%)	57	275211:275270	319385:320364
AZZ57794.1|259227_260106_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZZ57795.1|260830_262612_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
AZZ57796.1|263085_263484_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ57797.1|263500_265594_+	hypothetical protein	NA	M1NXJ3	Cellulophaga_phage	29.0	1.8e-38
AZZ57798.1|265612_265828_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ57799.1|266053_266308_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ57800.1|266312_267821_+	hypothetical protein	NA	S5W9T9	Leptospira_phage	27.5	1.3e-09
AZZ57801.1|267861_269283_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ57802.1|270087_270840_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ57803.1|270941_271250_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AZZ57804.1|271229_271526_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ57805.1|271651_272848_-	aminopeptidase	NA	NA	NA	NA	NA
AZZ57806.1|272872_273724_-	diacylglycerol kinase	NA	NA	NA	NA	NA
AZZ57807.1|273758_274481_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
AZZ57808.1|274564_274945_-	cytochrome C	NA	NA	NA	NA	NA
AZZ59744.1|274950_275151_-	hypothetical protein	NA	NA	NA	NA	NA
275211:275270	attL	ACCCGTTGTGCATTATGAAATGAAAAAAACAAGAGTTGTTTATTAGACTGAAAATCAGTA	NA	NA	NA	NA
AZZ57809.1|275297_276176_+|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ57810.1|276286_276676_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ57811.1|276780_279921_+	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
AZZ57812.1|279955_281191_+	TolC family protein	NA	NA	NA	NA	NA
AZZ57813.1|281196_282333_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AZZ57814.1|283989_284190_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ57815.1|284479_284842_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ57816.1|284951_285224_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ57817.1|285391_287371_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ57818.1|287381_288254_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ57819.1|288253_288898_+	AAA family ATPase	NA	NA	NA	NA	NA
AZZ57820.1|289016_289217_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ57821.1|289319_289502_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ57822.1|289498_289753_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ57823.1|289749_290628_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZZ57824.1|290730_292122_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
AZZ57825.1|292180_292765_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AZZ57826.1|293192_294389_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AZZ57827.1|294513_295146_+	peroxiredoxin	NA	NA	NA	NA	NA
AZZ57828.1|295224_295533_+	thioredoxin	NA	A0A2L1IVW2	Streptomyces_phage	35.7	1.0e-06
AZZ57829.1|295536_295785_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ57830.1|295871_296747_-	GTPase Era	NA	NA	NA	NA	NA
AZZ59745.1|296851_297208_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AZZ57831.1|298738_299617_+|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ59746.1|299682_299985_-	arsenate reductase family protein	NA	NA	NA	NA	NA
AZZ57832.1|300038_300863_-	RNA-binding protein	NA	NA	NA	NA	NA
AZZ57833.1|301329_301611_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ57834.1|303497_303920_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ57835.1|304064_304595_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ57836.1|305052_305340_+	XRE family transcriptional regulator	NA	F5A3H2	Riemerella_phage	46.4	3.7e-06
AZZ57837.1|305320_305941_-	phage antirepressor protein	NA	F5A3D4	Riemerella_phage	93.3	2.0e-49
AZZ57838.1|306060_306348_-	DNA-binding protein	NA	NA	NA	NA	NA
AZZ57839.1|306489_307305_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ57840.1|307459_308521_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	28.7	5.2e-21
AZZ57841.1|308533_309889_-|integrase	integrase	integrase	NA	NA	NA	NA
AZZ57842.1|310192_311962_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AZZ57843.1|311992_314953_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AZZ57844.1|315140_316670_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AZZ57845.1|316748_317828_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
AZZ57846.1|317853_318369_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
AZZ57847.1|318478_319357_-|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
319385:320364	attR	TACTGATTTTCAGTCTAATAAACAACTCTTGTTTTTTTCATTTCATAATGCACAACGGGTAAATTAAATGAACAAGAATAACACAAACAAAAATATGACAACTATTGAAAACTATTTAGACAGCCATTACATACACAGAAGTAACTGGCTAAGAGCAGCTGTATTGGGTGCTAATGATGGTATAATCTCTATTTCCAGTTTGGCGATAGGGGTTGCAGCTGCAAGTACTACGAGAGAACCTATCGTTCTTGCCACTGTGGCAGGTCTAGTAGCGGGAGCTCTTTCTATGGCAGCGGGAGAATATGTTTCTGTAAGCTCTCAAACAGATACCGAAAAGGCTGATATCGCTAGAGAAATTAAGGAATTAGAAGAAAACCCTGAATTAGAACTTCAAATTTTAGCTCAGATTTATGAAAAAAGAGGTCTTAAAAAAGATACTGCTTTACAAGTTGCTAAGGAATTAACGGAAGCTGATGCTTTGGCAGCACACATAAGAGACGAGCTAGGCATCAATGAGATTAGCCAAGCTAACCCTACACAGGCGGCATTAGCTTCAGGAGCTGCATTTACCGTAGGAGGTGTATTGCCTCTTCTAGTAACTTTATTTACTCCTGTAGAAAGTATGGAGTACTTCCTTTACGGATTTACCATTATTTTCCTTGTTATATTAGGAACTATTTCTGCAAAAACAGGTGGTGCCAATGTAGTAAGAGCCATATTAAGAATTACACTTTGGGGAACTTTAGCTATGGGATTATCGGCATTAGTAGGTTATTTATTTGGAGTTAATGTATAAATAAACTCCATTAAATTTATACTTAATAGACTGTCTTTTAGGCAGTTTATTTTTAGTTAAAATATTTTCCTACTTAGGGATTTGAAAATTTAATATTAAAATAATTATGTTTGCAAAAATTTTTAGAAAAATGATAAACTGGAAAACAACCAAAAACTACGAAGACATTACTTACAAAAAATGC	NA	NA	NA	NA
>prophage 2
CP029760	Riemerella anatipestifer strain RCAD0133 chromosome, complete genome	2509140	324949	384521	2509140	protease,transposase,tRNA	uncultured_virus(23.08%)	52	NA	NA
AZZ57851.1|324949_325828_-|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ57852.1|326189_328328_-	M3 family peptidase	NA	A0A1V0SID3	Klosneuvirus	23.8	6.7e-36
AZZ57853.1|328487_328775_+	barnase inhibitor	NA	NA	NA	NA	NA
AZZ57854.1|328771_329773_-	glycosyl transferase family 2	NA	NA	NA	NA	NA
AZZ57855.1|329788_330946_-	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
AZZ57856.1|331126_333037_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	39.6	9.4e-82
AZZ57857.1|333071_333830_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AZZ57858.1|334426_335743_-	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
AZZ57859.1|335826_336480_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	44.3	2.3e-27
AZZ57860.1|336596_337475_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZZ57861.1|337489_338596_-	peptidase M14	NA	NA	NA	NA	NA
AZZ57862.1|338931_339987_+	hypothetical protein	NA	A0A291LBC5	Escherichia_phage	31.0	5.6e-36
AZZ57863.1|340139_340685_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZZ57864.1|340980_341376_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ57865.1|341624_342239_-	DUF4230 domain-containing protein	NA	NA	NA	NA	NA
AZZ57866.1|342245_342776_-	thioredoxin	NA	NA	NA	NA	NA
AZZ57867.1|342787_343258_-	hypothetical protein	NA	A0A218MM90	uncultured_virus	41.3	8.7e-21
AZZ57868.1|343282_343768_-	cytidine deaminase	NA	NA	NA	NA	NA
AZZ57869.1|343825_345163_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ57870.1|345252_345681_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ57871.1|345829_346168_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AZZ57872.1|346226_347204_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AZZ57873.1|347208_348093_-	lipid A biosynthesis acyltransferase	NA	NA	NA	NA	NA
AZZ57874.1|348190_348742_+	thioredoxin family protein	NA	NA	NA	NA	NA
AZZ57875.1|348784_349132_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
AZZ57876.1|349128_350487_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L6G5	Tupanvirus	33.8	2.7e-51
AZZ57877.1|350634_351240_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A1V0SL12	Klosneuvirus	34.0	3.0e-18
AZZ57878.1|351347_351965_-	PorT family protein	NA	NA	NA	NA	NA
AZZ57879.1|352162_353833_-	asparagine synthase B	NA	A0A1X9VNR2	Mimivirus	41.3	3.0e-92
AZZ57880.1|354001_355750_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	28.1	4.0e-18
AZZ57881.1|355903_357532_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	67.5	7.5e-197
AZZ57882.1|357608_357887_-	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	68.6	3.4e-25
AZZ57883.1|358126_358540_-	META domain-containing protein	NA	NA	NA	NA	NA
AZZ57884.1|358557_360957_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AZZ57885.1|361095_362226_-	DNA polymerase III subunit beta	NA	NA	NA	NA	NA
AZZ57886.1|362327_363173_-	phosphoribosylformylglycinamidine synthase	NA	NA	NA	NA	NA
AZZ57887.1|363270_363675_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ57888.1|363686_366353_-	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
AZZ57889.1|366385_367021_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
AZZ57890.1|367033_368056_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	45.8	1.7e-77
AZZ57891.1|368065_369193_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
AZZ57892.1|369268_371698_-	transketolase	NA	NA	NA	NA	NA
AZZ59748.1|372081_372837_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ57893.1|372855_373491_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ57894.1|373647_374526_+|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ57895.1|375461_376340_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZZ57896.1|376816_379681_+	insulinase family protein	NA	G3MBJ8	Bacillus_virus	18.3	7.7e-11
AZZ57897.1|379740_381870_-	S46 family peptidase	NA	NA	NA	NA	NA
AZZ57898.1|381943_382375_-	DUF4268 domain-containing protein	NA	NA	NA	NA	NA
AZZ57899.1|382560_382983_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZZ57900.1|383048_383273_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ57901.1|383642_384521_+|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029760	Riemerella anatipestifer strain RCAD0133 chromosome, complete genome	2509140	639120	698069	2509140	transposase	unidentified_phage(16.67%)	51	NA	NA
AZZ58127.1|639120_639999_-|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ59754.1|640151_640946_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ58128.1|641603_641957_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58129.1|642222_643167_-	reverse transcriptase	NA	H7BUU7	unidentified_phage	34.2	4.4e-32
AZZ58130.1|643159_643681_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58131.1|643800_644169_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58132.1|644645_646556_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58133.1|646815_647199_-	DNA-binding protein	NA	NA	NA	NA	NA
AZZ59755.1|647217_647511_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58134.1|648904_650740_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.2	2.3e-61
AZZ58135.1|650820_652281_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.2	6.5e-99
AZZ58136.1|652311_653013_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ58137.1|653039_653330_+	transcriptional regulator	NA	NA	NA	NA	NA
AZZ58138.1|653384_654779_+	DUF4173 domain-containing protein	NA	NA	NA	NA	NA
AZZ58139.1|654866_657155_-	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
AZZ58140.1|657177_658035_-	ATPase	NA	NA	NA	NA	NA
AZZ58141.1|658131_660264_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AZZ58142.1|660381_660840_+	GtrA family protein	NA	NA	NA	NA	NA
AZZ58143.1|660853_661585_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AZZ58144.1|661624_663103_+	MFS transporter	NA	NA	NA	NA	NA
AZZ58145.1|663092_664154_+	DUF3810 domain-containing protein	NA	NA	NA	NA	NA
AZZ58146.1|664318_665299_-	glycosyl transferase	NA	A0A1V0SAH6	Catovirus	32.8	2.2e-10
AZZ58147.1|665330_666209_-|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ58148.1|666331_666856_-	N-acetyltransferase	NA	NA	NA	NA	NA
AZZ58149.1|666852_667074_-	PspC family transcriptional regulator	NA	NA	NA	NA	NA
AZZ58150.1|667081_668344_-	DUF2851 domain-containing protein	NA	NA	NA	NA	NA
AZZ59756.1|669503_671201_-	glycoside hydrolase	NA	NA	NA	NA	NA
AZZ58151.1|671443_672322_+|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ58152.1|672301_672895_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58153.1|673159_674038_-|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ58154.1|674182_676330_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	26.1	1.6e-13
AZZ58155.1|676398_678525_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
AZZ58156.1|678592_679576_+	pyruvate dehydrogenase complex E1 component subunit beta	NA	NA	NA	NA	NA
AZZ58157.1|679652_679991_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
AZZ58158.1|680122_681394_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
AZZ58159.1|682619_683111_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58160.1|683227_684205_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
AZZ58161.1|684234_685116_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58162.1|685166_685586_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AZZ58163.1|685591_687235_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	31.3	8.2e-58
AZZ59757.1|687373_687934_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58164.1|688143_689022_+|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ58165.1|689207_689765_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AZZ58166.1|689754_690627_+	lipoyl synthase	NA	NA	NA	NA	NA
AZZ58167.1|690694_691699_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AZZ58168.1|691792_692779_-	6-phosphofructokinase	NA	NA	NA	NA	NA
AZZ58169.1|692921_693263_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ59758.1|693364_695716_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AZZ58170.1|695753_696323_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ59759.1|696386_697037_+	PorT family protein	NA	NA	NA	NA	NA
AZZ58171.1|697190_698069_+|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
>prophage 4
CP029760	Riemerella anatipestifer strain RCAD0133 chromosome, complete genome	2509140	767446	888843	2509140	integrase,transposase,protease,tail,tRNA	Flavobacterium_phage(15.79%)	111	819822:819837	882791:882806
AZZ58229.1|767446_768325_-|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ58230.1|768389_769610_-	ABC transporter permease	NA	NA	NA	NA	NA
AZZ58231.1|769622_769982_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
AZZ58232.1|770963_771491_+	shikimate kinase	NA	NA	NA	NA	NA
AZZ58233.1|771462_771897_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
AZZ59762.1|771977_772697_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ58234.1|772734_774825_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
AZZ58235.1|774942_775887_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.1	3.0e-28
AZZ58236.1|776306_776570_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ58237.1|776595_777246_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ58238.1|777262_778438_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ58239.1|778466_779186_+	DUF4469 domain-containing protein	NA	NA	NA	NA	NA
AZZ58240.1|779393_780806_-	alkaline phosphatase	NA	NA	NA	NA	NA
AZZ58241.1|780951_782220_+	nicotinamide-nucleotide amidohydrolase family protein	NA	B5TK85	Pseudomonas_phage	39.3	2.3e-12
AZZ58242.1|782315_784388_+	M13 family peptidase	NA	A0A1V0SHG2	Klosneuvirus	32.5	2.0e-101
AZZ58243.1|784486_785206_+	CDP-alcohol phosphatidyltransferase	NA	NA	NA	NA	NA
AZZ58244.1|785215_785980_+	3'-5' exonuclease	NA	I6R9X8	Croceibacter_phage	40.8	2.9e-42
AZZ58245.1|786005_786611_+	FAA hydrolase family protein	NA	NA	NA	NA	NA
AZZ58246.1|786673_787117_+	universal stress protein	NA	NA	NA	NA	NA
AZZ58247.1|787420_788074_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58248.1|788108_788306_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58249.1|788559_789444_-	exopolyphosphatase	NA	NA	NA	NA	NA
AZZ58250.1|789450_791517_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
AZZ58251.1|791715_792291_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58252.1|792331_792661_-	DUF4190 domain-containing protein	NA	NA	NA	NA	NA
AZZ58253.1|792681_792960_-	DUF2752 domain-containing protein	NA	NA	NA	NA	NA
AZZ58254.1|793039_793582_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58255.1|793836_794847_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	34.2	1.4e-31
AZZ58256.1|794892_795588_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.8	5.7e-37
AZZ58257.1|795624_797376_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.8	4.5e-54
AZZ58258.1|797397_798138_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AZZ58259.1|798224_798719_+	metallophosphoesterase	NA	NA	NA	NA	NA
AZZ58260.1|798715_799213_+	DNA mismatch repair protein	NA	NA	NA	NA	NA
AZZ58261.1|799245_800067_+	flavin reductase family protein	NA	NA	NA	NA	NA
AZZ58262.1|800113_800662_-	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	27.0	7.0e-06
AZZ58263.1|800681_801008_-	gliding motility protein GldC	NA	NA	NA	NA	NA
AZZ58264.1|801036_802005_-	gliding motility protein GldB	NA	NA	NA	NA	NA
AZZ58265.1|802120_802912_+	NAD(+) synthase	NA	M1IPF8	Pelagibacter_phage	50.8	3.8e-61
AZZ58266.1|803237_804116_-|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ59763.1|805207_806458_+	alkaline phosphatase family protein	NA	A0A0M3PB47	Turkeypox_virus	31.0	1.9e-43
AZZ58267.1|806543_806963_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
AZZ58268.1|807083_809015_-	sulfatase	NA	NA	NA	NA	NA
AZZ58269.1|809190_809577_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ58270.1|809647_810463_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
AZZ58271.1|810488_811487_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
AZZ58272.1|812162_812435_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ58273.1|812500_813379_+|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ58274.1|813459_814056_+	WYL domain-containing protein	NA	NA	NA	NA	NA
AZZ58275.1|814056_814806_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58276.1|814875_815754_-|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ58277.1|815887_817150_+	mechanosensitive ion channel protein MscS	NA	NA	NA	NA	NA
AZZ58278.1|817175_817895_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AZZ58279.1|817888_818674_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZZ58280.1|818685_819696_+	KR domain-containing protein	NA	NA	NA	NA	NA
AZZ58281.1|819706_820252_+	hypothetical protein	NA	NA	NA	NA	NA
819822:819837	attL	TTTTCTTTCCTTTTGA	NA	NA	NA	NA
AZZ58282.1|820442_821321_+|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ58283.1|821634_822225_-	DUF3575 domain-containing protein	NA	NA	NA	NA	NA
AZZ58284.1|822318_823197_+|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ58285.1|823212_823542_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ58286.1|823552_825052_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ58287.1|825075_825757_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
AZZ58288.1|825801_826686_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ58289.1|826756_828778_-	M3 family peptidase	NA	NA	NA	NA	NA
AZZ58290.1|828876_830340_-	OmpA family protein	NA	NA	NA	NA	NA
AZZ58291.1|830362_831811_-	OmpA family protein	NA	NA	NA	NA	NA
AZZ58292.1|831835_832261_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AZZ58293.1|832282_834037_+	signal peptide peptidase SppA	NA	NA	NA	NA	NA
AZZ58294.1|834475_835354_+|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ58295.1|835350_835824_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58296.1|835925_836393_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
AZZ58297.1|836411_836798_+	HIT family protein	NA	NA	NA	NA	NA
AZZ58298.1|836835_838008_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	50.7	1.2e-108
AZZ59764.1|838484_840041_+	T9SS C-terminal target domain-containing protein	NA	NA	NA	NA	NA
AZZ58299.1|840052_840304_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ58300.1|840257_841643_+	redoxin	NA	NA	NA	NA	NA
AZZ59765.1|841720_842896_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58301.1|842932_843310_-	hypothetical protein	NA	A0A2H4J992	uncultured_Caudovirales_phage	31.1	2.2e-06
AZZ58302.1|843491_844298_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58303.1|844398_844683_-	DUF1524 domain-containing protein	NA	NA	NA	NA	NA
AZZ58304.1|844679_846179_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AZZ58305.1|846375_846675_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58306.1|846719_847598_-|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ58307.1|847672_848785_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ58308.1|848886_849606_+	DUF4469 domain-containing protein	NA	NA	NA	NA	NA
AZZ58309.1|849781_850543_-	exodeoxyribonuclease III	NA	A0A0N9QXX6	Chrysochromulina_ericina_virus	37.0	2.2e-37
AZZ58310.1|850558_851536_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
AZZ58311.1|851734_852304_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ58312.1|852358_853216_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58313.1|853332_854193_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58314.1|854486_855143_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ58315.1|855274_858460_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58316.1|859433_860174_+	T9SS C-terminal target domain-containing protein	NA	NA	NA	NA	NA
AZZ58317.1|861274_862069_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	66.7	4.8e-104
AZZ58318.1|862175_863054_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZZ58319.1|863102_865613_+	peptidase M1	NA	NA	NA	NA	NA
AZZ59766.1|865671_866388_-	PorT family protein	NA	NA	NA	NA	NA
AZZ58320.1|866440_867313_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
AZZ58321.1|867417_868320_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AZZ58322.1|868383_868947_-	elongation factor P	NA	NA	NA	NA	NA
AZZ58323.1|868973_869762_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
AZZ58324.1|869769_871164_-	bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
AZZ58325.1|871156_872191_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AZZ58326.1|872273_873485_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	31.1	4.2e-27
AZZ58327.1|873538_874546_-	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
AZZ58328.1|874545_875562_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	43.9	1.2e-67
AZZ58329.1|875752_876991_+	aspartate kinase	NA	NA	NA	NA	NA
AZZ58330.1|877016_878840_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZZ58331.1|879181_880354_+|integrase	site-specific integrase	integrase	A0A1B0WMK0	Flavobacterium_phage	48.2	3.9e-38
AZZ58332.1|880350_882912_-	hypothetical protein	NA	A0A1B0WN29	Flavobacterium_phage	30.7	1.2e-63
882791:882806	attR	TCAAAAGGAAAGAAAA	NA	NA	NA	NA
AZZ58333.1|882902_884441_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58334.1|884442_888843_-|tail	phage tail tape measure protein	tail	A0A1B0WMP0	Flavobacterium_phage	29.7	1.5e-143
>prophage 5
CP029760	Riemerella anatipestifer strain RCAD0133 chromosome, complete genome	2509140	1045394	1096449	2509140	integrase,transposase	Brevibacterium_phage(10.0%)	51	1048033:1048092	1067148:1068128
AZZ58489.1|1045394_1046273_-|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ58490.1|1046337_1047978_-	hypothetical protein	NA	NA	NA	NA	NA
1048033:1048092	attL	AACCCGTTGTGCATTATGAAATGAAAAAAACAAGAGTTGTTTATTAGACTGAAAATCAGT	NA	NA	NA	NA
AZZ58491.1|1048120_1048999_+|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ58492.1|1048991_1049246_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58493.1|1050157_1050442_+	DNA-binding protein	NA	NA	NA	NA	NA
AZZ58494.1|1050774_1051581_-	PRTRC system ThiF family protein	NA	NA	NA	NA	NA
AZZ58495.1|1052312_1053455_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58496.1|1053461_1053686_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58497.1|1053702_1053921_-	PRTRC system protein C	NA	NA	NA	NA	NA
AZZ58498.1|1053943_1054462_-	PRTRC system protein E	NA	NA	NA	NA	NA
AZZ58499.1|1054474_1054711_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58500.1|1054707_1055379_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58501.1|1055390_1055846_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58502.1|1055922_1056996_-	DUF945 domain-containing protein	NA	A0A249XNN6	Brevibacterium_phage	32.2	1.6e-33
AZZ58503.1|1057042_1057429_-	single-stranded DNA-binding protein	NA	L0P2N6	Streptococcus_phage	31.0	3.9e-11
AZZ58504.1|1057934_1058813_-|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ58505.1|1059757_1061017_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AZZ58506.1|1061282_1062188_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
AZZ58507.1|1062306_1062903_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	57.6	4.1e-60
AZZ58508.1|1064185_1065568_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ58509.1|1065626_1066154_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ58510.1|1066240_1067119_-|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ58511.1|1067225_1067747_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ58512.1|1067798_1068359_+	hypothetical protein	NA	NA	NA	NA	NA
1067148:1068128	attR	ACTGATTTTCAGTCTAATAAACAACTCTTGTTTTTTTCATTTCATAATGCACAACGGGTTTTAATCATTACCCTGTTAATGACTTGGTTTTGTAAATCACAAACTTATACACTAAGAACCTATGGAATAAATTTCCCTAAAGACAGCTATGTAAAGGACACCAAAAATGAATTACCTGCTTATGAAGGAACTTGGAAAGGAACTTGGGACGGAAAAACAATTCTCATAACATTTAAAAAAGAAACTAATATTTATGACTCTATTTTCGGTATTTATAGAGATTTTTTAATTGCTAAGTTTAAAGTATTAGATCAGAATAATAGAATTTTATTTGACAATACGAATTTATCCGATCAAGATTCTAAAATAGAAGGAGGAAAATTCAGAAAAAAAGATGATAGATATTCCTTAAACTACCATGATAAAGACATCTGTGGTCTTTGGGGCTTTATCACGATTTATTTTACAGACCATACAAAAAGTAGGTTACAATGGAACTTCTATGAGGGTAGTAATCTTATTACACCAGATTGTCCTTATTATAATGCAGCGGTATTTCCTCAACCGCTACCAAAAGACCTTGTTTTAGTAAAACAATAAAAAACACATAAAGCCCAGCTTTATAAAGTTGGGCTTTTAGCAAAAACTATTATGAAACAGTTTATTTTAATTGCTACTATGTTAGCAGCTTGGTTTTGTAAATCACAAACTTATACACTAAGAACCTATGGAATAAATTTCCCTAAAGACAGCTATGTAAAGGACACCAAAAATGAATTACCTGCTTATGAAGGAACTTGGAAAGGAACTTGGGACGGAAAAACAATTCTCATAACATTTAGGAAAGTAAAAAAATACTTAACACATAAAGTATCCAATGAATACTTCAGAGATATGTTAATAGGAAAATTTAAGGTAATGGATCAAAATAACAGAATTTTATTTGACAACTCTTATTTGTCTGATCAAGATACCAAGATA	NA	NA	NA	NA
AZZ58513.1|1068443_1069724_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	51.5	7.4e-115
AZZ58514.1|1069894_1071454_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58515.1|1071460_1072411_-	hydrogen peroxide-inducible genes activator	NA	NA	NA	NA	NA
AZZ58516.1|1072549_1074037_+	catalase	NA	A0A2K9L0T1	Tupanvirus	43.7	4.2e-93
AZZ58517.1|1074088_1075237_+	aldo/keto reductase	NA	NA	NA	NA	NA
AZZ58518.1|1075248_1076013_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AZZ58519.1|1076038_1076470_+	CMP deaminase	NA	H6WFU3	Cyanophage	45.3	4.6e-29
AZZ58520.1|1076470_1077382_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	34.8	4.4e-37
AZZ58521.1|1077386_1077899_+	NUDIX domain-containing protein	NA	A0A223LE02	Aeromonas_phage	46.9	5.9e-07
AZZ58522.1|1077977_1078484_+	ferritin	NA	NA	NA	NA	NA
AZZ58523.1|1078647_1079670_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	33.3	1.4e-07
AZZ58524.1|1079708_1080575_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AZZ58525.1|1080590_1081181_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
AZZ58526.1|1081193_1082183_+	cation transporter	NA	NA	NA	NA	NA
AZZ58527.1|1082187_1083993_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
AZZ58528.1|1083982_1084393_-	VanZ family protein	NA	NA	NA	NA	NA
AZZ58529.1|1084450_1086094_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
AZZ58530.1|1086127_1087126_+	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
AZZ58531.1|1087149_1089279_-	AAA family ATPase	NA	H7BUJ6	unidentified_phage	42.1	6.6e-84
AZZ58532.1|1089306_1089849_-	N-acetyltransferase	NA	NA	NA	NA	NA
AZZ58533.1|1089841_1090363_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AZZ58534.1|1090495_1091374_+	NifU family protein	NA	NA	NA	NA	NA
AZZ58535.1|1091399_1092428_+	ferrochelatase	NA	NA	NA	NA	NA
AZZ58536.1|1092481_1093243_+	epimerase	NA	NA	NA	NA	NA
AZZ58537.1|1093251_1094475_-	DUF5103 domain-containing protein	NA	NA	NA	NA	NA
AZZ58538.1|1094577_1095366_-	GLPGLI family protein	NA	NA	NA	NA	NA
AZZ58539.1|1095570_1096449_+|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
>prophage 6
CP029760	Riemerella anatipestifer strain RCAD0133 chromosome, complete genome	2509140	1245289	1348053	2509140	protease,transposase,tRNA	Catovirus(15.38%)	85	NA	NA
AZZ58672.1|1245289_1246168_-|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ59779.1|1246315_1247266_+	DAK2 domain-containing protein	NA	NA	NA	NA	NA
AZZ58673.1|1247437_1248640_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
AZZ58674.1|1248723_1250460_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AZZ58675.1|1250478_1250856_-	Plug domain-containing protein	NA	NA	NA	NA	NA
AZZ58676.1|1250977_1251556_+	septum formation protein Maf	NA	NA	NA	NA	NA
AZZ59780.1|1251620_1254086_+	gliding motility protein	NA	NA	NA	NA	NA
AZZ58677.1|1254091_1254766_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AZZ58678.1|1254831_1255344_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58679.1|1256114_1256993_-|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ58680.1|1257481_1258360_-|transposase	IS982 family transposase ISRa1	transposase	NA	NA	NA	NA
AZZ58681.1|1258476_1259328_-	acetyl-CoA carboxylase, carboxyltransferase subunit beta	NA	NA	NA	NA	NA
AZZ58682.1|1259439_1260510_-	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
AZZ58683.1|1260565_1261432_-	NAD kinase	NA	NA	NA	NA	NA
AZZ58684.1|1261605_1264281_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ58685.1|1264915_1265533_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ58686.1|1265512_1266391_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZZ58687.1|1266492_1268190_-	transcription termination factor Rho	NA	NA	NA	NA	NA
AZZ58688.1|1268372_1268765_+	DUF4293 domain-containing protein	NA	NA	NA	NA	NA
AZZ58689.1|1269702_1270422_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58690.1|1270485_1271364_-|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ58691.1|1271450_1273235_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AZZ58692.1|1273555_1274773_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AZZ58693.1|1274741_1275062_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AZZ58694.1|1275090_1275309_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58695.1|1275310_1276189_-|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ58696.1|1277062_1277443_+	DUF3127 domain-containing protein	NA	S0A2Y4	Cellulophaga_phage	50.4	5.0e-27
AZZ58697.1|1277515_1278199_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AZZ58698.1|1278468_1280508_-	ferrous iron transport protein B	NA	NA	NA	NA	NA
AZZ58699.1|1280540_1280792_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
AZZ58700.1|1280887_1281424_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58701.1|1281524_1282403_+|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ58702.1|1282558_1283746_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AZZ58703.1|1283762_1284983_+	GTPase HflX	NA	NA	NA	NA	NA
AZZ58704.1|1285039_1285810_-	hypothetical protein	NA	A0A0E3D9B7	Bacillus_phage	33.6	1.6e-08
AZZ58705.1|1285939_1287550_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58706.1|1287635_1288268_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
AZZ58707.1|1288279_1289107_+	sulfurtransferase	NA	NA	NA	NA	NA
AZZ58708.1|1292222_1295555_+	cell envelope biogenesis protein OmpA	NA	NA	NA	NA	NA
AZZ58709.1|1295853_1296231_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58710.1|1296531_1297410_-|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ58711.1|1297479_1298292_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58712.1|1298385_1300752_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AZZ59781.1|1300857_1301208_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58713.1|1301296_1302004_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
AZZ58714.1|1301990_1302476_+	DUF1905 domain-containing protein	NA	NA	NA	NA	NA
AZZ58715.1|1302479_1303244_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AZZ58716.1|1303350_1304460_+	DUF3078 domain-containing protein	NA	NA	NA	NA	NA
AZZ58717.1|1304557_1306753_+	glutamine synthetase type III	NA	NA	NA	NA	NA
AZZ58718.1|1306978_1307701_+	NlpC/P60 family protein	NA	NA	NA	NA	NA
AZZ58719.1|1307800_1308679_-|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ58720.1|1308800_1309976_+	CapA family protein	NA	S4VS02	Pandoravirus	26.1	3.3e-08
AZZ58721.1|1310501_1311053_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58722.1|1311080_1314014_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58723.1|1314298_1315603_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AZZ58724.1|1315664_1317650_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	44.9	1.7e-105
AZZ58725.1|1317665_1318034_-	ribosome silencing factor	NA	NA	NA	NA	NA
AZZ58726.1|1318109_1318820_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
AZZ58727.1|1318813_1319908_-	YjgP/YjgQ family permease	NA	NA	NA	NA	NA
AZZ58728.1|1320108_1321245_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	43.2	4.0e-80
AZZ58729.1|1321255_1321654_-	DUF4296 domain-containing protein	NA	NA	NA	NA	NA
AZZ58730.1|1321650_1322367_-	polyprenol monophosphomannose synthase	NA	A0A0N7A8R9	Sulfolobus_monocaudavirus	38.2	1.7e-28
AZZ58731.1|1323065_1323449_+	DNA-binding protein	NA	NA	NA	NA	NA
AZZ58732.1|1323612_1325127_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ58733.1|1325168_1326047_+|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ58734.1|1326228_1326606_-	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
AZZ58735.1|1326610_1329202_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	23.6	4.5e-42
AZZ58736.1|1329289_1331773_-	gliding motility protein	NA	A0A1X9I5D6	Streptococcus_phage	33.5	3.0e-19
AZZ58737.1|1331775_1332657_-	gliding motility protein	NA	NA	NA	NA	NA
AZZ58738.1|1332685_1333789_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
AZZ58739.1|1333805_1334933_-	EpsG family protein	NA	NA	NA	NA	NA
AZZ58740.1|1334942_1335935_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	35.8	1.8e-12
AZZ58741.1|1335936_1337001_-	arginase	NA	NA	NA	NA	NA
AZZ58742.1|1337012_1339532_-	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	39.9	3.9e-144
AZZ58743.1|1339718_1339973_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AZZ58744.1|1340013_1340970_-	signal recognition particle-docking protein FtsY	NA	D6PHS7	uncultured_phage	38.9	2.6e-19
AZZ58745.1|1341070_1341220_-	DUF4295 domain-containing protein	NA	NA	NA	NA	NA
AZZ58746.1|1341242_1341425_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
AZZ58747.1|1341435_1341672_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
AZZ58748.1|1341943_1343992_-	S9 family peptidase	NA	F2Y2Z7	Organic_Lake_phycodnavirus	25.2	5.3e-38
AZZ58749.1|1344091_1344835_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AZZ58750.1|1344856_1345501_-	DUF4271 domain-containing protein	NA	NA	NA	NA	NA
AZZ58751.1|1345556_1346651_-	acyltransferase	NA	NA	NA	NA	NA
AZZ58752.1|1346773_1347112_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58753.1|1347198_1348053_-|protease	metalloprotease	protease	A0A1I9SA48	Rhodococcus_phage	39.6	2.9e-38
>prophage 7
CP029760	Riemerella anatipestifer strain RCAD0133 chromosome, complete genome	2509140	1360558	1412831	2509140	tail,transposase,protease,tRNA	Hokovirus(12.5%)	47	NA	NA
AZZ58764.1|1360558_1361437_+|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ58765.1|1361450_1362227_-	GLPGLI family protein	NA	NA	NA	NA	NA
AZZ58766.1|1362327_1363206_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZZ59783.1|1363275_1363878_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58767.1|1363864_1364422_-	ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	28.6	2.3e-12
AZZ58768.1|1364477_1365356_+|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ58769.1|1365619_1367983_-	peptidoglycan glycosyltransferase	NA	NA	NA	NA	NA
AZZ58770.1|1367995_1368466_-	gliding motility lipoprotein GldH	NA	NA	NA	NA	NA
AZZ58771.1|1368452_1369727_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59784.1|1369827_1370244_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AZZ58772.1|1370348_1370837_+	cytochrome C	NA	NA	NA	NA	NA
AZZ58773.1|1370843_1371251_+	DUF393 domain-containing protein	NA	NA	NA	NA	NA
AZZ59785.1|1371277_1372075_+	GLPGLI family protein	NA	NA	NA	NA	NA
AZZ58774.1|1372086_1372962_-	mechanosensitive ion channel protein MscS	NA	NA	NA	NA	NA
AZZ58775.1|1373038_1375159_-|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	30.2	2.4e-57
AZZ59786.1|1375293_1376061_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	34.0	7.7e-35
AZZ58776.1|1376081_1376984_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AZZ58777.1|1376983_1377946_-	lipopolysaccharide heptosyltransferase family protein	NA	NA	NA	NA	NA
AZZ58778.1|1377955_1378375_-	SufE family protein	NA	NA	NA	NA	NA
AZZ58779.1|1378396_1379362_-	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AZZ58780.1|1379433_1381941_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	34.1	5.1e-120
AZZ58781.1|1382086_1382299_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
AZZ58782.1|1382295_1383399_+	glycosyl transferase family 1	NA	NA	NA	NA	NA
AZZ58783.1|1383483_1383915_+	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
AZZ58784.1|1383980_1386146_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.2	8.0e-61
AZZ58785.1|1387003_1387549_-	GLPGLI family protein	NA	NA	NA	NA	NA
AZZ58786.1|1387866_1388610_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	NA	NA	NA	NA
AZZ58787.1|1388657_1389332_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	44.4	8.3e-49
AZZ58788.1|1389336_1390191_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58789.1|1390254_1390842_+	thymidine kinase	NA	Q6GYZ9	Mycoplasma_phage	41.5	2.1e-32
AZZ58790.1|1390848_1393293_+	bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase	NA	NA	NA	NA	NA
AZZ58791.1|1393295_1394603_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
AZZ58792.1|1394612_1396271_-	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	32.9	8.5e-55
AZZ59787.1|1397792_1398266_+	muramidase	NA	NA	NA	NA	NA
AZZ58793.1|1398434_1400087_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AZZ58794.1|1400097_1401402_+	biotin attachment protein	NA	NA	NA	NA	NA
AZZ58795.1|1401382_1402792_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ58796.1|1402806_1403445_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AZZ58797.1|1406325_1406556_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58798.1|1406736_1407756_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
AZZ58799.1|1407863_1408742_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZZ58800.1|1408783_1409506_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58801.1|1409718_1410345_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
AZZ58802.1|1410378_1410636_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
AZZ58803.1|1410785_1411334_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58804.1|1411363_1411921_-	thioredoxin family protein	NA	NA	NA	NA	NA
AZZ58805.1|1411922_1412831_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 8
CP029760	Riemerella anatipestifer strain RCAD0133 chromosome, complete genome	2509140	1431956	1477341	2509140	transposase,tRNA	Moumouvirus(20.0%)	38	NA	NA
AZZ58825.1|1431956_1435355_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2P1ELB8	Moumouvirus	31.4	3.2e-157
AZZ58826.1|1435870_1436425_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZZ58827.1|1436505_1437219_+	heavy metal transporter	NA	NA	NA	NA	NA
AZZ58828.1|1437381_1438578_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AZZ58829.1|1439190_1440069_+|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ58830.1|1441955_1443488_+	YdiU family protein	NA	NA	NA	NA	NA
AZZ58831.1|1443527_1444796_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ58832.1|1444950_1445829_-|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ58833.1|1445925_1446222_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AZZ58834.1|1446475_1447354_+|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ58835.1|1447333_1449346_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AZZ58836.1|1449367_1451599_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	28.6	2.3e-39
AZZ58837.1|1451573_1452449_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58838.1|1452448_1452784_-	SPASM domain-containing protein	NA	NA	NA	NA	NA
AZZ58839.1|1452837_1453716_-|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ58840.1|1453849_1454053_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58841.1|1454302_1454984_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
AZZ58842.1|1454955_1455252_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58843.1|1455402_1457088_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZZ58844.1|1457161_1457746_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
AZZ58845.1|1457750_1458035_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
AZZ58846.1|1458037_1458226_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ58847.1|1458279_1458873_-	aminotransferase class IV	NA	NA	NA	NA	NA
AZZ58848.1|1458856_1459834_-	aminodeoxychorismate synthase component I	NA	NA	NA	NA	NA
AZZ58849.1|1459878_1460619_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ58850.1|1460641_1461769_+	AI-2E family transporter	NA	NA	NA	NA	NA
AZZ58851.1|1461758_1461977_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ58852.1|1461973_1463353_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AZZ58853.1|1463431_1464814_-	phosphoglucosamine mutase	NA	A0A1X9I671	Streptococcus_phage	24.2	3.6e-06
AZZ58854.1|1464857_1466294_-	RND transporter	NA	NA	NA	NA	NA
AZZ58855.1|1466776_1467655_+|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ58856.1|1468425_1469496_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AZZ58857.1|1470116_1471721_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	49.4	3.3e-136
AZZ58858.1|1471855_1472758_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
AZZ58859.1|1472875_1475041_+	patatin	NA	A0A1V0SFX9	Hokovirus	27.2	3.6e-13
AZZ58860.1|1475056_1475479_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
AZZ58861.1|1475580_1476183_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58862.1|1476462_1477341_-|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
>prophage 9
CP029760	Riemerella anatipestifer strain RCAD0133 chromosome, complete genome	2509140	1486858	1509183	2509140	protease,transposase,tRNA	Wolbachia_phage(100.0%)	17	NA	NA
AZZ58869.1|1486858_1487737_-|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ58870.1|1487792_1488290_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ58871.1|1488501_1489332_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZZ58872.1|1489392_1491255_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
AZZ58873.1|1491998_1492334_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58874.1|1492591_1493470_-|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ58875.1|1493943_1494822_-|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ58876.1|1495038_1496043_+	adenosine deaminase	NA	NA	NA	NA	NA
AZZ58877.1|1496098_1496599_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58878.1|1496662_1497853_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AZZ58879.1|1499636_1502780_-	T9SS C-terminal target domain-containing protein	NA	NA	NA	NA	NA
AZZ58880.1|1502751_1503291_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58881.1|1503670_1505467_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.3	7.1e-63
AZZ59790.1|1505485_1506220_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AZZ58882.1|1506234_1507215_+	endonuclease	NA	NA	NA	NA	NA
AZZ58883.1|1507315_1508194_+|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ58884.1|1508304_1509183_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 10
CP029760	Riemerella anatipestifer strain RCAD0133 chromosome, complete genome	2509140	1600299	1637805	2509140	protease,integrase,transposase,tRNA	Enterobacteria_phage(50.0%)	36	1604774:1604790	1621975:1621991
AZZ58952.1|1600299_1601178_+|transposase	IS982 family transposase ISRa1	transposase	NA	NA	NA	NA
AZZ58953.1|1601483_1602209_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58954.1|1602171_1602951_-	relaxase	NA	NA	NA	NA	NA
AZZ58955.1|1602943_1603393_-	special sigma factor	NA	NA	NA	NA	NA
1604774:1604790	attL	AATTATTTGATTTTCTT	NA	NA	NA	NA
AZZ58956.1|1604802_1606029_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58957.1|1606075_1606354_-	DNA-binding protein	NA	NA	NA	NA	NA
AZZ58958.1|1606504_1607803_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58959.1|1607812_1608499_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59793.1|1608491_1608992_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZZ58960.1|1609096_1610317_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AZZ58961.1|1610433_1611115_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
AZZ58962.1|1611283_1612162_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZZ58963.1|1612348_1613971_+	peptidase S41	NA	NA	NA	NA	NA
AZZ58964.1|1614013_1614760_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AZZ58965.1|1614769_1615795_-	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	24.6	5.2e-10
AZZ58966.1|1615852_1616512_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ58967.1|1616974_1617343_-	YraN family protein	NA	NA	NA	NA	NA
AZZ58968.1|1617346_1618276_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
AZZ58969.1|1618282_1618969_-	lysine transporter LysE	NA	NA	NA	NA	NA
AZZ58970.1|1619015_1619984_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AZZ58971.1|1620656_1621535_+|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ58972.1|1621962_1622553_-	RNA polymerase subunit sigma-24	NA	NA	NA	NA	NA
1621975:1621991	attR	AATTATTTGATTTTCTT	NA	NA	NA	NA
AZZ58973.1|1622729_1624244_-	ATP-binding protein	NA	NA	NA	NA	NA
AZZ58974.1|1624287_1625376_-	mannose-1-phosphate guanylyltransferase	NA	NA	NA	NA	NA
AZZ58975.1|1625385_1625967_-	transcription elongation protein SprT	NA	NA	NA	NA	NA
AZZ58976.1|1626047_1626656_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
AZZ58977.1|1626712_1627651_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	35.1	5.0e-44
AZZ58978.1|1627745_1629257_-	G-D-S-L family lipolytic protein	NA	NA	NA	NA	NA
AZZ58979.1|1629269_1630505_-	aromatic hydrocarbon degradation protein	NA	NA	NA	NA	NA
AZZ58980.1|1630678_1631227_-	DinB family protein	NA	NA	NA	NA	NA
AZZ58981.1|1631277_1631802_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AZZ58982.1|1631827_1633828_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
AZZ58983.1|1633985_1635032_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ58984.1|1635094_1635856_-	amidohydrolase	NA	NA	NA	NA	NA
AZZ58985.1|1635936_1636365_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ58986.1|1636473_1637805_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
>prophage 11
CP029760	Riemerella anatipestifer strain RCAD0133 chromosome, complete genome	2509140	1661684	1718872	2509140	transposase	Paramecium_bursaria_Chlorella_virus(12.5%)	58	NA	NA
AZZ59002.1|1661684_1662563_+|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ59003.1|1663571_1664258_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59004.1|1664285_1664498_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59005.1|1664931_1665651_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ59006.1|1665663_1669896_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ59007.1|1669936_1670452_+	peptide-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
AZZ59008.1|1670462_1670894_-	nucleoside deaminase	NA	NA	NA	NA	NA
AZZ59795.1|1670959_1671460_-	superoxide dismutase family protein	NA	M1I1U1	Paramecium_bursaria_Chlorella_virus	39.6	1.8e-16
AZZ59009.1|1671579_1673253_+	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
AZZ59010.1|1673343_1675476_+	S46 family peptidase	NA	NA	NA	NA	NA
AZZ59011.1|1675545_1676550_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
AZZ59012.1|1676721_1676877_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
AZZ59013.1|1677050_1677761_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.8	7.9e-26
AZZ59014.1|1677773_1678481_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
AZZ59015.1|1678485_1679940_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.9	2.7e-12
AZZ59016.1|1679940_1680522_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	42.3	1.5e-30
AZZ59017.1|1680571_1681657_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
AZZ59018.1|1681746_1682286_+	DUF177 domain-containing protein	NA	NA	NA	NA	NA
AZZ59019.1|1682331_1682535_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
AZZ59020.1|1682629_1683121_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
AZZ59021.1|1683206_1684562_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AZZ59796.1|1684681_1685935_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.9	1.0e-31
AZZ59022.1|1685935_1686751_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ59023.1|1686743_1687736_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ59024.1|1687739_1688702_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ59025.1|1688704_1689739_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AZZ59026.1|1689739_1690678_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AZZ59027.1|1690690_1691032_-	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	55.1	5.3e-28
AZZ59028.1|1691179_1693306_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
AZZ59029.1|1693410_1694349_+	MCE family protein	NA	NA	NA	NA	NA
AZZ59030.1|1694367_1695705_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
AZZ59031.1|1695805_1696621_-	GLPGLI family protein	NA	NA	NA	NA	NA
AZZ59032.1|1696681_1696930_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59033.1|1697052_1697838_+	CoB--CoM heterodisulfide reductase	NA	NA	NA	NA	NA
AZZ59034.1|1697863_1698358_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ59035.1|1698699_1699578_+|transposase	IS982 family transposase ISRa1	transposase	NA	NA	NA	NA
AZZ59036.1|1700166_1700664_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59037.1|1700630_1701959_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AZZ59038.1|1702302_1702581_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ59039.1|1702629_1703397_+	GLPGLI family protein	NA	NA	NA	NA	NA
AZZ59040.1|1703576_1704080_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ59041.1|1704405_1705284_-|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ59042.1|1705730_1706609_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZZ59043.1|1706664_1707438_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ59044.1|1707439_1708075_+	HAD family hydrolase	NA	NA	NA	NA	NA
AZZ59045.1|1708095_1708974_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZZ59046.1|1709173_1709413_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	39.7	2.8e-07
AZZ59047.1|1709440_1710685_+	beta-ketoacyl-[acyl-carrier-protein] synthase II	NA	NA	NA	NA	NA
AZZ59048.1|1710688_1711432_+	ribonuclease III	NA	A0A0P0YM82	Yellowstone_lake_phycodnavirus	32.4	1.7e-18
AZZ59049.1|1711418_1711889_+	IPExxxVDY family protein	NA	NA	NA	NA	NA
AZZ59050.1|1711881_1713327_+	pyruvate kinase	NA	NA	NA	NA	NA
AZZ59051.1|1713408_1714692_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AZZ59052.1|1715048_1715588_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59053.1|1715594_1715798_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59054.1|1715790_1716321_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59055.1|1716436_1716877_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59056.1|1716878_1717226_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59057.1|1717993_1718872_+|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
>prophage 12
CP029760	Riemerella anatipestifer strain RCAD0133 chromosome, complete genome	2509140	1846216	1882809	2509140	transposase,tRNA	Agrobacterium_phage(33.33%)	34	NA	NA
AZZ59188.1|1846216_1847095_+|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ59189.1|1847627_1850219_+	ATP-dependent chaperone ClpB	NA	A0A223W0B1	Agrobacterium_phage	33.8	4.1e-120
AZZ59190.1|1850410_1851718_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
AZZ59191.1|1851878_1852904_+	rod shape-determining protein	NA	NA	NA	NA	NA
AZZ59192.1|1852927_1853782_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AZZ59193.1|1853771_1854281_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AZZ59194.1|1854277_1856320_+	peptidoglycan glycosyltransferase	NA	NA	NA	NA	NA
AZZ59195.1|1856294_1857542_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
AZZ59805.1|1857621_1858458_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ59196.1|1858548_1859196_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
AZZ59197.1|1859200_1859914_+	hydrolase Nlp/P60	NA	D2KRB9	Lactobacillus_phage	26.6	4.1e-06
AZZ59198.1|1859914_1860370_+	DUF1648 domain-containing protein	NA	NA	NA	NA	NA
AZZ59199.1|1860372_1861602_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
AZZ59200.1|1861703_1863731_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	26.3	5.3e-06
AZZ59201.1|1863771_1864209_+	thioredoxin family protein	NA	NA	NA	NA	NA
AZZ59202.1|1864200_1864527_-	N-acetyltransferase	NA	NA	NA	NA	NA
AZZ59203.1|1864621_1865032_+	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
AZZ59204.1|1865117_1865996_-|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ59205.1|1866627_1867113_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ59206.1|1867168_1867852_+	GLPGLI family protein	NA	NA	NA	NA	NA
AZZ59207.1|1868267_1868975_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ59208.1|1869053_1870079_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
AZZ59209.1|1870102_1870762_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AZZ59210.1|1870773_1871694_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
AZZ59211.1|1871668_1872946_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
AZZ59212.1|1873250_1874129_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZZ59213.1|1874190_1874763_+	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
AZZ59214.1|1874931_1875432_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ59215.1|1875692_1876571_+|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ59216.1|1877277_1877631_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ59217.1|1877672_1878737_-	DUF4407 domain-containing protein	NA	NA	NA	NA	NA
AZZ59218.1|1879642_1880521_-|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ59219.1|1880623_1881715_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59220.1|1881930_1882809_-|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
>prophage 13
CP029760	Riemerella anatipestifer strain RCAD0133 chromosome, complete genome	2509140	1945372	1952370	2509140		Enterobacteria_phage(33.33%)	8	NA	NA
AZZ59279.1|1945372_1946506_+	pyridoxal phosphate-dependent aminotransferase	NA	A0A0P0YLZ6	Yellowstone_lake_phycodnavirus	23.8	4.8e-17
AZZ59808.1|1946653_1947238_+	sugar transferase	NA	NA	NA	NA	NA
AZZ59280.1|1947270_1947816_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	49.1	6.1e-42
AZZ59281.1|1947826_1948909_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.4	1.4e-85
AZZ59282.1|1948913_1949771_+	glucose-1-phosphate thymidylyltransferase	NA	H9NC64	Sphingomonas_phage	62.5	6.5e-99
AZZ59283.1|1949876_1951181_+	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
AZZ59284.1|1951191_1951683_-	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	42.5	6.3e-30
AZZ59285.1|1951764_1952370_+	LemA family protein	NA	A0A1X9IGG1	Lactococcus_phage	31.0	2.1e-11
>prophage 14
CP029760	Riemerella anatipestifer strain RCAD0133 chromosome, complete genome	2509140	2241436	2314942	2509140	protease,transposase	Vibrio_phage(25.0%)	59	NA	NA
AZZ59514.1|2241436_2242315_-|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ59515.1|2243749_2244412_-	CoA transferase subunit B	NA	NA	NA	NA	NA
AZZ59516.1|2244420_2245128_-	CoA transferase subunit A	NA	NA	NA	NA	NA
AZZ59517.1|2245143_2245419_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59518.1|2245448_2246630_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AZZ59519.1|2246705_2246909_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ59520.1|2248002_2248350_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59521.1|2248474_2249287_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
AZZ59522.1|2249364_2249628_-	DUF3098 domain-containing protein	NA	NA	NA	NA	NA
AZZ59523.1|2249631_2250531_-	ABC transporter permease	NA	NA	NA	NA	NA
AZZ59524.1|2250631_2251420_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
AZZ59525.1|2251439_2252789_+	magnesium transporter	NA	NA	NA	NA	NA
AZZ59526.1|2252870_2253380_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ59527.1|2253464_2253716_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ59528.1|2253687_2253993_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ59529.1|2254033_2254600_+	cysteine hydrolase	NA	NA	NA	NA	NA
AZZ59815.1|2254679_2255366_+	NAD-dependent deacylase	NA	R9TG77	Vibrio_phage	39.8	3.3e-29
AZZ59530.1|2255362_2256016_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
AZZ59531.1|2256058_2256967_-	magnesium transporter CorA	NA	NA	NA	NA	NA
AZZ59532.1|2257040_2257928_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
AZZ59533.1|2258179_2259058_-|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ59534.1|2259187_2261911_+	SusC/RagA family TonB-linked outer membrane protein	NA	NA	NA	NA	NA
AZZ59535.1|2261943_2263536_+	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
AZZ59536.1|2263619_2265767_+	glycoside hydrolase family 97 protein	NA	NA	NA	NA	NA
AZZ59537.1|2265938_2269178_+	peptidase S41	NA	NA	NA	NA	NA
AZZ59538.1|2269194_2270073_-|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ59539.1|2271568_2271826_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ59540.1|2273293_2274502_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ59541.1|2274522_2275593_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ59542.1|2277154_2277451_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ59543.1|2277447_2279478_-	recombinase	NA	NA	NA	NA	NA
AZZ59544.1|2279483_2280128_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AZZ59816.1|2280197_2281403_-	metallophosphoesterase	NA	NA	NA	NA	NA
AZZ59545.1|2281484_2282249_-	PorT family protein	NA	NA	NA	NA	NA
AZZ59546.1|2282293_2283016_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
AZZ59547.1|2283028_2283598_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59548.1|2283742_2284810_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
AZZ59549.1|2285175_2286462_-	peptidase	NA	NA	NA	NA	NA
AZZ59550.1|2286585_2287677_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
AZZ59551.1|2287753_2288407_-	fructose-6-phosphate aldolase	NA	H8ZMU3	Synechococcus_phage	46.8	8.3e-46
AZZ59552.1|2288531_2289350_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AZZ59553.1|2289437_2290520_+	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	48.0	9.3e-26
AZZ59554.1|2290742_2291192_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZZ59555.1|2291216_2293622_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
AZZ59556.1|2294087_2295266_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
AZZ59557.1|2295316_2297095_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AZZ59558.1|2297177_2299472_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59559.1|2301171_2302122_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AZZ59560.1|2302101_2302980_-|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ59561.1|2303374_2303728_+	four helix bundle protein	NA	NA	NA	NA	NA
AZZ59562.1|2307680_2308400_-	DUF4469 domain-containing protein	NA	NA	NA	NA	NA
AZZ59563.1|2308591_2309470_-|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ59564.1|2309534_2310620_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59565.1|2310603_2311194_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59566.1|2311296_2311506_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59567.1|2311841_2312612_-	TIGR02757 family protein	NA	NA	NA	NA	NA
AZZ59568.1|2312611_2313526_-	ribonuclease Z	NA	NA	NA	NA	NA
AZZ59569.1|2313539_2314115_-	non-canonical purine NTP pyrophosphatase, RdgB/HAM1 family	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	30.6	1.4e-12
AZZ59570.1|2314129_2314942_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 15
CP029760	Riemerella anatipestifer strain RCAD0133 chromosome, complete genome	2509140	2363880	2437670	2509140	tail,transposase,tRNA	Tupanvirus(15.38%)	60	NA	NA
AZZ59618.1|2363880_2364759_+|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ59619.1|2364760_2368651_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ59620.1|2368655_2369792_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ59621.1|2369923_2370751_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ59622.1|2370761_2371307_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ59623.1|2371320_2372055_+	gliding motility protein Gldf	NA	NA	NA	NA	NA
AZZ59624.1|2372057_2373725_+	gliding motility-associated ABC transporter substrate-binding protein GldG	NA	NA	NA	NA	NA
AZZ59625.1|2373736_2374813_-	glycosyltransferase	NA	NA	NA	NA	NA
AZZ59626.1|2374817_2377022_-	DNA helicase RecQ	NA	A0A2K9L3P7	Tupanvirus	38.5	8.1e-85
AZZ59627.1|2377165_2378125_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	32.9	1.5e-32
AZZ59628.1|2378145_2378973_+	preprotein translocase subunit TatC	NA	NA	NA	NA	NA
AZZ59629.1|2378976_2379534_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ59630.1|2379642_2383131_+	DUF2723 domain-containing protein	NA	NA	NA	NA	NA
AZZ59631.1|2383547_2384048_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59632.1|2384050_2384733_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
AZZ59633.1|2384971_2385727_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
AZZ59634.1|2385745_2386096_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59635.1|2386126_2387200_-	doxx family protein	NA	NA	NA	NA	NA
AZZ59636.1|2387192_2387738_-	DUF1599 domain-containing protein	NA	NA	NA	NA	NA
AZZ59637.1|2387967_2388294_+	single-stranded DNA-binding protein	NA	E1ABY7	Pseudoalteromonas_phage	47.5	1.3e-18
AZZ59638.1|2388362_2390297_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	43.5	2.0e-135
AZZ59639.1|2390546_2391074_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59640.1|2391124_2391439_-	DUF4286 domain-containing protein	NA	NA	NA	NA	NA
AZZ59641.1|2391564_2394090_+	DNA gyrase subunit A	NA	A0A172JHV7	Bacillus_phage	31.3	3.7e-102
AZZ59642.1|2394125_2395511_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ59643.1|2395590_2395938_+	YtxH domain-containing protein	NA	NA	NA	NA	NA
AZZ59644.1|2396010_2396319_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ59645.1|2396320_2396827_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ59646.1|2396934_2398599_+	DEAD/DEAH box helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	33.6	5.6e-54
AZZ59647.1|2398753_2399326_-	YceI family protein	NA	NA	NA	NA	NA
AZZ59648.1|2399396_2400467_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59649.1|2400500_2401166_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59650.1|2401155_2401698_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AZZ59651.1|2401827_2403519_-	peptidase S8	NA	A0A1B0T6A2	Bacillus_phage	37.3	4.8e-21
AZZ59652.1|2403575_2404184_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59653.1|2404184_2405795_-	signal peptidase I	NA	NA	NA	NA	NA
AZZ59654.1|2405826_2406525_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
AZZ59821.1|2406537_2407122_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59655.1|2407126_2408017_-	ParB/RepB/Spo0J family partition protein	NA	S5VSZ7	Leptospira_phage	41.5	5.5e-16
AZZ59656.1|2408043_2408817_-	ParA family protein	NA	Q8JL10	Natrialba_phage	30.1	1.6e-24
AZZ59657.1|2408985_2409837_-	energy transducer TonB	NA	NA	NA	NA	NA
AZZ59658.1|2410558_2411215_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AZZ59659.1|2411251_2412436_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
AZZ59660.1|2412474_2413827_+	MATE family efflux transporter	NA	NA	NA	NA	NA
AZZ59661.1|2413963_2414401_+	VOC family protein	NA	NA	NA	NA	NA
AZZ59662.1|2414583_2415462_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZZ59663.1|2415609_2416149_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ59664.1|2416154_2417021_+	GLPGLI family protein	NA	NA	NA	NA	NA
AZZ59665.1|2417091_2418441_-	ATP-dependent helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	1.3e-48
AZZ59666.1|2418590_2419721_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AZZ59667.1|2419881_2421915_-|tRNA	methionine--tRNA ligase	tRNA	A0A2K9KZR3	Tupanvirus	33.0	5.0e-81
AZZ59668.1|2422915_2424343_-	adenylosuccinate lyase	NA	NA	NA	NA	NA
AZZ59669.1|2424426_2425545_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZZ59670.1|2425848_2426331_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ59671.1|2426323_2427202_-|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ59672.1|2428059_2429898_-	hypothetical protein	NA	A0A1B0WN29	Flavobacterium_phage	28.0	2.9e-56
AZZ59673.1|2429887_2431957_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59674.1|2431946_2432345_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59675.1|2432322_2436507_-|tail	phage tail tape measure protein	tail	A0A1B0WN72	Flavobacterium_phage	28.0	2.8e-86
AZZ59676.1|2436791_2437670_-|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
>prophage 16
CP029760	Riemerella anatipestifer strain RCAD0133 chromosome, complete genome	2509140	2442654	2496833	2509140	protease,transposase,tRNA,holin	Flavobacterium_phage(33.33%)	54	NA	NA
AZZ59685.1|2442654_2443533_+|transposase	IS982-like element ISRa1 family transposase	transposase	NA	NA	NA	NA
AZZ59686.1|2443847_2444480_-	hypothetical protein	NA	A0A0A0YPJ3	Flavobacterium_phage	35.6	9.9e-20
AZZ59687.1|2444905_2445184_+	XRE family transcriptional regulator	NA	F5A3H2	Riemerella_phage	98.9	9.0e-42
AZZ59688.1|2445831_2446395_-	N-acetylmuramoyl-L-alanine amidase	NA	E7D0G0	Riemerella_phage	91.2	4.9e-95
AZZ59689.1|2446396_2447071_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59690.1|2447042_2447531_-|holin	holin	holin	NA	NA	NA	NA
AZZ59691.1|2447531_2447969_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
AZZ59692.1|2447980_2448421_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59693.1|2448432_2450241_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59694.1|2450245_2450821_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59695.1|2450864_2451743_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59696.1|2451764_2453111_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59697.1|2453110_2453434_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59822.1|2453707_2455183_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59823.1|2455220_2455757_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59698.1|2455919_2457245_-	DNA methylase	NA	A0A1B0RXE5	Streptococcus_phage	36.0	2.6e-70
AZZ59699.1|2457237_2457939_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59700.1|2457999_2458287_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59824.1|2458286_2458730_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59701.1|2458840_2459260_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59825.1|2459274_2460135_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59702.1|2460289_2460718_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59703.1|2460722_2461565_-	hypothetical protein	NA	A0A218M6Z9	Flavobacterium_phage	30.6	4.8e-14
AZZ59704.1|2461584_2462031_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59705.1|2462020_2462521_-	hypothetical protein	NA	NA	NA	NA	NA
AZZ59706.1|2463114_2463993_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZZ59707.1|2464346_2464961_+	deoxynucleoside kinase	NA	A0A127AVX2	Bacillus_phage	37.0	4.9e-32
AZZ59708.1|2465033_2465534_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ59709.1|2465658_2467284_+	GMC family oxidoreductase	NA	NA	NA	NA	NA
AZZ59710.1|2467373_2468126_+	bifunctional NAD pyrophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
AZZ59711.1|2468134_2469082_+	metallophosphatase	NA	NA	NA	NA	NA
AZZ59712.1|2469083_2471318_+	T9SS C-terminal target domain-containing protein	NA	NA	NA	NA	NA
AZZ59713.1|2471329_2472007_+	DNA recombination protein RecO	NA	NA	NA	NA	NA
AZZ59714.1|2472286_2472847_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AZZ59715.1|2472853_2473195_-	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
AZZ59716.1|2474585_2475464_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
AZZ59717.1|2475571_2475940_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ59718.1|2476012_2477071_+	ATP synthase F0 subunit A	NA	NA	NA	NA	NA
AZZ59719.1|2477126_2477336_+	ATP synthase F0 subunit C	NA	NA	NA	NA	NA
AZZ59720.1|2477432_2477927_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
AZZ59721.1|2477929_2478469_+	ATP synthase F1 subunit delta	NA	NA	NA	NA	NA
AZZ59722.1|2478486_2480064_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
AZZ59723.1|2480135_2481005_+	ATP synthase F1 subunit gamma	NA	NA	NA	NA	NA
AZZ59724.1|2481167_2482520_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
AZZ59826.1|2482541_2482829_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	NA	NA	NA	NA
AZZ59725.1|2482839_2483874_+	polyketide cyclase	NA	NA	NA	NA	NA
AZZ59726.1|2483989_2486749_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
AZZ59727.1|2486803_2488036_+	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
AZZ59728.1|2488079_2489426_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AZZ59729.1|2489422_2490103_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AZZ59730.1|2490247_2493421_+	c-type cytochrome biogenesis protein CcsB	NA	NA	NA	NA	NA
AZZ59731.1|2493485_2494187_+	hypothetical protein	NA	NA	NA	NA	NA
AZZ59827.1|2494201_2495284_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
AZZ59732.1|2495954_2496833_+|transposase	IS982 family transposase ISRa1	transposase	NA	NA	NA	NA
