The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP015281	Photorhabdus laumondii subsp. laumondii strain DSPV002N chromosome, complete genome	5688984	10250	44489	5688984	tRNA,tail,plate	Salmonella_phage(30.43%)	35	NA	NA
AWK40033.1|10250_10472_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.4	1.1e-18
AWK40034.1|10548_11634_-	late control protein D	NA	E5G6Q3	Salmonella_phage	60.2	1.8e-117
AWK40035.1|11630_12095_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	65.9	2.6e-46
AWK44395.1|12097_14536_-|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	32.5	1.6e-86
AWK40036.1|14650_14968_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	52.7	2.0e-21
AWK40037.1|14994_15510_-|tail	phage tail protein	tail	A0A218M4J0	Erwinia_phage	64.0	1.3e-57
AWK40038.1|15520_16693_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	75.3	7.4e-170
AWK40039.1|17677_18208_+	hypothetical protein	NA	A0A0A7NRZ7	Enterobacteria_phage	44.6	2.6e-34
AWK40040.1|18437_19034_-|tail	phage tail protein	tail	M1SV83	Escherichia_phage	45.2	1.1e-41
AWK40041.1|19033_19522_-	hypothetical protein	NA	M1TAS6	Escherichia_phage	46.1	5.8e-28
AWK40042.1|19521_20649_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	53.6	3.1e-93
AWK40043.1|20645_21260_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	64.8	8.8e-74
AWK40044.1|21252_22251_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	56.4	3.1e-84
AWK40045.1|22255_22597_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	59.1	1.6e-29
AWK44396.1|22596_23439_-|plate	phage baseplate protein	plate	A0A2I8TV69	Erwinia_phage	39.5	1.8e-40
AWK40046.1|23935_24139_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	70.1	2.0e-22
AWK44397.1|24982_25597_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	42.9	1.9e-44
AWK40047.1|25879_26452_-	DNA-invertase	NA	A0A0C4UR34	Shigella_phage	67.9	2.0e-67
AWK40048.1|26543_27542_+	hypothetical protein	NA	A5X9J3	Aeromonas_virus	54.9	1.5e-17
AWK40049.1|27551_27893_+	hypothetical protein	NA	A0A0M4RTP2	Salmonella_phage	62.1	6.5e-10
AWK40050.1|28943_29987_-	hypothetical protein	NA	M1TAS6	Escherichia_phage	44.3	9.9e-25
AWK40051.1|30573_30828_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
AWK40052.1|30976_32806_-	glutamine--fructose-6-phosphate aminotransferase	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.6	1.8e-130
AWK40053.1|32913_34287_-	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	37.8	4.8e-35
AWK40054.1|34415_34838_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
AWK40055.1|34859_36242_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
AWK40056.1|36276_37140_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
AWK40057.1|37198_38740_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
AWK40058.1|38754_39288_-	ATP F0F1 synthase subunit delta	NA	NA	NA	NA	NA
AWK40059.1|39300_39771_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
AWK40060.1|39829_40069_-	ATP F0F1 synthase subunit C	NA	NA	NA	NA	NA
AWK40061.1|40122_40947_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
AWK40062.1|40977_41355_-	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
AWK40063.1|41965_42586_-	16S rRNA methyltransferase G	NA	NA	NA	NA	NA
AWK40064.1|42599_44489_-|tRNA	tRNA uridine(34) 5-carboxymethylaminomethyl synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
>prophage 2
CP015281	Photorhabdus laumondii subsp. laumondii strain DSPV002N chromosome, complete genome	5688984	132319	197886	5688984	integrase,coat,transposase	Klosneuvirus(37.5%)	51	127005:127020	194740:194755
127005:127020	attL	AAGTCAGGTTTTGGTG	NA	NA	NA	NA
AWK40136.1|132319_133534_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	68.2	2.0e-157
AWK40137.1|133596_136848_+	hypothetical protein	NA	NA	NA	NA	NA
AWK40138.1|137036_138653_+|transposase	transposase	transposase	NA	NA	NA	NA
AWK40139.1|139635_140232_-	hypothetical protein	NA	NA	NA	NA	NA
AWK44401.1|140511_141642_+|transposase	transposase	transposase	NA	NA	NA	NA
AWK40140.1|141950_142424_+	hypothetical protein	NA	NA	NA	NA	NA
AWK40141.1|142561_143029_+	hypothetical protein	NA	NA	NA	NA	NA
AWK40142.1|143077_143404_+	antitoxin	NA	NA	NA	NA	NA
AWK40143.1|143879_144713_+	restriction endonuclease subunit M	NA	NA	NA	NA	NA
AWK40144.1|144800_145838_+	hydroxyacid dehydrogenase	NA	Q9JMN3	Wolbachia_phage	42.4	3.2e-68
AWK40145.1|146502_147273_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AWK40146.1|147417_147918_+	hydroxyquinol 1,2-dioxygenase	NA	NA	NA	NA	NA
AWK40147.1|147961_148939_+	hydroxyquinol 1,2-dioxygenase	NA	NA	NA	NA	NA
AWK44402.1|148964_150428_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AWK40148.1|150449_151313_+	3-oxoadipate--succinyl-CoA transferase subunit A	NA	NA	NA	NA	NA
AWK44403.1|151336_152089_+	3-oxoadipate--succinyl-CoA transferase subunit B	NA	NA	NA	NA	NA
AWK40149.1|152085_153150_+	maleylacetate reductase	NA	NA	NA	NA	NA
AWK40150.1|153210_154419_+	beta-ketoadipyl CoA thiolase	NA	NA	NA	NA	NA
AWK40151.1|154612_154999_+	hypothetical protein	NA	NA	NA	NA	NA
AWK40152.1|155890_156472_+	hypothetical protein	NA	NA	NA	NA	NA
AWK40153.1|157010_158870_+	helicase	NA	A0A097BY72	Enterococcus_phage	23.2	1.0e-11
AWK40154.1|158866_159292_+	hypothetical protein	NA	NA	NA	NA	NA
AWK40155.1|159680_160580_-	3-methyladenine DNA glycosylase 2	NA	NA	NA	NA	NA
AWK40156.1|160724_161663_+	hypothetical protein	NA	NA	NA	NA	NA
AWK40157.1|162598_162901_+	Cro/Cl family transcriptional regulator	NA	NA	NA	NA	NA
AWK40158.1|163664_164765_+	amidinotransferase	NA	NA	NA	NA	NA
AWK44404.1|165876_166740_+	hypothetical protein	NA	NA	NA	NA	NA
AWK40159.1|166899_167781_+	multidrug DMT transporter permease	NA	NA	NA	NA	NA
AWK40160.1|168153_169746_+	hypothetical protein	NA	NA	NA	NA	NA
AWK40161.1|169908_170412_+	hypothetical protein	NA	NA	NA	NA	NA
AWK40162.1|170904_172497_+	hypothetical protein	NA	NA	NA	NA	NA
AWK40163.1|172931_174524_+	hypothetical protein	NA	A0A1V0SLG8	Klosneuvirus	24.9	8.3e-07
AWK40164.1|174832_176428_+	hypothetical protein	NA	A0A1V0SLG8	Klosneuvirus	29.3	1.6e-05
AWK40165.1|176520_178110_+	hypothetical protein	NA	A0A1V0SLG8	Klosneuvirus	27.0	1.4e-06
AWK40166.1|180735_181923_-	mannonate dehydratase	NA	NA	NA	NA	NA
AWK40167.1|181960_182704_-	transcriptional regulator	NA	NA	NA	NA	NA
AWK40168.1|182822_183803_-	hypothetical protein	NA	NA	NA	NA	NA
AWK40169.1|184100_184607_+	C4-dicarboxylate ABC transporter permease	NA	NA	NA	NA	NA
AWK40170.1|184634_185948_+	hypothetical protein	NA	NA	NA	NA	NA
AWK40171.1|185975_187457_+	fructuronate reductase	NA	G9E6E2	Micromonas_pusilla_virus	32.7	1.1e-48
AWK40172.1|187453_188878_+	glucuronate isomerase	NA	NA	NA	NA	NA
AWK40173.1|188874_189819_+	ketodeoxygluconokinase	NA	NA	NA	NA	NA
AWK40174.1|189836_190466_+	2-dehydro-3-deoxyphosphogluconate aldolase	NA	NA	NA	NA	NA
AWK40175.1|190548_191037_-	GCN5 family acetyltransferase	NA	NA	NA	NA	NA
AWK40176.1|191027_191300_-	hypothetical protein	NA	NA	NA	NA	NA
AWK40177.1|192435_193941_+	asparagine synthase	NA	A0A0P0C1V4	Ostreococcus_lucimarinus_virus	30.3	2.2e-17
AWK40178.1|193943_194693_+|coat	spore coat protein CotG	coat	NA	NA	NA	NA
AWK40179.1|194706_195528_+|coat	spore coat protein CotH	coat	NA	NA	NA	NA
194740:194755	attR	AAGTCAGGTTTTGGTG	NA	NA	NA	NA
AWK40180.1|195604_196789_+	hypothetical protein	NA	NA	NA	NA	NA
AWK40181.1|196775_197030_+	hypothetical protein	NA	NA	NA	NA	NA
AWK40182.1|197037_197886_+|coat	spore coat protein CotH	coat	NA	NA	NA	NA
>prophage 3
CP015281	Photorhabdus laumondii subsp. laumondii strain DSPV002N chromosome, complete genome	5688984	1054824	1065802	5688984		Sodalis_phage(80.0%)	11	NA	NA
AWK40848.1|1054824_1056006_+	cysteine desulfurase IscS	NA	H7BUW1	unidentified_phage	39.9	1.3e-36
AWK40849.1|1056028_1057222_+	MFS transporter	NA	NA	NA	NA	NA
AWK40850.1|1057781_1057994_+	DNA-binding protein	NA	A0A2I7S995	Vibrio_phage	64.2	2.4e-18
AWK44446.1|1058314_1059037_-	helix-turn-helix transcriptional regulator	NA	Q2A088	Sodalis_phage	32.6	2.2e-15
AWK40851.1|1059197_1059920_-	helix-turn-helix transcriptional regulator	NA	Q2A088	Sodalis_phage	35.3	2.0e-16
AWK40852.1|1060241_1060964_-	helix-turn-helix transcriptional regulator	NA	Q2A088	Sodalis_phage	30.5	4.9e-15
AWK44447.1|1061264_1061987_-	helix-turn-helix transcriptional regulator	NA	Q2A088	Sodalis_phage	32.6	9.9e-16
AWK44448.1|1062304_1063027_-	helix-turn-helix transcriptional regulator	NA	Q2A088	Sodalis_phage	30.3	1.1e-17
AWK40853.1|1063312_1064035_-	helix-turn-helix transcriptional regulator	NA	Q2A088	Sodalis_phage	31.2	2.4e-14
AWK44449.1|1064196_1064919_-	helix-turn-helix transcriptional regulator	NA	Q2A088	Sodalis_phage	33.3	2.2e-15
AWK40854.1|1065079_1065802_-	helix-turn-helix transcriptional regulator	NA	Q2A088	Sodalis_phage	28.8	5.8e-16
>prophage 4
CP015281	Photorhabdus laumondii subsp. laumondii strain DSPV002N chromosome, complete genome	5688984	1492597	1503443	5688984		Mycobacterium_phage(25.0%)	12	NA	NA
AWK41167.1|1492597_1493797_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.7	2.0e-29
AWK41168.1|1494394_1495354_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	70.5	3.3e-128
AWK44468.1|1495374_1497456_-	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A0D3MSW9	Lactococcus_phage	52.3	3.5e-207
AWK44467.1|1497506_1497923_-	ribonucleotide reductase assembly protein NrdI	NA	A0A142F1R4	Bacillus_phage	40.3	6.3e-15
AWK41169.1|1497936_1498167_-	NrdH-redoxin	NA	V5UN81	Mycobacterium_phage	48.6	7.7e-15
AWK41170.1|1498498_1498960_+	cysteine methyltransferase	NA	NA	NA	NA	NA
AWK41171.1|1499178_1499388_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	79.7	7.7e-22
AWK44469.1|1499464_1499839_-	fluoride ion transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.5	3.4e-20
AWK41172.1|1499978_1500944_-	lipoyl synthase	NA	NA	NA	NA	NA
AWK41173.1|1501054_1501696_-	octanoyltransferase	NA	NA	NA	NA	NA
AWK41174.1|1501827_1502091_-	hypothetical protein	NA	NA	NA	NA	NA
AWK44470.1|1502231_1503443_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	49.7	4.5e-106
>prophage 6
CP015281	Photorhabdus laumondii subsp. laumondii strain DSPV002N chromosome, complete genome	5688984	1963082	1993171	5688984	transposase,tail,plate	Sodalis_phage(28.57%)	22	NA	NA
AWK41492.1|1963082_1964045_+|transposase	transposase	transposase	Q2A0A7	Sodalis_phage	62.7	4.8e-82
AWK41493.1|1965346_1966231_-|transposase	transposase	transposase	NA	NA	NA	NA
AWK41494.1|1966218_1966479_-	hypothetical protein	NA	NA	NA	NA	NA
AWK41495.1|1967856_1968363_-	hypothetical protein	NA	NA	NA	NA	NA
AWK41496.1|1969767_1970754_-	hypothetical protein	NA	NA	NA	NA	NA
AWK41497.1|1970858_1971761_-	hypothetical protein	NA	NA	NA	NA	NA
AWK41498.1|1971784_1973884_-	AAA family ATPase	NA	A0A2D2W2C3	Stenotrophomonas_phage	33.6	1.3e-07
AWK41499.1|1973893_1975858_-	hypothetical protein	NA	NA	NA	NA	NA
AWK41500.1|1975921_1977139_-	hypothetical protein	NA	F2Y385	Organic_Lake_phycodnavirus	25.1	2.0e-05
AWK41501.1|1977248_1980602_-	hypothetical protein	NA	NA	NA	NA	NA
AWK41502.1|1980598_1983307_-	hypothetical protein	NA	NA	NA	NA	NA
AWK41503.1|1983349_1983766_-	hypothetical protein	NA	NA	NA	NA	NA
AWK41504.1|1983762_1984254_-|plate	phage baseplate protein	plate	M4SKQ1	Cyanophage	28.8	9.7e-07
AWK41505.1|1984266_1985868_-	hypothetical protein	NA	NA	NA	NA	NA
AWK41506.1|1985864_1986548_-	hypothetical protein	NA	NA	NA	NA	NA
AWK41507.1|1986534_1986714_-	hypothetical protein	NA	NA	NA	NA	NA
AWK41508.1|1986710_1987169_-|tail	phage tail protein	tail	NA	NA	NA	NA
AWK41509.1|1987182_1988418_-|tail	phage tail protein	tail	NA	NA	NA	NA
AWK41510.1|1988465_1989899_-|tail	phage tail protein	tail	NA	NA	NA	NA
AWK41511.1|1989910_1990993_-|tail	phage tail protein	tail	D5LGY7	Escherichia_phage	27.0	7.4e-07
AWK41512.1|1991046_1991496_-|tail	phage tail protein	tail	A0A1J0GW41	Streptomyces_phage	28.2	9.8e-06
AWK41513.1|1992244_1993171_-|transposase	transposase	transposase	Q2A0A7	Sodalis_phage	61.4	3.9e-81
>prophage 7
CP015281	Photorhabdus laumondii subsp. laumondii strain DSPV002N chromosome, complete genome	5688984	2007979	2065195	5688984	transposase,tail,plate	Vibrio_phage(33.33%)	49	NA	NA
AWK41523.1|2007979_2008426_-|plate	phage baseplate protein	plate	A0A0E3ETF4	Synechococcus_phage	30.5	1.6e-08
AWK41524.1|2008438_2010040_-	hypothetical protein	NA	NA	NA	NA	NA
AWK41525.1|2010036_2010720_-	hypothetical protein	NA	NA	NA	NA	NA
AWK41526.1|2010706_2010886_-	hypothetical protein	NA	NA	NA	NA	NA
AWK41527.1|2010882_2011341_-|tail	phage tail protein	tail	NA	NA	NA	NA
AWK41528.1|2011376_2012552_-|tail	phage tail protein	tail	A0A2I7QP51	Vibrio_phage	31.0	5.7e-05
AWK41529.1|2012607_2013993_-|tail	phage tail protein	tail	NA	NA	NA	NA
AWK41530.1|2014004_2015087_-|tail	phage tail protein	tail	NA	NA	NA	NA
AWK41531.1|2015262_2015712_-|tail	phage tail protein	tail	NA	NA	NA	NA
AWK41532.1|2016642_2017590_-	hypothetical protein	NA	NA	NA	NA	NA
AWK41533.1|2017781_2018711_-	hypothetical protein	NA	NA	NA	NA	NA
AWK41534.1|2018791_2019694_-	hypothetical protein	NA	NA	NA	NA	NA
AWK41535.1|2019718_2021785_-	AAA family ATPase	NA	A0A2D2W2C3	Stenotrophomonas_phage	34.5	4.4e-08
AWK41536.1|2021794_2023357_-	hypothetical protein	NA	NA	NA	NA	NA
AWK41537.1|2023535_2024561_-	DDE endonuclease	NA	NA	NA	NA	NA
AWK41538.1|2024610_2025561_-	hypothetical protein	NA	NA	NA	NA	NA
AWK41539.1|2025762_2028669_-	hypothetical protein	NA	NA	NA	NA	NA
AWK41540.1|2028665_2031368_-	hypothetical protein	NA	NA	NA	NA	NA
AWK41541.1|2031464_2031881_-	hypothetical protein	NA	NA	NA	NA	NA
AWK41542.1|2031877_2032369_-|plate	phage baseplate protein	plate	M4SKQ1	Cyanophage	27.9	2.8e-06
AWK41543.1|2032381_2033983_-	hypothetical protein	NA	NA	NA	NA	NA
AWK41544.1|2033979_2034663_-	hypothetical protein	NA	NA	NA	NA	NA
AWK41545.1|2034649_2034829_-	hypothetical protein	NA	NA	NA	NA	NA
AWK41546.1|2034825_2035284_-|tail	phage tail protein	tail	NA	NA	NA	NA
AWK41547.1|2035297_2036503_-|tail	phage tail protein	tail	A0A2I7QP51	Vibrio_phage	31.9	5.3e-06
AWK41548.1|2036551_2038036_-|tail	phage tail protein	tail	NA	NA	NA	NA
AWK41549.1|2038047_2039124_-|tail	phage tail protein	tail	NA	NA	NA	NA
AWK41550.1|2039177_2039627_-|tail	phage tail protein	tail	A0A1J0GW41	Streptomyces_phage	28.2	1.3e-05
AWK41551.1|2040260_2040629_-	hypothetical protein	NA	NA	NA	NA	NA
AWK41552.1|2040654_2041677_-|transposase	transposase	transposase	Q2A0A7	Sodalis_phage	50.4	4.2e-60
AWK41553.1|2042170_2043193_-	Insecticial toxin	NA	NA	NA	NA	NA
AWK41554.1|2043312_2044155_-	hypothetical protein	NA	NA	NA	NA	NA
AWK41555.1|2044493_2044976_-	hypothetical protein	NA	NA	NA	NA	NA
AWK41556.1|2045077_2045980_-	hypothetical protein	NA	NA	NA	NA	NA
AWK41557.1|2046004_2048089_-	AAA family ATPase	NA	A0A2D2W2C3	Stenotrophomonas_phage	34.5	9.8e-08
AWK41558.1|2048098_2049754_-	hypothetical protein	NA	NA	NA	NA	NA
AWK41559.1|2049817_2051122_-	hypothetical protein	NA	I3PUX0	Vibrio_phage	47.9	4.4e-06
AWK41560.1|2051309_2054216_-	hypothetical protein	NA	NA	NA	NA	NA
AWK41561.1|2054208_2056926_-	hypothetical protein	NA	NA	NA	NA	NA
AWK41562.1|2056969_2057386_-	hypothetical protein	NA	NA	NA	NA	NA
AWK44487.1|2057382_2057814_-|plate	phage baseplate protein	plate	NA	NA	NA	NA
AWK41563.1|2058114_2059716_-	hypothetical protein	NA	NA	NA	NA	NA
AWK41564.1|2059712_2060396_-	hypothetical protein	NA	NA	NA	NA	NA
AWK41565.1|2060382_2060562_-	hypothetical protein	NA	NA	NA	NA	NA
AWK41566.1|2060558_2061017_-|tail	phage tail protein	tail	NA	NA	NA	NA
AWK41567.1|2061030_2062209_-|tail	phage tail protein	tail	NA	NA	NA	NA
AWK41568.1|2062263_2063655_-|tail	phage tail protein	tail	NA	NA	NA	NA
AWK41569.1|2063666_2064731_-|tail	phage tail protein	tail	NA	NA	NA	NA
AWK41570.1|2064745_2065195_-|tail	phage tail protein	tail	NA	NA	NA	NA
>prophage 8
CP015281	Photorhabdus laumondii subsp. laumondii strain DSPV002N chromosome, complete genome	5688984	2393561	2422039	5688984	tail	Morganella_phage(44.44%)	25	NA	NA
AWK44503.1|2393561_2394188_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	45.9	1.1e-34
AWK41821.1|2394242_2394992_+|tail	phage tail protein	tail	Q9MCR6	Enterobacteria_phage	56.7	6.8e-44
AWK41822.1|2396417_2396966_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
AWK41823.1|2397023_2398856_-	excinuclease ABC subunit C	NA	NA	NA	NA	NA
AWK44504.1|2398839_2399505_-	two-component system response regulator UvrY	NA	NA	NA	NA	NA
AWK44505.1|2399939_2400164_+	hypothetical protein	NA	NA	NA	NA	NA
AWK41824.1|2400523_2400952_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	43.0	4.2e-22
AWK41825.1|2401212_2401551_+	hypothetical protein	NA	NA	NA	NA	NA
AWK41826.1|2401729_2402167_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	44.8	1.4e-25
AWK41827.1|2402658_2403354_+	aquaporin	NA	NA	NA	NA	NA
AWK41828.1|2403736_2404456_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	48.3	5.2e-33
AWK41829.1|2404477_2405104_+|tail	phage tail protein	tail	Q9MCR5	Enterobacteria_phage	39.6	2.7e-33
AWK41830.1|2405341_2406628_+|tail	phage tail protein	tail	A0A1W6JNZ8	Morganella_phage	38.3	3.1e-60
AWK41831.1|2406861_2407860_+	deoxyribonuclease I	NA	NA	NA	NA	NA
AWK41832.1|2408511_2409300_+	hypothetical protein	NA	A0A1B2IGB4	Erwinia_phage	70.5	1.1e-81
AWK41833.1|2409734_2410568_-	NADPH-dependent ferric siderophore reductase	NA	NA	NA	NA	NA
AWK41834.1|2410706_2411936_-	hypothetical protein	NA	NA	NA	NA	NA
AWK41835.1|2412142_2413150_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AWK41836.1|2413139_2414477_-	cytochrome D ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AWK41837.1|2414608_2416030_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AWK41838.1|2416067_2416268_+	hypothetical protein	NA	NA	NA	NA	NA
AWK41839.1|2416464_2417307_-	hypothetical protein	NA	NA	NA	NA	NA
AWK41840.1|2418060_2419086_-	DDE endonuclease	NA	NA	NA	NA	NA
AWK41841.1|2419181_2419988_-	hypothetical protein	NA	NA	NA	NA	NA
AWK41842.1|2420827_2422039_+|tail	phage tail protein	tail	A0A1W6JNZ8	Morganella_phage	28.2	1.1e-27
>prophage 9
CP015281	Photorhabdus laumondii subsp. laumondii strain DSPV002N chromosome, complete genome	5688984	2800481	2808011	5688984	tail,plate	Streptomyces_phage(25.0%)	9	NA	NA
AWK42143.1|2800481_2800931_+|tail	phage tail protein	tail	A0A1J0GW41	Streptomyces_phage	29.5	4.4e-06
AWK42144.1|2801004_2802081_+|tail	phage tail protein	tail	NA	NA	NA	NA
AWK42145.1|2802138_2803431_+|tail	phage tail protein	tail	J9PVC2	Bacillus_phage	38.7	6.9e-28
AWK42146.1|2803485_2804652_+|tail	phage tail protein	tail	A0A2I7QP51	Vibrio_phage	29.5	5.7e-05
AWK42147.1|2804670_2805129_+|tail	phage tail protein	tail	NA	NA	NA	NA
AWK42148.1|2805125_2805305_+	hypothetical protein	NA	NA	NA	NA	NA
AWK42149.1|2805291_2805975_+	hypothetical protein	NA	NA	NA	NA	NA
AWK42150.1|2805971_2807576_+	hypothetical protein	NA	NA	NA	NA	NA
AWK42151.1|2807588_2808011_+|plate	phage baseplate protein	plate	A0A0E3ETF4	Synechococcus_phage	32.3	1.8e-09
>prophage 10
CP015281	Photorhabdus laumondii subsp. laumondii strain DSPV002N chromosome, complete genome	5688984	2913498	2980323	5688984	integrase,tail,plate	Escherichia_phage(20.0%)	56	2909022:2909036	2914848:2914862
2909022:2909036	attL	AGAAATAGTACTTTT	NA	NA	NA	NA
AWK42223.1|2913498_2914539_-|integrase	integrase	integrase	NA	NA	NA	NA
AWK42224.1|2914829_2915426_+	GTP cyclohydrolase	NA	A0A2H4PQS2	Staphylococcus_phage	44.5	5.1e-26
2914848:2914862	attR	AGAAATAGTACTTTT	NA	NA	NA	NA
AWK42225.1|2915438_2917124_+	hypothetical protein	NA	NA	NA	NA	NA
AWK42226.1|2917116_2918145_+	serine/threonine protein kinase	NA	A0A7H6	Microcystis_virus	27.1	1.6e-14
AWK42227.1|2918689_2919331_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42228.1|2919761_2920532_+	hypothetical protein	NA	NA	NA	NA	NA
AWK42229.1|2920699_2921227_-	attachment protein	NA	A0A1B0VBR9	Salmonella_phage	38.3	1.9e-24
AWK42230.1|2921743_2922289_-	attachment protein	NA	A0A1B0VBR9	Salmonella_phage	40.3	2.5e-27
AWK42231.1|2922554_2924312_-	sulfate permease	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.4	1.8e-15
AWK42232.1|2924525_2925062_+	septation protein A	NA	NA	NA	NA	NA
AWK42233.1|2925139_2925571_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AWK42234.1|2925633_2926314_-	transporter	NA	NA	NA	NA	NA
AWK42235.1|2926415_2926598_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42236.1|2926969_2928430_+	cardiolipin synthase A	NA	NA	NA	NA	NA
AWK44525.1|2928541_2928871_+	dsDNA-mimic protein	NA	NA	NA	NA	NA
AWK42237.1|2928999_2930001_-	oligopeptide ABC transporter ATP-binding protein OppF	NA	G9BWD6	Planktothrix_phage	35.1	1.1e-20
AWK42238.1|2929997_2930996_-	oligopeptide transporter ATP-binding component	NA	G9BWD6	Planktothrix_phage	27.6	1.7e-13
AWK42239.1|2931005_2931914_-	peptide ABC transporter permease	NA	NA	NA	NA	NA
AWK42240.1|2931928_2932849_-	oligopeptide transporter permease	NA	NA	NA	NA	NA
AWK42241.1|2932933_2934574_-	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
AWK42242.1|2934712_2936350_-	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
AWK42243.1|2936904_2937549_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42244.1|2937960_2940594_+	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
AWK42245.1|2940836_2941442_-	thymidine kinase	NA	A0A2K9V5L3	Klebsiella_phage	55.8	1.1e-55
AWK42246.1|2942087_2942492_+	transcriptional regulator	NA	NA	NA	NA	NA
AWK42247.1|2942790_2943804_-	capsular biosynthesis protein CpsI	NA	A0A0E3FNQ3	Synechococcus_phage	30.8	6.9e-31
AWK42248.1|2943812_2945156_-	UDP-glucose 6-dehydrogenase	NA	A0A127AXI2	Bacillus_phage	37.2	7.3e-81
AWK42249.1|2945179_2946172_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	45.6	2.4e-57
AWK42250.1|2946564_2947590_-	response regulator of RpoS	NA	NA	NA	NA	NA
AWK42251.1|2947715_2948228_+	hypothetical protein	NA	NA	NA	NA	NA
AWK42252.1|2948273_2949122_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	34.7	2.2e-14
AWK42253.1|2949552_2949966_-	hypothetical protein	NA	A0A0D4DCG1	Acinetobacter_phage	55.0	4.8e-31
AWK42254.1|2951052_2951958_+	oxidoreductase	NA	A0A077SLF7	Escherichia_phage	59.9	1.4e-91
AWK42255.1|2951957_2953235_+	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	50.2	8.7e-108
AWK42256.1|2953227_2953869_+	aldolase	NA	A0A077SK32	Escherichia_phage	54.1	4.9e-59
AWK42257.1|2953887_2954667_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
AWK42258.1|2954679_2955447_+	alkaline phosphatase	NA	A0A077SK06	Escherichia_phage	41.9	9.4e-49
AWK42259.1|2955619_2956585_+	hypothetical protein	NA	A0A1V0SAI6	Catovirus	24.8	8.0e-05
AWK42260.1|2956587_2957973_+	gluconate permease	NA	NA	NA	NA	NA
AWK42261.1|2958127_2959273_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42262.1|2959711_2960653_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42263.1|2960781_2961678_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42264.1|2961702_2963787_-	AAA family ATPase	NA	A0A2D2W2C3	Stenotrophomonas_phage	35.3	6.8e-09
AWK44526.1|2963796_2965656_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42265.1|2965714_2966971_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42266.1|2967098_2970002_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42267.1|2969994_2972724_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42268.1|2972806_2973223_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42269.1|2973219_2973636_-|plate	phage baseplate protein	plate	M4SKQ1	Cyanophage	32.3	8.8e-09
AWK42270.1|2973649_2975251_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42271.1|2975247_2975931_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42272.1|2975917_2976097_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42273.1|2976093_2976552_-|tail	phage tail protein	tail	NA	NA	NA	NA
AWK42274.1|2976565_2977762_-|tail	phage tail protein	tail	NA	NA	NA	NA
AWK42275.1|2977810_2979217_-|tail	phage tail protein	tail	NA	NA	NA	NA
AWK42276.1|2979228_2980323_-|tail	phage tail protein	tail	NA	NA	NA	NA
>prophage 11
CP015281	Photorhabdus laumondii subsp. laumondii strain DSPV002N chromosome, complete genome	5688984	3110948	3124192	5688984	tRNA	Tupanvirus(50.0%)	12	NA	NA
AWK42393.1|3110948_3112931_-	bifunctional UDP-glucuronic acid oxidase/UDP-4-amino-4-deoxy-L-arabinose formyltransferase	NA	A0A2K9KZK0	Tupanvirus	26.7	1.9e-21
AWK42394.1|3112931_3113909_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	Q76H32	Enterobacteria_phage	33.7	9.5e-38
AWK42395.1|3113909_3115055_-	UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase	NA	A0A2K9L470	Tupanvirus	25.9	1.4e-35
AWK44532.1|3115215_3115962_-	vitamin B12 ABC transporter ATP-binding protein	NA	M1H3A1	Paramecium_bursaria_Chlorella_virus	27.6	4.8e-05
AWK42396.1|3115995_3117003_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
AWK42397.1|3117068_3117365_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	7.1e-13
AWK42398.1|3117369_3119757_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	29.2	1.0e-08
AWK42399.1|3119772_3120756_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.1	2.9e-34
AWK42400.1|3121027_3121384_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AWK42401.1|3121425_3121623_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AWK42402.1|3121720_3122059_-	translation initiation factor IF-3	NA	NA	NA	NA	NA
AWK42403.1|3122263_3124192_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	6.3e-126
>prophage 12
CP015281	Photorhabdus laumondii subsp. laumondii strain DSPV002N chromosome, complete genome	5688984	3409529	3537384	5688984	transposase,tail,terminase,holin,plate	Salmonella_phage(14.67%)	163	NA	NA
AWK42585.1|3409529_3410156_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	39.2	4.7e-30
AWK42586.1|3410155_3411478_-|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	44.9	5.4e-28
AWK42587.1|3411464_3412121_-	hypothetical protein	NA	NA	NA	NA	NA
AWK44555.1|3412113_3413247_-	hypothetical protein	NA	D0UIH5	Aggregatibacter_phage	37.9	3.8e-70
AWK42588.1|3413230_3413593_-	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	52.3	8.1e-27
AWK42589.1|3413589_3414261_-|plate	baseplate protein	plate	Q7Y5S7	Haemophilus_phage	58.8	1.6e-44
AWK42590.1|3414235_3415081_-	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	53.6	1.3e-83
AWK42591.1|3415055_3415394_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42592.1|3415390_3416110_-	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	39.8	6.1e-34
AWK42593.1|3416256_3416463_-	hypothetical protein	NA	A0A0P0ZAX5	Stx2-converting_phage	69.6	1.1e-17
AWK44556.1|3416643_3417402_-	antirepressor	NA	A0A2L1IV39	Escherichia_phage	58.4	2.9e-82
AWK42594.1|3418151_3418439_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42595.1|3418507_3420496_-	hypothetical protein	NA	D0UII2	Aggregatibacter_phage	31.9	2.7e-15
AWK42596.1|3420643_3421039_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42597.1|3421038_3421467_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42598.1|3421476_3422988_-	hypothetical protein	NA	Q7Y5T5	Haemophilus_phage	44.0	7.9e-108
AWK44557.1|3422990_3423365_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42599.1|3423408_3423759_-	hypothetical protein	NA	Q776V7	Haemophilus_phage	31.2	3.5e-11
AWK42600.1|3423739_3424333_-	hypothetical protein	NA	A0A1L2JY56	Aeribacillus_phage	33.2	7.6e-14
AWK42601.1|3424329_3424692_-	hypothetical protein	NA	Q7Y5T9	Haemophilus_phage	46.2	4.5e-17
AWK42602.1|3424706_3425666_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42603.1|3425670_3426156_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42604.1|3426158_3427316_-	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	36.4	9.6e-21
AWK44558.1|3427319_3428171_-	hypothetical protein	NA	Q7Y5U5	Haemophilus_phage	31.8	2.7e-28
AWK42605.1|3428091_3429465_-	hypothetical protein	NA	A0A1W6JTH9	Shewanella_phage	24.3	1.6e-19
AWK42606.1|3429464_3430694_-|terminase	terminase	terminase	H6WRS9	Salmonella_phage	78.9	1.4e-195
AWK42607.1|3430690_3431092_-	hypothetical protein	NA	A0A068CGC1	Acinetobacter_phage	54.0	1.3e-28
AWK42608.1|3431136_3431805_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42609.1|3432169_3432511_+	hypothetical protein	NA	NA	NA	NA	NA
AWK42610.1|3432503_3432731_+	hypothetical protein	NA	NA	NA	NA	NA
AWK42611.1|3432927_3433377_-	peptidase	NA	A0A1P8DTG0	Proteus_phage	46.6	2.3e-18
AWK42612.1|3433373_3433598_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42613.1|3433609_3434020_-	structural protein	NA	A0A0A1IX72	Pseudomonas_phage	51.5	6.4e-28
AWK42614.1|3434016_3434334_-|holin	holin	holin	A0A0M3ULK9	Salmonella_phage	51.0	3.0e-25
AWK42615.1|3434491_3434677_+	hypothetical protein	NA	NA	NA	NA	NA
AWK42616.1|3434666_3434876_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42617.1|3434900_3435311_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42618.1|3435548_3436364_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	48.9	4.5e-65
AWK42619.1|3436550_3436736_-	hypothetical protein	NA	E5AGG1	Erwinia_phage	32.2	7.3e-08
AWK42620.1|3436732_3437113_-	hypothetical protein	NA	A0A1P8DTH6	Proteus_phage	40.7	6.3e-14
AWK42621.1|3437221_3437458_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42622.1|3437457_3437901_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	47.1	4.8e-29
AWK42623.1|3437901_3438102_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42624.1|3438094_3438301_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42625.1|3438313_3439270_-	DNA primase	NA	A0A0P0ZFY3	Escherichia_phage	57.2	3.1e-102
AWK42626.1|3439232_3440774_-	helicase	NA	A0A0N7KZV6	Escherichia_phage	70.9	2.4e-213
AWK42627.1|3440845_3441316_-	hypothetical protein	NA	NA	NA	NA	NA
AWK44559.1|3441540_3441870_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42628.1|3441947_3442265_-	hypothetical protein	NA	I6PCV6	Cronobacter_phage	52.3	4.3e-16
AWK42629.1|3442387_3442591_-	transcriptional regulator	NA	Q716D6	Shigella_phage	67.2	1.1e-17
AWK42630.1|3442700_3443339_+	repressor	NA	K7PK07	Enterobacteria_phage	56.9	3.7e-59
AWK42631.1|3443401_3443740_+	hypothetical protein	NA	NA	NA	NA	NA
AWK42632.1|3443732_3444143_+	hypothetical protein	NA	NA	NA	NA	NA
AWK42633.1|3444470_3444689_+	hypothetical protein	NA	NA	NA	NA	NA
AWK42634.1|3444878_3445163_+	hypothetical protein	NA	NA	NA	NA	NA
AWK42635.1|3445167_3445461_+	hypothetical protein	NA	NA	NA	NA	NA
AWK42636.1|3445567_3446098_+	hypothetical protein	NA	NA	NA	NA	NA
AWK42637.1|3446174_3446354_+	hypothetical protein	NA	NA	NA	NA	NA
AWK42638.1|3446572_3446830_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	42.4	5.2e-12
AWK42639.1|3446859_3447282_+	hypothetical protein	NA	NA	NA	NA	NA
AWK42640.1|3447351_3448254_+	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	54.9	2.1e-39
AWK42641.1|3448460_3448643_+	hypothetical protein	NA	NA	NA	NA	NA
AWK42642.1|3448644_3448902_+	hypothetical protein	NA	NA	NA	NA	NA
AWK42643.1|3448898_3449819_+	recombinase RecT	NA	F1C5B8	Cronobacter_phage	69.6	1.3e-121
AWK44560.1|3449822_3450503_+	exonuclease	NA	M9NZE1	Enterobacteria_phage	74.8	4.7e-100
AWK42644.1|3450493_3450901_+	hypothetical protein	NA	NA	NA	NA	NA
AWK42645.1|3450913_3451093_+	hypothetical protein	NA	NA	NA	NA	NA
AWK42646.1|3451108_3451546_+	hypothetical protein	NA	A9YX19	Burkholderia_phage	49.6	1.4e-36
AWK42647.1|3451551_3452208_+	hypothetical protein	NA	NA	NA	NA	NA
AWK42648.1|3452204_3452387_+	hypothetical protein	NA	NA	NA	NA	NA
AWK42649.1|3452370_3452595_+	hypothetical protein	NA	NA	NA	NA	NA
AWK42650.1|3452597_3452852_+	hypothetical protein	NA	A0A192YCJ9	Morganella_phage	48.2	1.7e-15
AWK42651.1|3452886_3453516_+	DNA methyltransferase	NA	A0A248SKY3	Klebsiella_phage	57.6	1.1e-66
AWK42652.1|3453502_3453742_+	hypothetical protein	NA	S4TWM3	Salmonella_phage	42.4	5.6e-08
AWK42653.1|3453765_3454068_+	hypothetical protein	NA	NA	NA	NA	NA
AWK42654.1|3454101_3454317_+	hypothetical protein	NA	NA	NA	NA	NA
AWK42655.1|3454313_3454610_+	hypothetical protein	NA	NA	NA	NA	NA
AWK42656.1|3454619_3454838_+	hypothetical protein	NA	NA	NA	NA	NA
AWK42657.1|3454839_3456018_+	recombinase	NA	A0A2D1GN00	Marinobacter_phage	30.9	5.5e-32
AWK42658.1|3456283_3456466_-|tail	phage tail protein	tail	NA	NA	NA	NA
AWK42659.1|3456516_3456804_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42660.1|3456818_3457115_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42661.1|3457229_3458045_-	hypothetical protein	NA	Q7Y5V4	Haemophilus_phage	44.3	8.7e-61
AWK42662.1|3458759_3459785_-	DDE endonuclease	NA	NA	NA	NA	NA
AWK42663.1|3459817_3460117_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42664.1|3460367_3460790_-|tail	phage tail protein	tail	B6SCW7	Bacteriophage	46.0	1.5e-27
AWK42665.1|3460802_3461708_-	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	45.9	1.3e-09
AWK42666.1|3462411_3462834_-|tail	phage tail protein	tail	B6SCW7	Bacteriophage	43.6	1.4e-25
AWK42667.1|3462836_3463424_-|tail	phage tail protein	tail	A0A0M3ULD8	Salmonella_phage	45.5	1.0e-10
AWK42668.1|3463957_3464722_-|tail	phage tail protein	tail	A0A2H4IYR0	uncultured_Caudovirales_phage	41.0	7.3e-09
AWK42669.1|3465165_3466581_-|tail	phage tail protein	tail	A5X9J3	Aeromonas_virus	57.6	1.1e-18
AWK42670.1|3466663_3468148_-|tail	phage tail protein	tail	A5X9J3	Aeromonas_virus	38.0	1.5e-18
AWK42671.1|3469333_3469972_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42672.1|3470414_3470624_+	hypothetical protein	NA	NA	NA	NA	NA
AWK42673.1|3470877_3471435_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AWK42674.1|3471457_3472126_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42675.1|3472142_3473003_-	GHMP kinase	NA	NA	NA	NA	NA
AWK42676.1|3472995_3474069_-	threonine-phosphate decarboxylase	NA	NA	NA	NA	NA
AWK44561.1|3474100_3474883_-	uroporphyrin-III methyltransferase	NA	NA	NA	NA	NA
AWK42677.1|3475198_3476626_+	reactivating factor for ethanolamine ammonia lyase	NA	NA	NA	NA	NA
AWK42678.1|3476638_3478000_+	ethanolamine ammonia-lyase	NA	NA	NA	NA	NA
AWK42679.1|3478022_3478877_+	ethanolamine ammonia-lyase	NA	NA	NA	NA	NA
AWK42680.1|3478970_3479618_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42681.1|3480121_3480541_+	hypothetical protein	NA	NA	NA	NA	NA
AWK42682.1|3480597_3480999_+	hypothetical protein	NA	NA	NA	NA	NA
AWK42683.1|3481530_3481935_+	hypothetical protein	NA	NA	NA	NA	NA
AWK42684.1|3481922_3482753_-	hypothetical protein	NA	A0A140XBD0	Dickeya_phage	50.0	1.4e-26
AWK42685.1|3482760_3483240_-	type VI secretion system protein	NA	NA	NA	NA	NA
AWK42686.1|3483638_3483953_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42687.1|3484274_3485324_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
AWK42688.1|3485328_3485946_-	alpha-ribazole phosphatase	NA	NA	NA	NA	NA
AWK42689.1|3486226_3486577_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42690.1|3487051_3487360_+	transcriptional regulator	NA	A0A222YWD7	Escherichia_phage	45.7	9.7e-13
AWK42691.1|3487396_3488143_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
AWK42692.1|3488139_3488685_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
AWK42693.1|3488681_3490220_-	cobyric acid synthase CobQ	NA	NA	NA	NA	NA
AWK42694.1|3490409_3491123_-	precorrin-2 C(20)-methyltransferase	NA	NA	NA	NA	NA
AWK42695.1|3491122_3491917_-	sirohydrochlorin cobaltochelatase	NA	NA	NA	NA	NA
AWK42696.1|3491930_3492716_-	cobalt-precorrin-6A reductase	NA	NA	NA	NA	NA
AWK42697.1|3492712_3493438_-	cobalt-precorrin-3B C(17)-methyltransferase	NA	NA	NA	NA	NA
AWK42698.1|3493431_3494493_-	cobalamin biosynthesis protein CbiG	NA	NA	NA	NA	NA
AWK42699.1|3494473_3495247_-	cobalt-precorrin-4 C(11)-methyltransferase	NA	NA	NA	NA	NA
AWK42700.1|3495239_3495809_-	cobalt-precorrin-6Y C(15)-methyltransferase	NA	NA	NA	NA	NA
AWK42701.1|3495798_3496401_-	cobalt-precorrin-6Y C(5)-methyltransferase	NA	NA	NA	NA	NA
AWK42702.1|3496397_3497534_-	cobalt-precorrin-5B (C(1))-methyltransferase	NA	NA	NA	NA	NA
AWK42703.1|3497530_3498163_-	precorrin-8X methylmutase	NA	NA	NA	NA	NA
AWK42704.1|3498177_3499137_-	adenosylcobinamide-phosphate synthase	NA	NA	NA	NA	NA
AWK42705.1|3499133_3500516_-	cobyrinic acid a,c-diamide synthase	NA	NA	NA	NA	NA
AWK42706.1|3502293_3503820_+	trypsin	NA	NA	NA	NA	NA
AWK42707.1|3504642_3504924_+	Killer protein	NA	A0A2L1IV28	Escherichia_phage	54.3	4.5e-25
AWK42708.1|3504920_3505211_+	transcriptional regulator	NA	A0A0N7BS23	Escherichia_phage	52.8	1.6e-20
AWK44562.1|3505714_3505927_+	hemolysin XhlA	NA	NA	NA	NA	NA
AWK42709.1|3506100_3506307_+	hypothetical protein	NA	NA	NA	NA	NA
AWK42710.1|3507323_3507896_+	hypothetical protein	NA	NA	NA	NA	NA
AWK42711.1|3508360_3509113_+	hypothetical protein	NA	I6X7P4	Aeromonas_phage	39.8	2.0e-19
AWK42712.1|3509122_3509635_+	hypothetical protein	NA	Q7Y4D3	Escherichia_virus	37.3	1.3e-22
AWK42713.1|3509676_3510774_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42714.1|3510866_3512417_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42715.1|3512832_3513459_-|tail	phage tail protein	tail	A0A218M4J2	Erwinia_phage	43.6	3.8e-40
AWK42716.1|3513458_3514049_-	hypothetical protein	NA	M1TAS6	Escherichia_phage	43.5	1.5e-30
AWK42717.1|3515846_3516824_+	hypothetical protein	NA	A0A1V0SAH6	Catovirus	42.9	2.9e-10
AWK42718.1|3517193_3518162_-|transposase	transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.8e-41
AWK42719.1|3519439_3520396_+	hypothetical protein	NA	NA	NA	NA	NA
AWK42720.1|3520607_3521363_+	beta1,4-galactosyltransferase waax	NA	A0A1V0SJT4	Klosneuvirus	31.4	1.1e-09
AWK42721.1|3521522_3522293_+	hypothetical protein	NA	NA	NA	NA	NA
AWK42722.1|3522743_3523172_-	CopG family transcriptional regulator	NA	A0A0R6PJ17	Moraxella_phage	31.9	1.0e-15
AWK42723.1|3523653_3524142_+	hypothetical protein	NA	NA	NA	NA	NA
AWK42724.1|3524144_3524567_+|tail	phage tail protein	tail	B6SCW7	Bacteriophage	44.2	9.8e-24
AWK42725.1|3524611_3525238_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	41.0	3.8e-32
AWK42726.1|3525237_3526674_-	hypothetical protein	NA	A0A219YBC2	Aeromonas_phage	49.2	2.4e-37
AWK42727.1|3526676_3527249_-	hypothetical protein	NA	A9YX13	Burkholderia_phage	44.3	1.7e-34
AWK42728.1|3527245_3528439_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	50.9	3.6e-103
AWK42729.1|3528431_3528779_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	56.0	2.7e-27
AWK42730.1|3528775_3529531_-	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	62.7	4.4e-75
AWK42731.1|3529527_3530484_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	39.2	1.2e-64
AWK42732.1|3530574_3530880_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	41.1	1.1e-13
AWK42733.1|3530864_3531470_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	51.2	1.1e-47
AWK42734.1|3531472_3533242_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	34.8	2.1e-14
AWK42735.1|3533434_3533845_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42736.1|3533958_3534399_-	hypothetical protein	NA	A0A0M5M1K6	Salmonella_phage	67.8	2.7e-48
AWK42737.1|3534408_3535881_-	hypothetical protein	NA	A0A0P0I492	Acinetobacter_phage	47.3	2.3e-120
AWK42738.1|3535881_3536442_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	53.6	4.0e-49
AWK42739.1|3536964_3537384_-	antitermination protein Q	NA	B6SCZ7	Bacteriophage	45.5	2.6e-29
>prophage 13
CP015281	Photorhabdus laumondii subsp. laumondii strain DSPV002N chromosome, complete genome	5688984	3884606	4077256	5688984	head,transposase,tRNA,tail,integrase,terminase,holin,protease,plate	Burkholderia_phage(14.43%)	182	3864547:3864606	4085181:4085215
3864547:3864606	attL	ATAGATAACTATGTGACCGGGGTGAGTGAGTGCAGCCAACAAAGAAGCAACTTGAAAGAT	NA	NA	NA	NA
AWK42961.1|3884606_3886223_-|transposase	transposase	transposase	NA	NA	NA	NA
3864547:3864606	attL	ATAGATAACTATGTGACCGGGGTGAGTGAGTGCAGCCAACAAAGAAGCAACTTGAAAGAT	NA	NA	NA	NA
AWK42962.1|3886590_3887604_-|integrase	integrase	integrase	NA	NA	NA	NA
AWK42963.1|3889622_3889874_+	hypothetical protein	NA	NA	NA	NA	NA
AWK42964.1|3889860_3891657_+	hypothetical protein	NA	NA	NA	NA	NA
AWK42965.1|3891748_3892171_-	Enhances serine sensitivity	NA	NA	NA	NA	NA
AWK42966.1|3892206_3893502_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	42.3	1.5e-38
AWK42967.1|3893810_3894011_-	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AWK42968.1|3894029_3894365_-	2Fe-2S ferredoxin	NA	NA	NA	NA	NA
AWK42969.1|3894367_3896218_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.1	3.9e-109
AWK42970.1|3896229_3896751_-	co-chaperone HscB	NA	NA	NA	NA	NA
AWK42971.1|3896788_3897112_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	49.5	5.4e-22
AWK42972.1|3897221_3897608_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.2	3.5e-52
AWK42973.1|3897632_3898847_-	cysteine desulfurase IscS	NA	A0A1X7C038	Faustovirus	32.6	2.7e-34
AWK42974.1|3898896_3899391_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
AWK42975.1|3899477_3900203_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
AWK42976.1|3900336_3901140_+	inositol monophosphatase	NA	NA	NA	NA	NA
AWK42977.1|3901242_3902904_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
AWK42978.1|3903003_3904425_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
AWK42979.1|3904573_3905521_-	trehalose operon repressor	NA	NA	NA	NA	NA
AWK42980.1|3905593_3906739_-	3-phenylpropionic acid transporter	NA	NA	NA	NA	NA
AWK42981.1|3907058_3908312_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	51.3	1.9e-99
AWK42982.1|3908683_3909874_+	nitric oxide dioxygenase	NA	NA	NA	NA	NA
AWK42983.1|3910529_3910952_-	RecX family transcriptional regulator	NA	NA	NA	NA	NA
AWK42984.1|3910948_3912343_-	transcriptional regulator	NA	NA	NA	NA	NA
AWK42985.1|3912402_3912984_-	resolvase	NA	A0A0F7LA37	Escherichia_phage	36.6	2.0e-22
AWK42986.1|3913331_3913742_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42987.1|3914457_3915483_-	DDE endonuclease	NA	NA	NA	NA	NA
AWK42988.1|3915554_3915788_+	hypothetical protein	NA	NA	NA	NA	NA
AWK42989.1|3915774_3916425_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42990.1|3916421_3917510_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
AWK42991.1|3918069_3918657_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42992.1|3920686_3922078_-	hypothetical protein	NA	NA	NA	NA	NA
AWK42993.1|3922077_3923151_-	phenazine antibiotic biosynthesis protein	NA	NA	NA	NA	NA
AWK42994.1|3923572_3924457_-|transposase	transposase	transposase	NA	NA	NA	NA
AWK42995.1|3924817_3925156_-	transcriptional regulator	NA	NA	NA	NA	NA
AWK42996.1|3925171_3926794_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	36.8	1.1e-94
AWK42997.1|3926860_3928198_-	response regulator GlrR	NA	W8CYM9	Bacillus_phage	38.2	1.8e-10
AWK44568.1|3928194_3928950_-	hypothetical protein	NA	NA	NA	NA	NA
AWK44569.1|3929043_3930483_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.3	2.0e-15
AWK42998.1|3931210_3931531_+	hypothetical protein	NA	NA	NA	NA	NA
AWK42999.1|3931517_3931865_+	plasmid stabilization protein	NA	NA	NA	NA	NA
AWK43000.1|3931981_3935869_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.0	2.1e-128
AWK43001.1|3936135_3937551_+	lytic transglycosylase F	NA	A0A1V0E6L2	Klebsiella_phage	36.6	1.1e-07
AWK43002.1|3937681_3939988_+	arginine decarboxylase	NA	NA	NA	NA	NA
AWK44570.1|3939976_3940468_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
AWK43003.1|3940746_3941160_-	hypothetical protein	NA	NA	NA	NA	NA
AWK43004.1|3941701_3942214_+	hypothetical protein	NA	NA	NA	NA	NA
AWK43005.1|3942667_3953263_-	hypothetical protein	NA	NA	NA	NA	NA
AWK43006.1|3954539_3954941_+	hypothetical protein	NA	NA	NA	NA	NA
AWK43007.1|3955225_3955726_+	hypothetical protein	NA	M1TAS6	Escherichia_phage	44.5	1.2e-31
AWK43008.1|3955722_3956322_+|tail	phage tail protein	tail	A0A218M4J2	Erwinia_phage	45.2	1.7e-45
AWK43009.1|3957161_3957881_+|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	41.6	3.4e-16
3956563:3956632	attR	ATCTTTCAAGTTGCTTCTTTGTTGGCTGCACTCACTCACCCCGGTCACATAGTTATCTATACCCGTTATC	NA	NA	NA	NA
AWK43010.1|3959754_3960582_+|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	39.2	2.7e-17
3956563:3956632	attR	ATCTTTCAAGTTGCTTCTTTGTTGGCTGCACTCACTCACCCCGGTCACATAGTTATCTATACCCGTTATC	NA	NA	NA	NA
AWK43011.1|3961154_3961982_+|tail	phage tail protein	tail	Q858V4	Yersinia_virus	42.7	2.7e-09
AWK43012.1|3961983_3962418_+|tail	phage tail protein	tail	B6SCW7	Bacteriophage	47.6	7.5e-27
AWK43013.1|3962806_3963526_+|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	41.7	8.9e-17
AWK43014.1|3964213_3964474_+	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	3.8e-18
AWK43015.1|3964476_3964857_-	holo-ACP synthase	NA	NA	NA	NA	NA
AWK43016.1|3964856_3965588_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AWK43017.1|3965782_3966508_-	DNA repair protein RecO	NA	NA	NA	NA	NA
AWK43018.1|3966519_3967428_-	GTPase Era	NA	NA	NA	NA	NA
AWK43019.1|3967424_3968105_-	ribonuclease III	NA	M1HK80	Acanthocystis_turfacea_Chlorella_virus	32.0	2.1e-20
AWK43020.1|3968279_3969260_-	S26 family signal peptidase	NA	NA	NA	NA	NA
AWK44571.1|3969280_3971077_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.8	3.2e-23
AWK43021.1|3971270_3971735_-	SoxR reducing system protein RseC	NA	NA	NA	NA	NA
AWK43022.1|3971734_3972691_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
AWK43023.1|3972696_3973347_-	anti-sigma factor	NA	NA	NA	NA	NA
AWK43024.1|3973386_3973956_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
AWK43025.1|3974159_3975764_+	L-aspartate oxidase	NA	NA	NA	NA	NA
AWK43026.1|3975831_3976566_-|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
AWK43027.1|3976848_3978186_+	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	29.8	4.2e-44
AWK43028.1|3978356_3978875_-	hypothetical protein	NA	NA	NA	NA	NA
AWK43029.1|3979432_3980647_-	hypothetical protein	NA	NA	NA	NA	NA
AWK43030.1|3980639_3981227_-	hypothetical protein	NA	NA	NA	NA	NA
AWK43031.1|3981233_3982259_-	DDE endonuclease	NA	NA	NA	NA	NA
AWK43032.1|3983531_3984278_-	hypothetical protein	NA	NA	NA	NA	NA
AWK43033.1|3984960_3985974_+|integrase	integrase	integrase	NA	NA	NA	NA
AWK43034.1|3986349_3987240_-	hypothetical protein	NA	NA	NA	NA	NA
AWK43035.1|3987277_3987982_-	hypothetical protein	NA	NA	NA	NA	NA
AWK44572.1|3987988_3989203_-	colanic acid biosynthesis glycosyltransferase WcaL	NA	NA	NA	NA	NA
AWK43036.1|3989471_3990086_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AWK43037.1|3990107_3991217_-	hypothetical protein	NA	NA	NA	NA	NA
AWK43038.1|3991705_3993124_-	hypothetical protein	NA	NA	NA	NA	NA
AWK43039.1|3993320_3993851_-	isopentenyl-diphosphate delta-isomerase	NA	NA	NA	NA	NA
AWK43040.1|3993866_3994610_-	geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
AWK43041.1|3994856_3995996_-	hypothetical protein	NA	NA	NA	NA	NA
AWK43042.1|3995997_3996846_-	radical SAM protein	NA	A0A1B1ITW6	uncultured_Mediterranean_phage	24.8	5.4e-13
AWK43043.1|3997545_3998133_-	hypothetical protein	NA	NA	NA	NA	NA
AWK43044.1|3998148_3999165_-	phospholipase	NA	NA	NA	NA	NA
AWK43045.1|3999923_4000604_+	uracil-DNA glycosylase	NA	A0A1R3T3N6	Sphenicid_alphaherpesvirus	46.7	4.3e-53
AWK43046.1|4000672_4001254_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AWK43047.1|4001378_4002257_+	NAD(+) kinase	NA	NA	NA	NA	NA
AWK43048.1|4002345_4004007_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AWK43049.1|4004245_4004593_+	membrane biogenesis protein	NA	NA	NA	NA	NA
AWK43050.1|4004648_4004942_-	RnfH family protein	NA	NA	NA	NA	NA
AWK43051.1|4004934_4005369_-	ubiquinone-binding protein	NA	NA	NA	NA	NA
AWK43052.1|4005525_4006008_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	49.4	7.3e-31
AWK43053.1|4006888_4007074_+	hypothetical protein	NA	NA	NA	NA	NA
AWK44573.1|4007291_4007501_+	hypothetical protein	NA	NA	NA	NA	NA
AWK43054.1|4007648_4008095_-|tail	phage tail protein	tail	F1BUK2	Cronobacter_phage	60.7	1.1e-09
AWK43055.1|4008095_4009439_-	hypothetical protein	NA	H9C0Y2	Aeromonas_phage	49.2	7.0e-23
AWK43056.1|4009425_4010031_-	hypothetical protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	37.7	2.0e-30
AWK43057.1|4010031_4011273_-	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	50.2	7.4e-104
AWK43058.1|4011272_4011629_-	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	50.9	1.9e-20
AWK43059.1|4012057_4012591_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	54.1	2.0e-53
AWK44574.1|4013054_4013591_-	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	47.8	2.8e-39
AWK43060.1|4013613_4014510_-	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	35.4	1.5e-42
AWK43061.1|4014506_4014812_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	52.1	3.9e-22
AWK43062.1|4014808_4015630_-	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	7.8e-25
AWK43063.1|4015629_4017750_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	57.1	5.4e-46
AWK43064.1|4017955_4018363_-	hypothetical protein	NA	H9C0W7	Aeromonas_phage	45.7	1.6e-18
AWK43065.1|4018362_4018800_-	hypothetical protein	NA	A0A077K9T0	Edwardsiella_phage	36.7	2.3e-20
AWK43066.1|4018799_4020287_-	hypothetical protein	NA	E2GLU1	Acinetobacter_phage	31.7	3.0e-59
AWK44575.1|4020267_4020753_-	hypothetical protein	NA	Q6UJ27	Burkholderia_virus	33.8	2.4e-10
AWK43067.1|4020809_4021181_-	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	46.7	3.2e-26
AWK43068.1|4021177_4021636_-	hypothetical protein	NA	A0A068C8K8	Acinetobacter_phage	40.8	5.7e-17
AWK43069.1|4021635_4022085_-	hypothetical protein	NA	H9C0W0	Aeromonas_phage	45.9	1.0e-18
AWK43070.1|4022089_4022416_-	hypothetical protein	NA	A0A1X9SFA9	Acinetobacter_phage	38.6	3.5e-13
AWK43071.1|4022416_4023451_-	hypothetical protein	NA	A0A219YBB0	Aeromonas_phage	47.0	1.3e-82
AWK43072.1|4023450_4023927_-	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	44.2	5.3e-26
AWK43073.1|4023929_4025255_-	hypothetical protein	NA	A0A219YBB9	Aeromonas_phage	42.7	1.8e-71
AWK43074.1|4025272_4025965_-|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	45.1	2.0e-50
AWK43075.1|4026050_4027556_-	hypothetical protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	45.5	4.5e-103
AWK43076.1|4027533_4028790_-|terminase	terminase	terminase	A0A2H4JCM3	uncultured_Caudovirales_phage	64.0	1.5e-144
AWK43077.1|4028798_4029518_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	37.3	6.4e-07
AWK43078.1|4029596_4029914_-	hypothetical protein	NA	NA	NA	NA	NA
AWK43079.1|4030352_4030865_+	hypothetical protein	NA	NA	NA	NA	NA
AWK43080.1|4031307_4032207_-	hypothetical protein	NA	NA	NA	NA	NA
AWK43081.1|4032226_4032745_-	hypothetical protein	NA	NA	NA	NA	NA
AWK44576.1|4032875_4033325_-	peptidase	NA	Q8HA85	Salmonella_phage	46.6	1.3e-18
AWK43082.1|4033417_4033954_-	lysozyme	NA	K7PM52	Enterobacteria_phage	67.8	3.7e-68
AWK43083.1|4033937_4034120_-|holin	holin	holin	B6SD15	Bacteriophage	58.6	4.2e-16
AWK43084.1|4036098_4036347_-	transcriptional regulator	NA	NA	NA	NA	NA
AWK43085.1|4036435_4036690_-	transcriptional regulator	NA	NA	NA	NA	NA
AWK43086.1|4036794_4037052_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.2	1.9e-17
AWK43087.1|4037152_4037605_-|tail	phage tail protein	tail	A0A0M4RTP2	Salmonella_phage	43.8	1.2e-11
AWK43088.1|4038584_4039160_-|tail	phage tail protein	tail	A4JWL7	Burkholderia_virus	62.2	9.5e-62
AWK43089.1|4039152_4040256_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	50.7	1.1e-98
AWK43090.1|4040246_4040600_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.2	2.5e-33
AWK43091.1|4040646_4041252_-|plate	baseplate protein	plate	A0A067ZIM2	Vibrio_phage	41.1	7.0e-15
AWK43092.1|4041248_4042427_-	Cro/Cl family transcriptional regulator	NA	Q6QIA2	Burkholderia_phage	50.1	3.5e-87
AWK43093.1|4042414_4042627_-	hypothetical protein	NA	NA	NA	NA	NA
AWK43094.1|4042629_4043514_-	hypothetical protein	NA	Q6QIA4	Burkholderia_phage	47.1	2.4e-56
AWK43095.1|4043513_4046066_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	42.0	4.8e-166
AWK43096.1|4046148_4046475_-	hypothetical protein	NA	NA	NA	NA	NA
AWK43097.1|4046732_4047257_-|tail	phage tail protein	tail	A4JWK6	Burkholderia_virus	70.1	6.0e-71
AWK43098.1|4047256_4048684_-|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	73.2	2.3e-205
AWK43099.1|4048673_4048886_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	41.9	5.4e-07
AWK43100.1|4048882_4049350_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	53.4	1.4e-39
AWK43101.1|4049349_4049787_-	hypothetical protein	NA	A4JWK2	Burkholderia_virus	47.7	3.6e-29
AWK43102.1|4049788_4050139_-	hypothetical protein	NA	Q6QIB4	Burkholderia_phage	46.9	7.4e-17
AWK43103.1|4050152_4051088_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.9	1.9e-67
AWK43104.1|4051119_4052214_-	peptidase	NA	A4JWJ9	Burkholderia_virus	51.6	1.3e-99
AWK43105.1|4052418_4052868_-	phage morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	40.6	4.0e-23
AWK43106.1|4052860_4053691_-|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	62.9	9.7e-100
AWK43107.1|4053671_4055165_-	hypothetical protein	NA	Q6QIC0	Burkholderia_phage	59.3	5.5e-170
AWK43108.1|4055164_4056688_-	hypothetical protein	NA	Q6QIC1	Burkholderia_phage	61.8	5.4e-181
AWK43109.1|4056684_4057230_-|terminase	terminase	terminase	A4JWJ3	Burkholderia_virus	65.4	4.3e-56
AWK43110.1|4057229_4057541_-	hypothetical protein	NA	A0A2H4JGU5	uncultured_Caudovirales_phage	61.0	2.3e-30
AWK43111.1|4057533_4057866_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.6	6.8e-20
AWK43112.1|4057862_4058486_-	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	33.3	2.0e-09
AWK43113.1|4058475_4059093_-	lytic transglycosylase	NA	A0A2H4J7R8	uncultured_Caudovirales_phage	51.7	4.6e-54
AWK43114.1|4059095_4059446_-	hypothetical protein	NA	A4JWP3	Burkholderia_virus	52.3	7.1e-20
AWK43115.1|4059696_4060467_+	restriction endonuclease subunit M	NA	A2I2Y7	Vibrio_virus	64.9	1.3e-98
AWK43116.1|4060514_4060952_-	hypothetical protein	NA	NA	NA	NA	NA
AWK43117.1|4060969_4061398_-	hypothetical protein	NA	NA	NA	NA	NA
AWK43118.1|4061435_4061780_-	hypothetical protein	NA	NA	NA	NA	NA
AWK43119.1|4062299_4062485_+	DNA-binding protein	NA	A0A0S4L0D0	Pseudomonas_phage	71.4	1.9e-16
AWK43120.1|4062540_4062849_+	IclR family transcriptional regulator	NA	Q5ZR02	Pseudomonas_phage	49.0	2.0e-18
AWK43121.1|4062868_4063825_+	hypothetical protein	NA	A4JWN3	Burkholderia_virus	44.1	1.1e-62
AWK43122.1|4063878_4065663_+|integrase	integrase	integrase	Q6QIE0	Burkholderia_phage	54.3	1.3e-181
AWK43123.1|4065901_4067074_+	hypothetical protein	NA	A4JWN1	Burkholderia_virus	58.8	8.0e-116
AWK43124.1|4067532_4067724_+	hypothetical protein	NA	NA	NA	NA	NA
AWK43125.1|4068245_4068614_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.4	4.4e-28
AWK43126.1|4070559_4071153_-	hypothetical protein	NA	H9C173	Pectobacterium_phage	54.1	9.2e-60
AWK43127.1|4071253_4072453_-	hypothetical protein	NA	B6SBZ6	Clostridium_virus	31.0	6.6e-49
AWK43128.1|4073565_4074933_-	hypothetical protein	NA	K7P852	Enterobacteria_phage	44.1	1.1e-92
AWK43129.1|4074934_4075519_-	DNA replication protein DnaC	NA	K7PLU3	Enterobacteria_phage	48.1	6.7e-47
AWK43130.1|4075527_4076280_-	hypothetical protein	NA	A0A1W6JP36	Morganella_phage	48.1	1.6e-29
AWK43131.1|4076282_4076507_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	47.9	6.6e-11
AWK43132.1|4076521_4076971_-|tRNA	tRNA-(guanine-N1)-methyltransferase	tRNA	H9C162	Pectobacterium_phage	53.7	5.7e-30
AWK43133.1|4077028_4077256_-	XRE family transcriptional regulator	NA	A0A1W6JTD1	Pseudomonas_phage	42.0	1.4e-05
4085181:4085215	attR	GGACGCGGGTTCAACTCCCGCCAGCTCCACCAAAT	NA	NA	NA	NA
>prophage 14
CP015281	Photorhabdus laumondii subsp. laumondii strain DSPV002N chromosome, complete genome	5688984	4083756	4092678	5688984		Cronobacter_phage(71.43%)	9	NA	NA
AWK43140.1|4083756_4083972_+	excisionase	NA	I6PBM8	Cronobacter_phage	71.7	3.0e-21
AWK44577.1|4085552_4085768_-	hypothetical protein	NA	NA	NA	NA	NA
AWK43141.1|4085861_4086062_+	hypothetical protein	NA	NA	NA	NA	NA
AWK43142.1|4086058_4086328_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	61.5	2.1e-16
AWK43143.1|4086675_4087086_-	antitoxin	NA	F1C593	Cronobacter_phage	57.9	1.9e-35
AWK43144.1|4087139_4087313_-	mRNA interferase	NA	A0A0M3LQ86	Mannheimia_phage	66.7	3.7e-14
AWK43145.1|4089080_4089617_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	54.9	2.0e-42
AWK43146.1|4089588_4090317_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	33.3	6.6e-36
AWK43147.1|4090935_4092678_-	hypothetical protein	NA	F1BUK3	Cronobacter_phage	54.2	4.3e-73
>prophage 15
CP015281	Photorhabdus laumondii subsp. laumondii strain DSPV002N chromosome, complete genome	5688984	4732371	4741416	5688984		Cronobacter_phage(66.67%)	8	NA	NA
AWK43630.1|4732371_4733223_+	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.3	1.1e-05
AWK43631.1|4733222_4733495_+	phosphohistidinoprotein-hexose phosphotransferase	NA	NA	NA	NA	NA
AWK43632.1|4733683_4734094_+	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
AWK43633.1|4734834_4735104_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	61.5	1.3e-16
AWK43634.1|4736106_4737756_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	50.3	2.8e-159
AWK43635.1|4737755_4738292_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	54.9	2.0e-42
AWK43636.1|4738263_4738992_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	32.9	6.6e-36
AWK43637.1|4739607_4741416_-	hypothetical protein	NA	F1BUK3	Cronobacter_phage	52.5	4.2e-79
