The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP014031	Hafnia paralvei strain FDAARGOS_158 chromosome, complete genome	4513714	2732701	2813974	4513714	tail,tRNA,terminase,holin,plate,portal	Vibrio_phage(17.65%)	86	NA	NA
AMH18656.1|2732701_2733883_-	recombinase	NA	A0A2D1GN00	Marinobacter_phage	30.9	1.2e-31
AMH18657.1|2733883_2734102_-	hypothetical protein	NA	NA	NA	NA	NA
AMH18658.1|2734156_2734774_-	3'-5' exoribonuclease	NA	A0A0H4IPM9	Stenotrophomonas_phage	32.8	4.8e-19
AMH18659.1|2734929_2735124_-	hypothetical protein	NA	A0A1B0VN94	Pseudomonas_phage	71.8	3.3e-11
AVE16668.1|2735123_2735600_-	hypothetical protein	NA	H2BDF1	Pseudomonas_virus	58.0	3.9e-13
AVE16669.1|2735604_2736261_-	hypothetical protein	NA	A0A076G7C3	Sinorhizobium_phage	37.9	7.8e-28
AMH18661.1|2736250_2736724_-	hypothetical protein	NA	A0A2H4J7V6	uncultured_Caudovirales_phage	40.0	5.8e-17
AMH18662.1|2737233_2737500_+	hypothetical protein	NA	NA	NA	NA	NA
AMH20251.1|2737483_2738131_-	phage repressor protein	NA	H9C160	Pectobacterium_phage	67.1	4.3e-79
AMH18663.1|2738237_2738441_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	70.2	6.6e-18
AMH18664.1|2738465_2738999_+	DNA-binding protein	NA	A0A0P0ZE62	Stx2-converting_phage	33.3	1.4e-14
AMH18665.1|2739179_2739359_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AMH18666.1|2739355_2740312_+	GntR family transcriptional regulator	NA	U5P0A0	Shigella_phage	73.7	2.0e-32
AMH18667.1|2740308_2740581_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AMH18668.1|2740583_2741237_+	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	71.9	3.1e-93
AMH18669.1|2741233_2741986_+	hypothetical protein	NA	M1FN76	Enterobacteria_phage	86.0	2.8e-130
AMH18670.1|2741993_2742371_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	62.7	2.0e-36
AMH18671.2|2742367_2743372_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	44.9	2.3e-79
AMH18672.1|2743392_2744088_+	hypothetical protein	NA	A0A1W6JP37	Morganella_phage	37.8	1.2e-39
AMH18673.1|2745174_2745348_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	63.2	1.2e-12
AMH18674.1|2745398_2745806_+	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	61.4	2.6e-37
AMH18675.1|2745898_2746723_+	hypothetical protein	NA	NA	NA	NA	NA
AMH18676.1|2746948_2747281_+|holin	phage holin, lambda family	holin	Q2A0C6	Sodalis_phage	42.2	3.7e-18
AMH18677.1|2747290_2747905_+	endolysin	NA	A0A192Y6G4	Salmonella_phage	83.8	9.4e-92
AMH18678.1|2747901_2748444_+	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	43.9	2.0e-29
AMH18679.1|2748630_2748837_+	hypothetical protein	NA	NA	NA	NA	NA
AMH18680.1|2749214_2749709_+	DUF1441 domain-containing protein	NA	K7PJY2	Enterobacterial_phage	65.2	3.2e-50
AMH18681.1|2749708_2751838_+|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	71.7	6.0e-295
AMH18682.1|2751834_2752050_+	hypothetical protein	NA	NA	NA	NA	NA
AMH18683.1|2752058_2753597_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	53.1	5.9e-151
AMH18684.1|2753544_2755593_+	peptidase S14	NA	A0A1W6JT88	Pseudomonas_phage	54.9	6.1e-196
AMH18685.1|2755670_2756021_+	DUF2190 domain-containing protein	NA	Q9EYD5	Enterobacteria_phage	40.5	5.1e-10
AMH18686.1|2756020_2756380_+	hypothetical protein	NA	NA	NA	NA	NA
AMH18687.2|2756411_2757041_+	hypothetical protein	NA	R9TR34	Vibrio_phage	34.3	1.3e-16
AMH18688.1|2757050_2757590_+	hypothetical protein	NA	R9TNK0	Vibrio_phage	29.5	3.7e-15
AVE16670.1|2757582_2758197_+|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	39.4	7.9e-14
AMH18689.2|2758218_2759697_+|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	42.8	8.1e-73
AMH18690.1|2759696_2760203_+|tail	phage tail protein	tail	Q75QK9	Wolbachia_phage	31.8	4.5e-15
AMH18691.1|2760260_2760557_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AMH18692.1|2760659_2762435_+	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	28.1	7.1e-23
AMH18693.1|2762434_2762911_+|tail	phage tail protein	tail	D4HTW5	Vibrio_phage	37.1	4.5e-17
AMH18694.2|2762918_2763101_+|tail	phage tail protein	tail	V5YTI6	Pseudomonas_phage	44.8	1.0e-06
AMH18695.1|2763104_2764220_+	late control protein D	NA	R9TNM7	Vibrio_phage	34.1	4.9e-38
AMH18696.1|2764253_2764604_+|plate	baseplate assembly protein	plate	D4HTV2	Vibrio_phage	51.4	2.8e-24
AVE16671.1|2764587_2765502_+|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	46.4	4.1e-67
AMH18697.1|2765494_2766046_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	43.3	4.1e-30
AVE16672.1|2766038_2767607_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	39.3	1.0e-65
AMH18698.1|2767606_2768194_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	46.0	1.1e-44
AMH18699.2|2768253_2769222_-	glycosyl transferase family 8	NA	NA	NA	NA	NA
AMH18700.1|2769525_2769903_+	hypothetical protein	NA	Q6UAV9	Klebsiella_phage	50.4	2.2e-27
AMH18701.1|2769942_2770203_-	DinI family protein	NA	NA	NA	NA	NA
AMH18702.1|2770595_2772380_-	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
AMH20252.1|2772410_2772638_-	hypothetical protein	NA	NA	NA	NA	NA
AMH18703.1|2772848_2773856_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.8	3.9e-87
AMH18704.1|2773947_2774232_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
AMH18705.1|2774377_2776138_-	ATP-dependent helicase	NA	M4Q3N1	Vibrio_phage	42.6	1.3e-98
AMH18706.1|2776162_2776402_-	DUF2492 domain-containing protein	NA	NA	NA	NA	NA
AMH18707.1|2776698_2777421_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
AMH18708.1|2777511_2778720_+	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	24.3	3.7e-23
AMH18709.1|2779666_2780047_+	hypothetical protein	NA	NA	NA	NA	NA
AMH18710.1|2780173_2781787_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	30.2	1.9e-19
AMH18711.1|2781788_2782811_-	microcin ABC transporter permease	NA	NA	NA	NA	NA
AMH18712.1|2782810_2783908_-	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
AMH18713.1|2783918_2785745_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AMH18714.1|2785994_2787578_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AMH18715.1|2787866_2788508_-	flavin reductase family protein	NA	NA	NA	NA	NA
AMH18716.1|2788682_2789630_+	23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF	NA	NA	NA	NA	NA
AMH18717.1|2789690_2791934_-	mechanosensitive channel protein	NA	NA	NA	NA	NA
AMH18718.1|2792183_2792906_-	glutamine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.6	2.5e-35
AMH18719.1|2792902_2793571_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
AMH18720.1|2793798_2794542_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
AMH18721.1|2794976_2795411_-	NUDIX domain-containing protein	NA	A0A1L7N1W6	Ralstonia_phage	38.6	5.2e-12
AMH18722.1|2795671_2796805_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AMH18723.1|2796807_2797746_+	1-phosphofructokinase	NA	NA	NA	NA	NA
AMH18724.1|2797760_2799452_+	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
AMH18725.1|2799520_2800378_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	32.2	9.9e-23
AVE16673.1|2800563_2800749_-	hypothetical protein	NA	NA	NA	NA	NA
AMH18727.1|2801289_2802378_-	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
AMH18728.1|2803046_2803487_+	universal stress protein UspA	NA	A0A1W6JNV4	Morganella_phage	43.0	1.4e-20
AMH18729.1|2803805_2804669_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AMH18730.1|2804886_2806371_+	amino acid permease	NA	NA	NA	NA	NA
AMH20253.2|2806604_2807759_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AMH18731.1|2807816_2808899_+	iron ABC transporter permease	NA	NA	NA	NA	NA
AMH18732.1|2808895_2809684_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.2	4.2e-12
AMH18733.2|2809876_2811853_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	35.8	5.7e-13
AMH18734.1|2811919_2813974_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.9	1.8e-54
>prophage 2
CP014031	Hafnia paralvei strain FDAARGOS_158 chromosome, complete genome	4513714	3415654	3429688	4513714	tRNA	Tupanvirus(33.33%)	14	NA	NA
AMH19241.1|3415654_3417637_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.4	9.6e-21
AMH19242.1|3417636_3418653_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	33.5	1.7e-37
AMH19243.1|3418645_3419794_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	C7U074	Ostreococcus_tauri_virus	29.6	4.1e-24
AMH20273.1|3420076_3420847_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2K9L407	Tupanvirus	23.6	1.4e-07
AMH20274.1|3420856_3421867_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
AMH19244.1|3421917_3422115_-	hypothetical protein	NA	NA	NA	NA	NA
AMH19245.1|3422197_3422494_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	3.2e-13
AMH19246.1|3422498_3424886_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	28.9	5.1e-08
AMH19247.1|3424900_3425884_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.0	1.3e-34
AMH19248.1|3426057_3426282_+	hypothetical protein	NA	NA	NA	NA	NA
AMH19249.1|3426517_3426874_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AMH19250.1|3426916_3427114_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AMH19251.2|3427212_3427755_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	8.8e-17
AMH19252.1|3427750_3429688_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.9	9.4e-130
>prophage 3
CP014031	Hafnia paralvei strain FDAARGOS_158 chromosome, complete genome	4513714	3903414	3911356	4513714	tRNA	Escherichia_phage(66.67%)	6	NA	NA
AMH19634.1|3903414_3904029_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	39.2	7.8e-30
AMH19635.1|3904142_3905003_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	35.5	3.3e-26
AMH19636.1|3905004_3905622_-	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	58.6	5.2e-74
AVE16736.1|3905632_3908077_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	1.3e-216
AMH19637.1|3908611_3909904_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.8	4.0e-92
AMH19638.1|3910012_3911356_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	41.3	1.5e-78
>prophage 4
CP014031	Hafnia paralvei strain FDAARGOS_158 chromosome, complete genome	4513714	4416022	4453454	4513714	tail,terminase,plate,integrase,portal	Vibrio_phage(27.27%)	46	4413809:4413837	4453556:4453584
4413809:4413837	attL	GGGTTCAAATCCCCCCAGCTCCACCAAAT	NA	NA	NA	NA
AMH20043.1|4416022_4418989_+	histidine kinase	NA	A0A1B5FPD5	Escherichia_phage	34.7	3.9e-82
AMH20044.1|4418985_4420779_+	hypothetical protein	NA	NA	NA	NA	NA
AMH20045.1|4421363_4421909_+	serine acetyltransferase	NA	NA	NA	NA	NA
AMH20046.1|4421927_4422479_-|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	39.2	3.3e-27
AVE16763.1|4422450_4423983_-	hypothetical protein	NA	S4TP62	Salmonella_phage	29.0	2.5e-37
AMH20047.1|4423975_4424527_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	43.3	3.2e-30
AMH20048.1|4424519_4425434_-|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	46.7	1.8e-67
AMH20049.1|4425417_4425768_-|plate	baseplate assembly protein	plate	D4HTV2	Vibrio_phage	50.5	8.1e-24
AMH20050.1|4425801_4426926_-	late control protein D	NA	R9TNM7	Vibrio_phage	35.0	3.1e-40
AMH20051.1|4426929_4427145_-|tail	phage tail protein	tail	R9TR63	Vibrio_phage	48.6	7.0e-10
AMH20052.1|4427119_4427596_-|tail	phage tail protein	tail	D4HTW5	Vibrio_phage	37.1	3.5e-17
AMH20053.1|4427595_4429371_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	28.1	2.4e-23
AMH20054.1|4429473_4429770_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AMH20055.1|4429827_4430334_-|tail	phage tail protein	tail	Q75QK9	Wolbachia_phage	31.8	4.5e-15
AMH20056.2|4430333_4431812_-|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	42.8	1.8e-72
AMH20057.1|4431833_4432448_-|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	38.6	7.9e-14
AMH20058.1|4432440_4432980_-	hypothetical protein	NA	R9TNK0	Vibrio_phage	30.1	2.1e-15
AMH20059.2|4432989_4433619_-	hypothetical protein	NA	R9TR34	Vibrio_phage	34.3	2.3e-16
AMH20060.1|4433650_4434010_-	hypothetical protein	NA	NA	NA	NA	NA
AMH20061.1|4434009_4434360_-	DUF2190 domain-containing protein	NA	S5MQJ5	Escherichia_phage	38.6	1.1e-09
AMH20062.1|4434437_4436486_-	peptidase S14	NA	S5M7Q8	Escherichia_phage	54.1	1.8e-195
AMH20063.1|4436433_4437972_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	52.9	5.9e-151
AMH20064.1|4437980_4438196_-	hypothetical protein	NA	NA	NA	NA	NA
AMH20065.1|4438192_4440322_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	71.7	7.8e-295
AMH20066.1|4440321_4440816_-	DUF1441 domain-containing protein	NA	K7PJY2	Enterobacterial_phage	65.2	3.2e-50
AMH20067.1|4441030_4441234_-	hypothetical protein	NA	NA	NA	NA	NA
AMH20068.1|4441345_4441870_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
AMH20069.1|4441866_4442397_-	lysozyme	NA	A0A2R2Z343	Escherichia_phage	71.8	4.0e-67
AMH20070.1|4442851_4443322_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AMH20071.1|4443495_4443915_-	hypothetical protein	NA	NA	NA	NA	NA
AMH20072.1|4444055_4444463_-	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	62.1	3.0e-38
AMH20073.1|4444513_4444687_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	63.2	1.2e-12
AMH20074.1|4444824_4445088_+	hypothetical protein	NA	NA	NA	NA	NA
AMH20075.1|4445198_4445894_-	hypothetical protein	NA	A0A1W6JP37	Morganella_phage	37.8	7.2e-40
AMH20076.1|4445914_4446913_-	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	45.3	1.8e-79
AMH20077.1|4446909_4447557_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	72.9	3.6e-94
AMH20078.1|4447559_4447832_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AMH20079.1|4447828_4448785_-	GntR family transcriptional regulator	NA	U5P0A0	Shigella_phage	73.1	7.6e-32
AMH20080.1|4448781_4448961_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AMH20081.1|4449141_4449675_-	DNA-binding protein	NA	A0A0P0ZE62	Stx2-converting_phage	33.3	1.4e-14
AVE16764.1|4449699_4449927_-	XRE family transcriptional regulator	NA	K7PMD5	Enterobacterial_phage	69.1	1.3e-22
AMH20082.1|4450036_4450690_+	LexA family transcriptional repressor	NA	K7PH71	Enterobacterial_phage	70.7	2.5e-82
AMH20083.1|4451058_4451442_+	hypothetical protein	NA	NA	NA	NA	NA
AMH20084.1|4451434_4452052_+	3'-5' exoribonuclease	NA	R9TPV7	Vibrio_phage	32.2	5.3e-18
AVE16765.1|4452105_4452318_+	excisionase	NA	I6PBM8	Cronobacter_phage	72.6	2.7e-22
AMH20085.1|4452272_4453454_+|integrase	site-specific integrase	integrase	I6PDJ1	Cronobacter_phage	69.8	2.1e-156
4453556:4453584	attR	GGGTTCAAATCCCCCCAGCTCCACCAAAT	NA	NA	NA	NA
