The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP014060	Achromobacter xylosoxidans strain FDAARGOS_147, complete genome	6864988	1215868	1223878	6864988	tRNA	uncultured_Mediterranean_phage(33.33%)	9	NA	NA
AMG35477.2|1215868_1216558_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	45.2	9.4e-32
AMG35478.1|1216677_1217436_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.6	2.6e-67
AUZ17994.1|1217626_1218265_+	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AMG35479.1|1218343_1219375_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	51.7	2.4e-92
AMG35480.1|1219483_1220776_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.3	1.2e-64
AMG35481.1|1220933_1221290_-	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
AMG35482.1|1221659_1222682_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
AMG35483.1|1222882_1223257_+	thioredoxin	NA	V9SJ74	Achromobacter_phage	26.8	5.5e-10
AMG35484.1|1223290_1223878_-	DUF1949 domain-containing protein	NA	A0A1X9I5T8	Streptococcus_phage	39.6	1.2e-19
>prophage 2
CP014060	Achromobacter xylosoxidans strain FDAARGOS_147, complete genome	6864988	1973669	1996281	6864988	tail,head	Pseudomonas_phage(40.91%)	29	NA	NA
AMG36099.1|1973669_1974179_-	hypothetical protein	NA	I6NSS1	Burkholderia_phage	57.4	1.3e-43
AMG36100.1|1974181_1974625_-	hypothetical protein	NA	A0A0A1IVG1	Pseudomonas_phage	35.0	2.0e-11
AMG36101.1|1974722_1975172_-|tail	phage tail protein	tail	Q9ZXK5	Pseudomonas_virus	48.6	1.0e-26
AMG36102.2|1975171_1976485_-	hypothetical protein	NA	A0A2H4JF09	uncultured_Caudovirales_phage	30.0	3.8e-05
AMG36104.1|1976484_1977150_-	DUF2612 domain-containing protein	NA	D4N460	Pseudomonas_phage	31.8	1.6e-15
AMG36105.1|1977149_1978601_-	hypothetical protein	NA	A0A0N9SH53	Pseudomonas_phage	36.0	2.2e-75
AMG36106.1|1978622_1978991_-	hypothetical protein	NA	A0A218MAM6	Escherichia_phage	36.2	1.5e-12
AMG36107.1|1978990_1979689_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	29.7	2.1e-10
AMG36108.1|1979685_1980603_-	hypothetical protein	NA	E5AGC0	Erwinia_phage	32.2	3.6e-39
AMG36109.1|1980589_1980922_-	hypothetical protein	NA	A0A0N9SG14	Pseudomonas_phage	42.5	2.1e-13
AMG36110.1|1980926_1981547_-	hypothetical protein	NA	I3PGV3	Xanthomonas_phage	28.2	1.7e-08
AMG36111.1|1981560_1984023_-|tail	tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	28.3	5.9e-20
AUZ18037.1|1984019_1984247_-	hypothetical protein	NA	NA	NA	NA	NA
AMG36112.1|1984165_1984675_-	hypothetical protein	NA	NA	NA	NA	NA
AMG36113.1|1984674_1985103_-	DUF3277 domain-containing protein	NA	A0A0N7GFC4	Pseudomonas_phage	38.2	8.7e-20
AMG36114.1|1985118_1986477_-	DUF3383 domain-containing protein	NA	A0A0N9SJA3	Pseudomonas_phage	40.0	3.3e-81
AMG36115.1|1986543_1987002_-	hypothetical protein	NA	NA	NA	NA	NA
AMG36116.1|1987129_1987543_-	hypothetical protein	NA	NA	NA	NA	NA
AMG36117.1|1987547_1988000_-	hypothetical protein	NA	A0A2K9V3I1	Faecalibacterium_phage	32.8	2.7e-11
AMG36118.1|1987989_1988364_-	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
AMG36119.1|1988366_1988753_-	hypothetical protein	NA	NA	NA	NA	NA
AMG36120.1|1988752_1989712_-	DUF2184 domain-containing protein	NA	A0A0N9SG07	Pseudomonas_phage	38.0	2.0e-56
AMG36121.1|1989779_1990232_-	hypothetical protein	NA	NA	NA	NA	NA
AMG36122.1|1990231_1991314_-	DUF2213 domain-containing protein	NA	E5AGA6	Erwinia_phage	39.6	6.2e-54
AMG36123.2|1991324_1992014_-|head	phage head morphogenesis protein	head	I3PGT9	Xanthomonas_phage	40.8	5.9e-34
AMG36124.1|1992105_1993386_-	DUF1073 domain-containing protein	NA	A0A2H4PGN2	Escherichia_phage	29.3	5.6e-30
AMG36125.2|1993385_1994909_-	hypothetical protein	NA	A0A291LBL3	Klebsiella_phage	46.8	3.3e-114
AMG36126.1|1994919_1995393_-	DUF2280 domain-containing protein	NA	A0A125RNL6	Pseudomonas_phage	56.6	4.8e-35
AUZ18038.1|1995930_1996281_-	hypothetical protein	NA	A0A1B0VRJ1	Pseudomonas_phage	44.1	5.3e-15
>prophage 3
CP014060	Achromobacter xylosoxidans strain FDAARGOS_147, complete genome	6864988	2129832	2147258	6864988	tail,terminase	uncultured_Caudovirales_phage(17.65%)	19	NA	NA
AMG40204.2|2129832_2133663_-	hypothetical protein	NA	I7HDJ4	Xanthomonas_virus	27.2	8.9e-55
AMG36243.1|2133704_2134091_-	hypothetical protein	NA	NA	NA	NA	NA
AMG36244.1|2134092_2134569_-	DUF1833 domain-containing protein	NA	I7GYA2	Xanthomonas_virus	26.5	3.8e-08
AMG36245.1|2134570_2134915_-	hypothetical protein	NA	NA	NA	NA	NA
AMG36246.1|2134915_2137585_-|tail	phage tail tape measure protein	tail	A0A1V0E821	Vibrio_phage	36.8	3.7e-108
AMG36247.1|2137609_2137900_-	hypothetical protein	NA	A0A2H4JBP7	uncultured_Caudovirales_phage	35.5	1.9e-10
AMG36248.1|2137917_2138247_-	hypothetical protein	NA	A0A0M7QCN0	Escherichia_phage	35.5	7.7e-08
AMG40205.2|2138259_2138778_-|tail	phage tail protein	tail	A0A2H4J6K6	uncultured_Caudovirales_phage	39.9	8.9e-27
AMG36249.1|2138960_2139383_-	hypothetical protein	NA	I6PDJ8	Cronobacter_phage	29.2	2.9e-07
AMG36250.1|2139379_2139778_-	hypothetical protein	NA	A0A088FBW9	Salmonella_phage	42.4	3.3e-21
AMG36251.1|2139774_2140170_-	hypothetical protein	NA	A0A2D2W284	Stenotrophomonas_phage	36.7	5.4e-08
AMG36252.1|2140172_2140655_-	hypothetical protein	NA	A0A2H4JE38	uncultured_Caudovirales_phage	36.5	6.8e-13
AMG36253.1|2141074_2142043_-	hypothetical protein	NA	R9TJ64	Synechococcus_phage	73.2	2.0e-125
AMG36254.1|2142069_2142672_-	hypothetical protein	NA	R9TF81	Synechococcus_phage	46.5	9.4e-28
AMG36255.1|2142794_2143037_-	hypothetical protein	NA	A0A0H5AUE5	Pseudomonas_phage	54.5	1.5e-16
AMG40206.1|2143042_2144095_-	hypothetical protein	NA	A0A0H5BBX3	Pseudomonas_phage	50.6	2.7e-94
AMG36256.1|2144123_2145542_-	DUF4055 domain-containing protein	NA	R9TF43	Synechococcus_phage	41.1	6.5e-96
AMG36257.1|2145544_2146822_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	64.0	1.7e-148
AMG36258.1|2146808_2147258_-|terminase	terminase	terminase	C7U0W1	Enterobacteria_phage	63.1	3.6e-40
>prophage 4
CP014060	Achromobacter xylosoxidans strain FDAARGOS_147, complete genome	6864988	2270610	2284697	6864988	tail,integrase	Burkholderia_phage(40.0%)	18	2264704:2264720	2288557:2288573
2264704:2264720	attL	GGAAAATCCCTACGAGG	NA	NA	NA	NA
AMG36366.1|2270610_2271141_-	hypothetical protein	NA	A0A2H4JFP9	uncultured_Caudovirales_phage	58.0	8.2e-44
AMG36367.1|2271130_2271592_-	hypothetical protein	NA	A0A0U5LBV3	unidentified_phage	38.0	3.5e-14
AMG36368.1|2271777_2272800_+|integrase	site-specific integrase	integrase	A0A2H4JE37	uncultured_Caudovirales_phage	32.2	4.8e-24
AMG36369.1|2272803_2273157_-|tail	phage tail protein	tail	NA	NA	NA	NA
AUZ18053.1|2273929_2274916_-	hypothetical protein	NA	A0A0A8J8U5	Ralstonia_phage	35.2	4.8e-29
AMG36370.1|2274929_2275595_-	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	61.6	1.2e-73
AMG36371.1|2275596_2276778_-	hypothetical protein	NA	A9YX12	Burkholderia_phage	64.1	4.0e-131
AMG36372.1|2276774_2277128_-	hypothetical protein	NA	A9YX11	Burkholderia_phage	65.8	1.8e-34
AMG36373.1|2277136_2277880_-	hypothetical protein	NA	A9YX06	Burkholderia_phage	62.2	9.6e-83
AMG40216.1|2277928_2278939_-	hypothetical protein	NA	A9YX04	Burkholderia_phage	52.4	6.7e-79
AMG36374.1|2278958_2279258_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	46.0	2.8e-17
AMG36375.2|2279267_2279858_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	32.6	1.5e-17
AMG36376.1|2279859_2281533_-|tail	phage tail protein	tail	NA	NA	NA	NA
AMG36377.1|2281525_2281714_-	hypothetical protein	NA	NA	NA	NA	NA
AMG36378.1|2281710_2282160_-	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	37.1	3.8e-18
AMG36379.1|2282163_2282604_-	DUF3277 domain-containing protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	53.5	5.2e-36
AMG36380.1|2282617_2284093_-	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	47.9	1.7e-110
AMG36381.1|2284103_2284697_-	hypothetical protein	NA	A9YX29	Burkholderia_phage	48.7	1.5e-49
2288557:2288573	attR	GGAAAATCCCTACGAGG	NA	NA	NA	NA
>prophage 5
CP014060	Achromobacter xylosoxidans strain FDAARGOS_147, complete genome	6864988	4840412	4857916	6864988	tail	Burkholderia_virus(33.33%)	17	NA	NA
AMG38446.2|4840412_4841771_+	DUF1254 domain-containing protein	NA	M1H738	Paramecium_bursaria_Chlorella_virus	28.8	2.3e-42
AMG38447.2|4841853_4842555_-	phage repressor protein	NA	NA	NA	NA	NA
AMG38448.2|4842827_4843418_+	hypothetical protein	NA	NA	NA	NA	NA
AMG38449.1|4843569_4844037_+	hypothetical protein	NA	NA	NA	NA	NA
AMG38450.1|4844042_4844516_+|tail	phage tail protein	tail	A4JX08	Burkholderia_virus	44.4	6.9e-26
AMG38451.1|4844515_4844806_+	DUF4035 domain-containing protein	NA	S4TND7	Salmonella_phage	48.8	7.0e-13
AUZ18169.1|4844863_4846147_+|tail	phage tail tape measure protein	tail	K7PM62	Enterobacteria_phage	27.6	1.8e-15
AMG40338.1|4846149_4846488_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	50.0	5.8e-27
AUZ18170.1|4846493_4849136_+	hypothetical protein	NA	A0A1B1IX43	uncultured_Mediterranean_phage	42.1	7.8e-18
AMG38456.1|4849138_4849867_+|tail	phage minor tail protein L	tail	A4JX13	Burkholderia_virus	57.0	3.9e-68
AMG38457.1|4849869_4850649_+	hydrolase Nlp/P60	NA	Q3HQU3	Burkholderia_phage	48.1	6.6e-66
AMG38458.1|4850645_4851251_+|tail	tail assembly protein	tail	C7BGD3	Burkholderia_phage	57.9	6.5e-53
AMG40339.1|4851376_4854880_+	host specificity protein J	NA	A4JX16	Burkholderia_virus	45.2	9.3e-261
AMG38459.1|4855237_4855450_+	hypothetical protein	NA	NA	NA	NA	NA
AMG38460.1|4855446_4856043_+|tail	tail assembly protein	tail	Q6JIL3	Burkholderia_virus	53.3	2.1e-51
AMG38461.1|4856163_4857093_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AMG40340.2|4857097_4857916_-	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	50.7	6.4e-11
>prophage 6
CP014060	Achromobacter xylosoxidans strain FDAARGOS_147, complete genome	6864988	6713823	6790151	6864988	portal,tail,head,capsid,terminase,integrase,tRNA,protease	Burkholderia_virus(14.71%)	67	6742690:6742710	6793626:6793646
AMG39934.1|6713823_6716685_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.9	1.7e-74
AMG39935.1|6716674_6717640_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
AMG39936.1|6717703_6718369_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.2	2.8e-25
AUZ18270.1|6719382_6720777_+	rRNA methyltransferase	NA	NA	NA	NA	NA
AMG39937.1|6720799_6721195_-	hypothetical protein	NA	NA	NA	NA	NA
AMG39938.1|6721517_6722726_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
AMG39939.1|6722722_6725014_+	DNA helicase II	NA	A7KV33	Bacillus_phage	35.7	6.6e-106
AMG39940.1|6725019_6725325_+	chorismate mutase	NA	NA	NA	NA	NA
AUZ18229.1|6725442_6726702_-	cytochrome-c peroxidase	NA	NA	NA	NA	NA
AMG39941.2|6726873_6729456_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AMG39942.1|6729514_6731965_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AMG39943.2|6732090_6734661_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AMG39944.1|6735009_6735942_-	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
AMG39945.1|6735938_6736427_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
AMG39946.2|6736552_6738487_-	ABC transporter	NA	A0A2K9L0W2	Tupanvirus	32.5	1.3e-70
AMG39947.1|6738483_6739380_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AMG39948.1|6739390_6740530_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
AMG39949.1|6740530_6741352_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
AMG39950.2|6741380_6742595_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
6742690:6742710	attL	CGAGTCCCCTCCTTCGCACCA	NA	NA	NA	NA
AMG39951.1|6742850_6743834_+|integrase	site-specific integrase	integrase	A0A0A0YR56	Pseudomonas_phage	43.8	1.0e-55
AMG39952.1|6744347_6744602_-	hypothetical protein	NA	NA	NA	NA	NA
AMG39953.1|6744602_6744899_-	ASCH domain-containing protein	NA	A4PE68	Ralstonia_virus	62.9	1.1e-26
AMG39954.1|6744891_6745464_-	hypothetical protein	NA	NA	NA	NA	NA
AMG39955.1|6745460_6746390_-	hypothetical protein	NA	A0A291L9X3	Bordetella_phage	37.3	4.0e-17
AMG39956.1|6746955_6747369_+	hypothetical protein	NA	NA	NA	NA	NA
AMG39957.1|6747365_6747590_-	hypothetical protein	NA	A0A1B0VN94	Pseudomonas_phage	60.7	2.2e-14
AMG39958.2|6747589_6747931_-	hypothetical protein	NA	A0A248SL53	Klebsiella_phage	42.7	3.8e-18
AMG39959.1|6748008_6748833_-	DNA methyltransferase	NA	Q5QF26	Pseudomonas_virus	64.0	1.6e-94
AMG39960.1|6748829_6749825_-	hypothetical protein	NA	A1YZR3	Burkholderia_virus	41.4	9.3e-57
AUZ18271.1|6750994_6751687_-	hypothetical protein	NA	NA	NA	NA	NA
AMG39962.2|6753607_6753988_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ18230.1|6756293_6757532_-	ATPase	NA	NA	NA	NA	NA
AMG39964.1|6757659_6758748_-	phage repressor protein	NA	L7TH81	Pseudomonas_virus	36.6	6.7e-08
AMG39965.2|6758885_6759086_+	hypothetical protein	NA	NA	NA	NA	NA
AMG39966.1|6759270_6759663_-	hypothetical protein	NA	NA	NA	NA	NA
AMG39967.1|6759864_6760392_+	hypothetical protein	NA	B7SYH6	Stenotrophomonas_phage	35.9	3.0e-22
AMG39968.1|6760475_6760691_+	hypothetical protein	NA	NA	NA	NA	NA
AMG39969.1|6760683_6760968_+	hypothetical protein	NA	NA	NA	NA	NA
AMG39970.2|6760964_6761441_+	DUF1364 domain-containing protein	NA	Q8W6N7	Burkholderia_virus	43.2	1.4e-13
AUZ18272.1|6761437_6762379_+	hypothetical protein	NA	A0A1W6JNY0	Morganella_phage	44.6	2.4e-14
AMG39971.2|6762260_6763100_+	DNA replication protein DnaC	NA	A0A067ZJ24	Vibrio_phage	39.8	6.9e-45
AMG39972.2|6763096_6763537_+	VRR-NUC domain-containing protein	NA	A0A1J0GWD9	Alteromonas_phage	41.0	1.3e-15
AMG39973.2|6763686_6764112_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ18231.1|6764747_6766472_-	OLD family endonuclease	NA	NA	NA	NA	NA
AMG39975.1|6766916_6767702_+	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	39.3	2.5e-33
AMG39976.1|6767698_6768196_+	DNA packaging Nu1	NA	NA	NA	NA	NA
AUZ18273.1|6768273_6770268_+|terminase	terminase	terminase	R9TMM4	Vibrio_phage	37.0	2.0e-114
AMG39977.1|6770314_6770521_+	hypothetical protein	NA	A0A2H4EUL1	Aeromonas_phage	41.2	1.0e-05
AUZ18232.1|6770517_6772017_+|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	51.0	1.7e-126
AMG39978.2|6771934_6773173_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	38.7	2.4e-38
AMG39979.1|6773200_6773551_+|head	head decoration protein	head	A0A2H4JF15	uncultured_Caudovirales_phage	47.8	2.3e-18
AMG39980.1|6773632_6774637_+|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	42.8	6.3e-69
AMG39981.1|6774642_6774945_+	hypothetical protein	NA	NA	NA	NA	NA
AMG39982.1|6774941_6775364_+	hypothetical protein	NA	NA	NA	NA	NA
AMG39983.1|6775626_6776562_+	hypothetical protein	NA	G8CLB2	Synechococcus_phage	40.6	1.3e-60
AUZ18233.1|6776853_6777429_+	hypothetical protein	NA	NA	NA	NA	NA
AMG39986.1|6777462_6780435_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	32.2	7.0e-92
AMG39987.1|6780434_6780776_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	52.7	2.2e-29
AMG39988.1|6782304_6782748_+	hypothetical protein	NA	NA	NA	NA	NA
AMG39989.1|6782756_6783485_+|tail	phage minor tail protein L	tail	Q6JIL5	Burkholderia_virus	54.5	3.4e-64
AMG39990.1|6783487_6784261_+	hydrolase Nlp/P60	NA	Q3HQU3	Burkholderia_phage	49.8	6.5e-66
AMG39991.1|6784264_6784858_+|tail	tail assembly protein	tail	Q6JIL3	Burkholderia_virus	58.7	8.0e-56
AMG39992.2|6784854_6788034_+	host specificity protein J	NA	A4JX16	Burkholderia_virus	45.4	7.2e-260
AUZ18234.1|6788030_6788327_+	hypothetical protein	NA	NA	NA	NA	NA
AUZ18235.1|6788326_6789055_+	hypothetical protein	NA	A0A0B5A5A1	Achromobacter_phage	47.1	7.0e-62
AMG39993.1|6789156_6789600_+	hypothetical protein	NA	A0A0U5LBV3	unidentified_phage	42.2	5.1e-15
AMG39994.1|6789602_6790151_+	hypothetical protein	NA	A0A0H5BBZ5	Pseudomonas_phage	54.1	3.7e-31
6793626:6793646	attR	CGAGTCCCCTCCTTCGCACCA	NA	NA	NA	NA
