The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP014129	Pantoea vagans strain FDAARGOS_160 chromosome, complete genome	4050121	1086030	1094808	4050121		Streptococcus_phage(28.57%)	9	NA	NA
AMG57642.1|1086030_1087143_-	porin	NA	Q1MVN1	Enterobacteria_phage	56.2	5.6e-111
AMG57643.1|1087381_1088485_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	1.7e-59
AMG57644.1|1088495_1089749_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.1	4.3e-91
AMG57645.1|1090110_1090842_+	chromophore lyase	NA	A0A2I6PIE7	Escherichia_phage	37.5	6.4e-47
AVE16834.1|1091264_1091543_+	hypothetical protein	NA	NA	NA	NA	NA
AMG57647.1|1091747_1092215_+	lysozyme	NA	H9C148	Vibrio_phage	44.7	8.9e-26
AMG57648.1|1092211_1092559_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	45.6	5.4e-20
AMG57649.1|1092555_1092849_+	hypothetical protein	NA	NA	NA	NA	NA
AMG57650.1|1093053_1094808_+	amylovoran biosynthesis protein AmsF	NA	A0A1S6L3G8	Erwinia_phage	46.4	2.1e-152
>prophage 2
CP014129	Pantoea vagans strain FDAARGOS_160 chromosome, complete genome	4050121	1157524	1197270	4050121	terminase,coat,tail,integrase,plate,protease	uncultured_Caudovirales_phage(25.0%)	68	1157455:1157475	1204147:1204167
1157455:1157475	attL	CATCGGACTGTTTCTCCGATG	NA	NA	NA	NA
AMG57705.1|1157524_1158568_-|integrase	site-specific integrase	integrase	K7PKD7	Enterobacteria_phage	35.5	4.4e-57
AMG57706.2|1158880_1159201_-	hypothetical protein	NA	B0ZSH8	Halomonas_phage	51.8	9.7e-24
AMG57707.1|1159257_1159632_-	hypothetical protein	NA	A0A173GC52	Salmonella_phage	38.3	3.9e-08
AMG57708.1|1159628_1159847_-	hypothetical protein	NA	A0A2H4IYB3	uncultured_Caudovirales_phage	87.1	7.3e-31
AMG57709.2|1159904_1160399_-	hypothetical protein	NA	NA	NA	NA	NA
AMG57710.1|1160395_1160638_-	DNA polymerase III subunit theta	NA	A0A2H4J4A9	uncultured_Caudovirales_phage	88.8	2.8e-31
AMG57711.1|1160668_1160980_-	hypothetical protein	NA	A0A0S3UG40	Pseudomonas_phage	39.1	1.5e-05
AMG57712.1|1161062_1161437_-	hypothetical protein	NA	NA	NA	NA	NA
AMG57713.1|1161433_1161952_-	hypothetical protein	NA	A0A291L9X9	Bordetella_phage	46.5	5.3e-11
AMG57714.1|1161948_1162671_-	hypothetical protein	NA	A0A2I2L6M3	Escherichia_phage	58.6	5.6e-11
AMG57715.1|1162720_1163029_-	hypothetical protein	NA	A0A2H4JCD0	uncultured_Caudovirales_phage	87.3	4.9e-41
AMG57716.1|1163056_1163533_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	82.7	7.1e-55
AMG57717.1|1163533_1164148_-	single-stranded DNA-binding protein	NA	A0A1W6JP21	Morganella_phage	66.0	4.7e-67
AMG57718.1|1164282_1164480_-	protein kil	NA	A0A075B8F9	Enterobacteria_phage	69.2	3.1e-20
AVE16836.1|1164476_1164620_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	NA	NA	NA	NA
AMG57719.1|1164967_1165231_-	hypothetical protein	NA	NA	NA	NA	NA
AMG57720.1|1165344_1165836_-	hypothetical protein	NA	A0A2H4J4Q4	uncultured_Caudovirales_phage	52.5	1.9e-39
AMG57721.1|1166051_1166291_-	hypothetical protein	NA	A0A2H4J657	uncultured_Caudovirales_phage	46.0	6.6e-09
AMG57722.1|1166738_1167428_-	helix-turn-helix transcriptional regulator	NA	F1C5C2	Cronobacter_phage	90.0	1.2e-111
AMG57723.1|1167526_1167754_+	XRE family transcriptional regulator	NA	S5FKP1	Shigella_phage	50.0	3.0e-11
AMG57724.1|1167870_1168140_+	hypothetical protein	NA	I6RSP4	Salmonella_phage	64.0	4.6e-19
AMG57725.1|1168175_1168877_+	hypothetical protein	NA	NA	NA	NA	NA
AMG57726.1|1168876_1169755_+	hypothetical protein	NA	G8C7U5	Escherichia_phage	68.1	1.2e-100
AMG57727.1|1169757_1170609_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	62.7	6.2e-94
AMG57728.1|1170605_1170830_+	hypothetical protein	NA	A0A2H4J1E7	uncultured_Caudovirales_phage	81.4	5.4e-21
AMG57729.1|1170829_1171093_+	DUF3850 domain-containing protein	NA	R9TML3	Aeromonas_phage	66.7	1.5e-22
AMG57730.1|1171073_1171430_+	hypothetical protein	NA	NA	NA	NA	NA
AMG60230.1|1171440_1171728_+	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	64.0	1.7e-27
AMG57731.1|1171724_1171922_+	hypothetical protein	NA	A0A2H4J4C7	uncultured_Caudovirales_phage	42.9	3.2e-09
AMG57732.1|1171893_1172328_+	recombination protein NinB	NA	A0A2H4J8D9	uncultured_Caudovirales_phage	92.9	7.1e-70
AMG57733.1|1172324_1172615_+	hypothetical protein	NA	A0A2H4JI39	uncultured_Caudovirales_phage	36.8	5.5e-10
AMG57734.1|1172607_1172808_+	hypothetical protein	NA	A0A2H4JE12	uncultured_Caudovirales_phage	90.6	3.4e-27
AMG57735.2|1172804_1173014_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	49.3	4.2e-12
AVE16837.1|1173103_1173289_+	hypothetical protein	NA	A0A2H4J175	uncultured_Caudovirales_phage	67.8	9.9e-13
AMG57736.1|1173281_1173863_+	protein NinG	NA	A0A2R2Z332	Escherichia_phage	44.4	2.9e-34
AMG57737.1|1173859_1174057_+	hypothetical protein	NA	M9NZE6	Enterobacteria_phage	75.4	6.6e-23
AMG57738.1|1174168_1174990_+	antitermination protein	NA	E5AGG3	Erwinia_phage	63.2	6.7e-93
AMG57739.1|1175269_1175683_-	hypothetical protein	NA	A0A0D4DCG1	Acinetobacter_phage	39.0	1.9e-19
AMG57740.1|1175728_1175911_-	addiction module toxin, HicA family	NA	NA	NA	NA	NA
AMG57741.1|1176208_1176628_+	hypothetical protein	NA	NA	NA	NA	NA
AMG57742.1|1176624_1176861_+	hypothetical protein	NA	NA	NA	NA	NA
AMG57743.1|1176857_1177325_+	lysozyme	NA	H9C148	Vibrio_phage	41.1	2.0e-25
AMG57744.1|1177321_1177666_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	45.0	1.8e-20
AMG57745.1|1177662_1177959_+	hypothetical protein	NA	NA	NA	NA	NA
AMG57746.1|1178106_1178376_+	hypothetical protein	NA	NA	NA	NA	NA
AMG57747.1|1178653_1179181_+	hypothetical protein	NA	A0A1V0E5P7	Salmonella_phage	62.5	2.0e-50
AMG57748.1|1179272_1179707_-	hypothetical protein	NA	NA	NA	NA	NA
AMG57749.1|1179729_1180299_+|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	75.1	2.5e-75
AMG57750.1|1180285_1181758_+	DNA-packaging protein	NA	G0ZND4	Cronobacter_phage	84.6	1.8e-245
AMG60231.1|1181830_1183168_+	DUF4055 domain-containing protein	NA	A0A0S2SYJ5	Pseudomonas_phage	40.4	2.2e-85
AMG57751.1|1183288_1184041_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	49.2	8.0e-61
AMG57752.1|1184055_1185180_+|coat	P22 coat - protein 5 family protein	coat	W6EBZ8	Rhizobium_phage	53.0	5.4e-93
AMG57753.1|1185225_1185471_+	hypothetical protein	NA	NA	NA	NA	NA
AMG57754.1|1185470_1185863_+	hypothetical protein	NA	NA	NA	NA	NA
AMG57755.1|1185864_1186509_+	hypothetical protein	NA	NA	NA	NA	NA
AMG57756.1|1186510_1187332_+	hypothetical protein	NA	NA	NA	NA	NA
AMG57757.1|1187335_1187557_+	hypothetical protein	NA	NA	NA	NA	NA
AMG60232.1|1187615_1189172_+|tail	phage tail protein	tail	B3GAJ6	uncultured_virus	44.4	6.1e-95
AMG57758.1|1189218_1189650_+	hypothetical protein	NA	NA	NA	NA	NA
AMG57759.1|1189659_1190031_+	hypothetical protein	NA	NA	NA	NA	NA
AMG57760.1|1190212_1190650_+	hypothetical protein	NA	NA	NA	NA	NA
AMG60233.1|1190697_1191126_-	hypothetical protein	NA	J7HXA3	Pseudomonas_phage	33.3	6.9e-09
AMG57761.1|1191363_1191654_+	hypothetical protein	NA	NA	NA	NA	NA
AMG57762.1|1191718_1194181_+	hypothetical protein	NA	K4NZX3	Burkholderia_phage	29.8	5.5e-42
AMG57763.1|1194191_1195181_+	hypothetical protein	NA	NA	NA	NA	NA
AMG57764.1|1195183_1196299_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
AMG57765.1|1196295_1196895_+|plate	baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	32.9	2.2e-08
AMG57766.1|1196904_1197270_+|tail	phage tail protein	tail	NA	NA	NA	NA
1204147:1204167	attR	CATCGGACTGTTTCTCCGATG	NA	NA	NA	NA
>prophage 3
CP014129	Pantoea vagans strain FDAARGOS_160 chromosome, complete genome	4050121	1996305	2010155	4050121	tRNA	Tupanvirus(11.11%)	14	NA	NA
AMG58466.1|1996305_1998234_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.8	1.4e-125
AMG58467.1|1998237_1998789_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	1.7e-15
AMG58468.1|1998888_1999086_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
AMG58469.1|1999130_1999487_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
AMG58470.1|1999801_2000785_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	37.6	2.9e-34
AMG58471.1|2000799_2003187_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	32.0	1.2e-09
AMG58472.1|2003191_2003494_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.3e-13
AMG58473.1|2003673_2004657_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
AMG58474.1|2004707_2005253_+	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	37.4	7.7e-13
AMG58475.1|2005253_2006003_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	W5SAS9	Pithovirus	26.9	8.7e-07
AMG58476.1|2006071_2006530_+	endopeptidase	NA	A0A217EQL1	Bacillus_phage	37.5	5.5e-12
AMG58477.1|2006824_2007571_+	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AMG58478.1|2007650_2009102_+	YdiU family protein	NA	NA	NA	NA	NA
AMG58479.1|2009108_2010155_-	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	49.7	5.5e-84
>prophage 4
CP014129	Pantoea vagans strain FDAARGOS_160 chromosome, complete genome	4050121	2454976	2508411	4050121	holin,tail,integrase,tRNA,plate,protease	Erwinia_phage(26.67%)	49	2486584:2486614	2516511:2516541
AMG58853.1|2454976_2455675_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AMG58854.1|2455719_2457636_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.2	6.3e-86
AMG58855.1|2457885_2458623_-	carbonic anhydrase	NA	NA	NA	NA	NA
AMG58856.1|2459772_2460132_+	hypothetical protein	NA	NA	NA	NA	NA
AMG58857.1|2460199_2460544_+	RidA family protein	NA	NA	NA	NA	NA
AMG58858.1|2460556_2460751_-	YoaH family protein	NA	NA	NA	NA	NA
AMG58859.1|2460861_2462241_+	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	32.7	4.9e-40
AMG58860.1|2462224_2462788_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
AMG58861.1|2462973_2464338_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AMG58862.1|2464562_2466125_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AMG58863.1|2466261_2467860_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.4	8.3e-39
AMG58864.1|2468369_2469332_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
AMG60300.1|2469395_2470196_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
AMG58865.1|2470211_2471057_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
AMG58866.1|2471148_2471607_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
AMG58867.1|2471603_2472413_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
AMG58868.1|2472550_2472760_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	76.6	5.9e-22
AMG58869.1|2473412_2474417_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AMG58870.1|2474435_2474708_-	hypothetical protein	NA	NA	NA	NA	NA
AMG58871.1|2474920_2475157_+	hypothetical protein	NA	NA	NA	NA	NA
AMG58872.1|2475187_2475979_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
AMG58873.1|2476165_2477530_+	MFS transporter	NA	NA	NA	NA	NA
AMG58874.1|2477879_2478761_-|protease	protease HtpX	protease	NA	NA	NA	NA
AMG58875.1|2479005_2481045_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.7	7.2e-88
AMG58876.1|2481064_2481769_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
AMG58877.1|2481865_2482366_-	GAF domain-containing protein	NA	NA	NA	NA	NA
AMG58878.1|2482580_2483825_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
AMG58879.1|2483793_2486427_+	MCE family protein	NA	NA	NA	NA	NA
2486584:2486614	attL	GCGCAGGGAACACGGGCAGAGGAGGAAAGCG	NA	NA	NA	NA
AMG58880.1|2486808_2488242_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
AMG58881.1|2488243_2488891_-	serine/threonine-protein phosphatase	NA	K7P6H8	Enterobacteria_phage	48.1	3.9e-56
AMG58882.1|2489159_2489372_-	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
AMG58883.1|2489518_2490868_-	MFS transporter	NA	NA	NA	NA	NA
AMG58884.1|2491003_2493034_-|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	26.2	4.4e-21
AMG58885.1|2493289_2493883_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
AMG58886.1|2493897_2495370_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AMG58887.1|2495393_2497076_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.7	4.2e-57
AMG58888.1|2497504_2497855_+	multidrug/spermidine transporter subunit MdtJ	NA	NA	NA	NA	NA
AMG58889.1|2497841_2498171_+	multidrug/spermidine transporter subunit MdtI	NA	NA	NA	NA	NA
AMG58890.1|2498371_2499514_+	acyltransferase	NA	Q6QI96	Burkholderia_phage	31.2	6.1e-36
AMG58891.1|2499677_2499938_+	hypothetical protein	NA	NA	NA	NA	NA
AMG58892.1|2500054_2500240_+	hypothetical protein	NA	NA	NA	NA	NA
AMG58893.1|2500689_2501712_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.9	5.7e-25
AVE16868.1|2502618_2503119_+|plate	baseplate J-like family protein	plate	F1BUP3	Erwinia_phage	82.5	1.7e-67
AMG58894.1|2503111_2503720_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	81.7	5.3e-95
AMG58895.1|2503716_2504760_+|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	65.1	3.3e-121
AMG58896.1|2505404_2505845_-	hypothetical protein	NA	NA	NA	NA	NA
AMG58897.1|2505862_2506396_-	hypothetical protein	NA	NA	NA	NA	NA
AVE16869.1|2507025_2507241_+	transcriptional regulator	NA	F1BUT0	Erwinia_phage	77.8	7.4e-28
AMG58899.1|2507346_2508411_+|integrase	integrase	integrase	A0A0M4S6G4	Salmonella_phage	56.0	8.0e-115
2516511:2516541	attR	GCGCAGGGAACACGGGCAGAGGAGGAAAGCG	NA	NA	NA	NA
>prophage 5
CP014129	Pantoea vagans strain FDAARGOS_160 chromosome, complete genome	4050121	3269979	3281395	4050121		Enterobacteria_phage(50.0%)	13	NA	NA
AMG59503.1|3269979_3271176_+	DUF4102 domain-containing protein	NA	A0A1V0E8G8	Vibrio_phage	45.5	2.1e-103
AMG60333.2|3271192_3272059_+	HAD family hydrolase	NA	NA	NA	NA	NA
AMG59504.1|3272055_3272664_+	hypothetical protein	NA	NA	NA	NA	NA
AMG59505.1|3272732_3274655_-	ATP-binding protein	NA	A0A2H4J2R8	uncultured_Caudovirales_phage	38.8	8.2e-126
AMG59506.1|3275014_3275266_-	transcriptional regulator	NA	F1BUT0	Erwinia_phage	63.8	1.3e-15
AMG59507.1|3275262_3275979_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	26.4	1.7e-12
AMG59508.1|3276500_3276758_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	57.0	6.4e-18
AMG59509.1|3276754_3277003_+	hypothetical protein	NA	NA	NA	NA	NA
AVE16880.1|3277016_3277544_+	Ash-like/host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	67.0	4.4e-29
AMG59511.1|3277540_3277807_+	hypothetical protein	NA	NA	NA	NA	NA
AMG59512.1|3277793_3278135_+	hypothetical protein	NA	NA	NA	NA	NA
AVE16910.1|3278149_3280465_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	60.4	4.4e-259
AMG59513.1|3280618_3281395_-	thymidylate synthase (FAD)	NA	A0A166Y9A6	Gordonia_phage	39.0	1.3e-29
>prophage 6
CP014129	Pantoea vagans strain FDAARGOS_160 chromosome, complete genome	4050121	3650735	3691394	4050121	tail,head,capsid,portal,integrase,tRNA,plate	Salmonella_phage(69.05%)	53	3658779:3658830	3693574:3693625
AMG59810.1|3650735_3651749_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.3	1.7e-106
AMG59811.1|3652026_3652242_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AMG59812.1|3652360_3654106_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.6	1.4e-71
AVE16911.1|3654320_3654419_-	DNA metabolism protein	NA	NA	NA	NA	NA
AMG59813.1|3654602_3656444_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
AMG59814.1|3656518_3657037_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
AMG59815.1|3657033_3657618_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
3658779:3658830	attL	GACTCATAATCGCTTGGTCGCTGGTTCAAACCCAGCAGGGGCCACCAAATTT	NA	NA	NA	NA
AVE16887.1|3659346_3659565_-	transcriptional regulator	NA	E5G6Q4	Salmonella_phage	69.1	3.1e-21
AMG59816.1|3659631_3660732_-	late control protein D	NA	E5G6Q3	Salmonella_phage	72.9	3.9e-149
AMG59817.1|3660728_3661214_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	82.7	2.7e-57
AMG59818.1|3661210_3664246_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	41.4	2.1e-128
AVE16888.1|3664238_3664373_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	60.5	5.3e-08
AMG59819.1|3664375_3664684_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	68.6	2.7e-31
AMG59820.1|3664740_3665256_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	86.0	3.7e-81
AMG59821.1|3665268_3666438_-|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	88.7	6.4e-198
AMG59822.1|3666556_3667156_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	43.9	5.5e-36
AMG59823.1|3667155_3668412_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	50.2	1.0e-121
AMG59824.1|3668408_3669020_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	74.5	6.3e-88
AMG59825.1|3669016_3669931_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	65.2	5.7e-101
AMG59826.1|3669917_3670274_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	63.2	5.0e-37
AMG60356.1|3670270_3670849_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	69.1	1.9e-70
AMG59827.1|3671114_3671651_+	hypothetical protein	NA	NA	NA	NA	NA
AMG59828.1|3671638_3672094_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	61.6	7.8e-43
AMG59829.1|3672086_3672518_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	75.7	1.2e-56
AVE16889.1|3672480_3672684_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	73.1	3.4e-22
AMG59830.1|3672613_3673042_-	hypothetical protein	NA	A0A1S6KZX8	Salmonella_phage	56.8	1.1e-33
AMG59831.2|3673038_3673446_-	hypothetical protein	NA	NA	NA	NA	NA
AMG59832.1|3673414_3673924_-	lysozyme	NA	E5G6N1	Salmonella_phage	76.2	1.2e-71
AMG59833.1|3673904_3674117_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	63.2	1.4e-18
AMG59834.1|3674120_3674324_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	83.6	1.4e-28
AMG59835.1|3674323_3674788_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	69.5	2.1e-59
AMG59836.1|3674887_3675532_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	72.2	6.0e-81
AMG59837.1|3675535_3676753_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	70.7	1.0e-137
AMG59838.1|3676797_3677655_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	58.6	9.4e-82
AMG59839.1|3677797_3679564_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	85.2	8.2e-306
AMG59840.1|3679563_3680607_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	78.9	4.3e-161
AMG59841.1|3680662_3681358_-	hypothetical protein	NA	NA	NA	NA	NA
AMG59842.1|3681377_3682442_-	hypothetical protein	NA	NA	NA	NA	NA
AMG59843.1|3682438_3683503_-	hypothetical protein	NA	NA	NA	NA	NA
AVE16890.1|3683481_3683730_-	hypothetical protein	NA	NA	NA	NA	NA
AMG59844.1|3683761_3684028_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	46.6	7.6e-14
AMG59845.1|3684101_3684341_-	DNA-damage-inducible protein DinI	NA	A0A1S6L014	Salmonella_phage	65.3	4.0e-22
AMG59846.1|3684353_3684542_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	83.3	3.4e-21
AMG59847.2|3684711_3687081_-	endonuclease	NA	A0A1S6L028	Salmonella_phage	80.6	0.0e+00
AMG59848.1|3687080_3687881_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	63.5	2.6e-89
AMG59849.1|3687877_3688105_-	hypothetical protein	NA	F1BUS2	Erwinia_phage	61.1	9.6e-18
AMG59850.1|3688104_3688332_-	DUF2732 domain-containing protein	NA	F1BUS3	Erwinia_phage	53.3	1.6e-12
AMG59851.1|3688401_3688740_-	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	58.9	1.6e-29
AVE16891.1|3688703_3688892_-	DUF2724 domain-containing protein	NA	F1BUS5	Erwinia_phage	57.9	4.7e-10
AMG59852.1|3688895_3689405_-	hypothetical protein	NA	F1BUS6	Erwinia_phage	70.8	1.2e-60
AMG59853.1|3689439_3689676_-	regulator	NA	NA	NA	NA	NA
AMG59854.1|3689765_3690371_+	phage repressor protein	NA	F1BUN8	Cronobacter_phage	38.2	2.2e-29
AMG59855.1|3690380_3691394_+|integrase	integrase	integrase	F1BUS9	Erwinia_phage	62.3	8.2e-117
3693574:3693625	attR	GACTCATAATCGCTTGGTCGCTGGTTCAAACCCAGCAGGGGCCACCAAATTT	NA	NA	NA	NA
>prophage 1
CP014126	Pantoea vagans strain FDAARGOS_160 plasmid unnamed1, complete sequence	90511	16364	23305	90511		Morganella_phage(42.86%)	10	NA	NA
AMG56146.1|16364_16601_-	impB/mucB/samB family protein	NA	F1C5A5	Cronobacter_phage	67.1	2.9e-25
AMG56218.2|16603_17053_-	SamA	NA	A0A1W6JNS2	Morganella_phage	50.8	8.5e-26
AMG56147.1|17508_18189_-	DUF159 family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	79.9	5.5e-109
AMG56148.1|18326_18707_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	38.2	3.1e-13
AMG56149.1|18706_19969_+	translesion error-prone DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	56.7	7.0e-134
AMG56150.1|20043_20832_-	hypothetical protein	NA	NA	NA	NA	NA
AVE16790.1|21060_21324_-	hypothetical protein	NA	NA	NA	NA	NA
AMG56151.1|21443_22088_+	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	40.3	1.4e-32
AMG56152.1|22123_22354_+	hypothetical protein	NA	NA	NA	NA	NA
AMG56153.1|22804_23305_+	antirestriction protein	NA	A0A1I9S7Y0	Rhodococcus_phage	33.3	2.4e-13
