The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP014113	Staphylococcus saprophyticus strain FDAARGOS_168 chromosome, complete genome	2583619	7936	26666	2583619		uncultured_Caudovirales_phage(33.33%)	14	NA	NA
AMG18715.1|7936_8905_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	78.3	2.6e-136
AMG18716.1|9318_10287_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	94.4	2.2e-175
AMG18717.1|10410_12516_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	90.0	0.0e+00
AMG18718.1|12478_12877_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	76.5	8.6e-54
AMG18719.1|13603_14491_+	EamA/RhaT family transporter	NA	NA	NA	NA	NA
AMG18720.1|14504_15005_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	72.3	2.0e-52
AMG18721.1|15186_16701_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	35.8	5.6e-69
AMG18722.1|17068_18574_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.0	2.4e-64
AMG18723.2|19043_19991_+	lipid kinase	NA	A0A1V0SBJ0	Catovirus	23.6	3.9e-12
AMG18724.1|20161_20710_-	5'(3')-deoxyribonucleotidase	NA	A0A0A0PKY7	Bacillus_phage	39.0	2.0e-29
AMG18725.1|20887_21943_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	27.2	2.3e-21
AMG18726.1|22101_23619_-	glycine/betaine ABC transporter permease	NA	NA	NA	NA	NA
AMG18727.1|23615_24578_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.5	4.8e-26
AMG18728.1|24887_26666_-	DNA helicase RecQ	NA	K7YHB4	Megavirus	36.4	2.2e-77
>prophage 2
CP014113	Staphylococcus saprophyticus strain FDAARGOS_168 chromosome, complete genome	2583619	34969	42519	2583619		Pandoravirus(16.67%)	9	NA	NA
AMG18735.1|34969_36112_-	aminodeoxychorismate synthase, component I	NA	S4VNU7	Pandoravirus	36.7	5.4e-24
AMG18736.1|36095_36689_-	type 1 glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	41.5	1.9e-36
AMG18737.1|36944_37616_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	54.9	1.2e-63
AMG18738.1|37617_38043_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
AMG18739.1|38035_38752_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.4	2.5e-51
AMG18740.1|38992_39586_+	hypothetical protein	NA	NA	NA	NA	NA
AMG18741.1|39654_39906_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AMG18742.1|40123_41185_-	glycosyltransferase	NA	A0A192Y8W7	Salmonella_phage	42.3	8.7e-61
AMG18743.1|41679_42519_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.2	1.2e-52
>prophage 3
CP014113	Staphylococcus saprophyticus strain FDAARGOS_168 chromosome, complete genome	2583619	366200	378120	2583619	integrase,terminase	Staphylococcus_phage(50.0%)	15	362442:362456	382280:382294
362442:362456	attL	AACTATTTGTTTGTT	NA	NA	NA	NA
AMG19032.2|366200_366686_-|terminase	terminase small subunit	terminase	A0A1S5S7Z2	Streptococcus_phage	45.8	1.3e-19
AMG19033.1|366703_367267_-	hypothetical protein	NA	NA	NA	NA	NA
AMG19034.1|367280_367517_-	hypothetical protein	NA	NA	NA	NA	NA
AMG19035.1|367513_367936_-	hypothetical protein	NA	NA	NA	NA	NA
AMG19036.1|368103_368583_-	HNH endonuclease	NA	NA	NA	NA	NA
AMG19037.1|368645_368849_-	hypothetical protein	NA	NA	NA	NA	NA
AMG19038.1|368993_369233_-	hypothetical protein	NA	NA	NA	NA	NA
AMG19039.1|369585_370956_-	virulence-associated protein E	NA	A0A1W6JQD6	Staphylococcus_phage	41.9	5.9e-102
AMG19040.2|370969_371830_-	hypothetical protein	NA	Q4ZE74	Staphylococcus_phage	36.2	2.1e-44
AMG19041.1|372116_372389_-	pathogenicity island protein	NA	Q4ZE77	Staphylococcus_phage	41.8	2.3e-10
AVC42112.1|372729_373275_+	XRE family transcriptional regulator	NA	A0A0E3U244	Fusobacterium_phage	51.7	2.2e-07
AMG19043.1|373277_374480_+|integrase	site-specific integrase	integrase	Q4ZE80	Staphylococcus_phage	45.8	1.5e-93
AMG19044.1|374480_374996_+	hypothetical protein	NA	NA	NA	NA	NA
AMG21033.1|375089_376631_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.6	1.8e-22
AMG19045.1|376653_378120_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.9	7.2e-98
382280:382294	attR	AACAAACAAATAGTT	NA	NA	NA	NA
>prophage 4
CP014113	Staphylococcus saprophyticus strain FDAARGOS_168 chromosome, complete genome	2583619	1516235	1576030	2583619	head,tail,integrase,protease,portal,capsid,holin,terminase	uncultured_Caudovirales_phage(59.46%)	84	1508387:1508402	1518451:1518466
1508387:1508402	attL	TTAGAAGATGAATTAA	NA	NA	NA	NA
AMG20029.2|1516235_1517276_-|integrase	site-specific integrase	integrase	U3PJ31	Staphylococcus_phage	97.4	7.9e-192
AMG20030.1|1517327_1517819_-	hypothetical protein	NA	A0A2H4J5W8	uncultured_Caudovirales_phage	85.3	3.4e-28
AMG20031.1|1517907_1518372_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1W6JQ23	Staphylococcus_phage	79.3	6.7e-66
AMG20032.1|1518385_1518721_-	XRE family transcriptional regulator	NA	A0A1W6JP51	Staphylococcus_phage	64.9	6.8e-28
1518451:1518466	attR	TTAATTCATCTTCTAA	NA	NA	NA	NA
AMG20033.1|1518884_1519115_+	XRE family transcriptional regulator	NA	Q4ZD52	Staphylococcus_phage	59.2	5.2e-19
AMG20034.1|1519133_1520063_+	DUF3102 domain-containing protein	NA	A0A2H4JAH5	uncultured_Caudovirales_phage	68.4	1.6e-66
AMG20035.1|1520055_1520613_+	hypothetical protein	NA	A0A2H4J1Z3	uncultured_Caudovirales_phage	78.5	1.7e-71
AMG20036.1|1520738_1520957_-	hypothetical protein	NA	A0A2H4JAT7	uncultured_Caudovirales_phage	100.0	4.6e-33
AMG21059.2|1521019_1521304_+	DUF771 domain-containing protein	NA	U3PBP3	Staphylococcus_phage	88.3	4.4e-44
AMG20037.1|1521550_1521835_+	hypothetical protein	NA	A0A2H4J7G4	uncultured_Caudovirales_phage	88.3	4.1e-42
AMG20038.1|1521800_1522025_+	hypothetical protein	NA	A1BTZ2	Staphylococcus_virus	67.6	2.2e-22
AMG20039.1|1522017_1522635_+	DUF1071 domain-containing protein	NA	A0A2H4JEC9	uncultured_Caudovirales_phage	97.6	1.2e-110
AMG20040.1|1522637_1523060_+	single-stranded DNA-binding protein	NA	A0A2H4JGW9	uncultured_Caudovirales_phage	94.4	2.7e-58
AMG20041.1|1523073_1523745_+	hypothetical protein	NA	A0A2H4J972	uncultured_Caudovirales_phage	95.0	3.3e-122
AMG20042.1|1523741_1524494_+	DnaD domain protein	NA	A0A2H4JAA4	uncultured_Caudovirales_phage	98.0	4.9e-135
AMG20043.1|1524497_1524860_+	hypothetical protein	NA	A0A2H4J7Z2	uncultured_Caudovirales_phage	98.3	1.1e-63
AMG20044.2|1524852_1526088_+	damage-inducible protein	NA	A0A2H4JB46	uncultured_Caudovirales_phage	99.3	4.8e-228
AMG20045.1|1526084_1526297_+	hypothetical protein	NA	A0A2H4JDU0	uncultured_Caudovirales_phage	94.0	9.2e-31
AMG20046.1|1526283_1526520_+	hypothetical protein	NA	A0A2H4J2U2	uncultured_Caudovirales_phage	98.7	3.0e-38
AMG20047.1|1526530_1526932_+	DUF1064 domain-containing protein	NA	A0A2H4JB09	uncultured_Caudovirales_phage	91.7	9.8e-66
AMG20048.1|1526937_1527141_+	hypothetical protein	NA	A0A2H4JED5	uncultured_Caudovirales_phage	98.5	1.8e-28
AMG20049.1|1527153_1527609_+	hypothetical protein	NA	NA	NA	NA	NA
AMG20050.1|1527796_1528027_+	hypothetical protein	NA	NA	NA	NA	NA
AMG20051.1|1528028_1528715_+	methylase	NA	B7T0H3	Staphylococcus_virus	71.1	9.8e-90
AMG20052.1|1528711_1528921_+	hypothetical protein	NA	A0A2H4JAZ1	uncultured_Caudovirales_phage	92.2	6.7e-26
AMG20055.1|1529732_1529918_+	hypothetical protein	NA	A0A2R3ZXL0	Staphylococcus_phage	78.7	4.3e-24
AMG20056.1|1529923_1530133_+	hypothetical protein	NA	A0A2H4J6Y0	uncultured_Caudovirales_phage	53.6	1.5e-09
AMG20057.1|1530147_1530423_+	hypothetical protein	NA	NA	NA	NA	NA
AMG20058.1|1530437_1530842_+	hypothetical protein	NA	A0A2H4J5L2	uncultured_Caudovirales_phage	90.8	1.0e-38
AMG20059.1|1530986_1531229_+	hypothetical protein	NA	A0A2H4JB57	uncultured_Caudovirales_phage	79.5	4.9e-12
AMG20060.1|1531221_1531533_+	hypothetical protein	NA	A0A2H4JDU9	uncultured_Caudovirales_phage	94.2	6.5e-49
AMG20061.1|1531572_1531815_+	hypothetical protein	NA	A0A1X9SI82	Staphylococcus_phage	57.1	1.5e-16
AMG20062.1|1531814_1532036_+	DUF1381 domain-containing protein	NA	U3PD04	Staphylococcus_phage	86.0	4.1e-13
AMG20063.1|1532038_1532413_+	hypothetical protein	NA	NA	NA	NA	NA
AVC42134.1|1532409_1532541_+	transcriptional regulator	NA	U3PG58	Staphylococcus_phage	90.5	7.7e-12
AMG20064.1|1532542_1532848_+	hypothetical protein	NA	A0A2H4J998	uncultured_Caudovirales_phage	99.0	2.3e-54
AVC42135.1|1532847_1533015_+	DUF1514 domain-containing protein	NA	U3PJ58	Staphylococcus_phage	98.2	4.0e-21
AMG20065.1|1533029_1533257_+	hypothetical protein	NA	U3PE10	Staphylococcus_phage	100.0	1.0e-35
AMG20066.1|1533273_1533582_+	hypothetical protein	NA	NA	NA	NA	NA
AMG20067.1|1533595_1534039_+	transcriptional regulator	NA	A0A2H4JB67	uncultured_Caudovirales_phage	98.0	6.6e-79
AMG20068.1|1534680_1535031_+	HNH endonuclease	NA	H9A108	Staphylococcus_phage	84.2	5.4e-52
AMG20069.1|1535205_1535691_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4J5U2	uncultured_Caudovirales_phage	92.5	4.2e-79
AMG20070.1|1535683_1537435_+|terminase	terminase large subunit	terminase	A0A2H4J5G3	uncultured_Caudovirales_phage	98.5	0.0e+00
AMG20071.1|1537446_1537641_+	hypothetical protein	NA	A0A2H4J9T6	uncultured_Caudovirales_phage	95.3	1.7e-23
AMG20072.1|1537643_1538873_+|portal	phage portal protein	portal	A0A2H4JB06	uncultured_Caudovirales_phage	95.8	2.9e-225
AMG20073.1|1538865_1539429_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JDQ0	uncultured_Caudovirales_phage	84.5	2.3e-89
AMG20074.1|1539469_1540810_+|capsid	phage major capsid protein	capsid	A0A2H4JGA1	uncultured_Caudovirales_phage	91.5	8.7e-175
AMG20075.1|1540828_1541167_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1D6Z297	Staphylococcus_phage	97.3	1.2e-56
AMG20076.1|1541156_1541486_+	hypothetical protein	NA	A0A2H4JGE5	uncultured_Caudovirales_phage	97.2	6.8e-57
AMG20077.1|1541482_1541887_+	hypothetical protein	NA	A0A2H4JF04	uncultured_Caudovirales_phage	98.5	1.5e-69
AMG20078.1|1541891_1542296_+	hypothetical protein	NA	A0A2H4J943	uncultured_Caudovirales_phage	98.5	3.5e-71
AMG20079.1|1542308_1542932_+|tail	phage tail protein	tail	A0A2H4JC63	uncultured_Caudovirales_phage	100.0	7.5e-113
AMG20080.1|1542950_1543136_+	hypothetical protein	NA	A0A2H4JAG2	uncultured_Caudovirales_phage	100.0	3.2e-27
AMG20081.1|1543205_1543568_+	hypothetical protein	NA	A0A2H4JHD2	uncultured_Caudovirales_phage	99.2	1.9e-60
AMG20082.1|1543781_1548404_+|tail	phage tail tape measure protein	tail	A0A2H4JDT7	uncultured_Caudovirales_phage	92.5	0.0e+00
AMG20083.2|1548405_1549233_+|tail	phage tail family protein	tail	A0A2H4JAE4	uncultured_Caudovirales_phage	99.3	4.9e-160
AMG20084.1|1549242_1550832_+	peptidase	NA	A0A2H4JAF8	uncultured_Caudovirales_phage	92.8	5.1e-291
AMG20085.1|1550824_1551412_+	hypothetical protein	NA	A0A1W6JQ70	Staphylococcus_phage	71.8	5.5e-81
AMG20086.1|1551428_1554047_+	peptidase G2	NA	A0A2H4JF10	uncultured_Caudovirales_phage	95.3	0.0e+00
AMG20087.1|1554061_1555573_+	DUF2479 domain-containing protein	NA	A0A2H4J5W4	uncultured_Caudovirales_phage	97.0	4.5e-228
AMG20088.1|1555585_1555924_+	hypothetical protein	NA	A0A2H4J2S0	uncultured_Caudovirales_phage	92.0	2.8e-37
AVC42136.1|1555925_1556078_+	XkdX family protein	NA	A0A2H4JAH1	uncultured_Caudovirales_phage	98.0	1.1e-22
AMG20089.1|1556538_1556934_+	hypothetical protein	NA	A0A2H4JB27	uncultured_Caudovirales_phage	100.0	4.5e-63
AMG20090.1|1556979_1557690_+	DUF2479 domain-containing protein	NA	A0A1D6Z279	Staphylococcus_phage	53.0	6.3e-39
AMG20091.1|1557693_1558491_+	hypothetical protein	NA	NA	NA	NA	NA
AMG20092.1|1558492_1558711_+	hypothetical protein	NA	NA	NA	NA	NA
AMG20093.1|1558761_1559049_+|holin	phage holin	holin	A0A2H4JAT1	uncultured_Caudovirales_phage	96.8	5.2e-45
AMG20094.1|1559059_1560448_+	CHAP domain-containing protein	NA	A0A2H4JBD0	uncultured_Caudovirales_phage	90.3	2.4e-252
AMG20095.1|1561803_1563186_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	61.3	5.3e-167
AMG20096.1|1563205_1564210_+	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	49.4	2.9e-90
AMG20097.1|1564199_1564451_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	81.1	4.2e-30
AMG20098.1|1564510_1564987_+	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	53.5	4.8e-43
AMG21060.1|1564994_1565762_+	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	71.4	3.1e-100
AMG20099.1|1565857_1567447_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	81.8	8.5e-262
AMG20100.1|1567835_1569032_+	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	86.6	1.8e-195
AMG20101.1|1569130_1570039_+	hypothetical protein	NA	A0A2H4PQQ8	Staphylococcus_phage	75.8	1.1e-101
AMG20102.1|1570208_1571045_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	68.2	7.2e-111
AMG20103.1|1571315_1571672_-	camphor resistance protein CrcB	NA	NA	NA	NA	NA
AMG20104.1|1571668_1572034_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	62.8	3.3e-36
AMG20105.1|1572244_1572550_-	hypothetical protein	NA	NA	NA	NA	NA
AMG20106.1|1572834_1573548_+	transaldolase	NA	E3SKN5	Synechococcus_phage	36.3	2.9e-20
AMG20107.1|1574663_1575113_+	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	47.5	1.3e-21
AMG20108.1|1575120_1575546_-	hypothetical protein	NA	NA	NA	NA	NA
AMG20109.1|1575559_1576030_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4PQT5	Staphylococcus_phage	44.4	2.2e-24
>prophage 5
CP014113	Staphylococcus saprophyticus strain FDAARGOS_168 chromosome, complete genome	2583619	1580475	1597563	2583619	tRNA	Staphylococcus_phage(100.0%)	15	NA	NA
AMG20113.1|1580475_1581942_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2H4PQX2	Staphylococcus_phage	58.6	5.5e-13
AMG20114.1|1582483_1583527_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	64.4	1.0e-130
AMG20115.1|1583533_1584166_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	64.8	5.0e-72
AMG20116.1|1584177_1585359_+	riboflavin biosynthesis protein RibBA	NA	A0A2H4PQS2	Staphylococcus_phage	71.2	4.2e-165
AMG20117.1|1585372_1585831_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	76.3	6.6e-58
AMG20118.1|1586095_1587097_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	68.5	7.3e-126
AMG20119.1|1587363_1588188_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AMG20120.1|1588423_1589380_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
AMG20121.1|1589531_1589933_+	transcriptional regulator	NA	NA	NA	NA	NA
AMG20122.1|1590051_1590612_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	63.8	9.5e-67
AMG20123.1|1590608_1591562_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	83.3	7.3e-67
AMG20124.1|1591671_1592841_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	77.4	2.0e-167
AMG20125.1|1593369_1595784_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	85.6	0.0e+00
AMG20126.1|1595802_1596114_+	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	68.9	4.5e-34
AMG20127.1|1596294_1597563_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	77.2	1.5e-38
>prophage 6
CP014113	Staphylococcus saprophyticus strain FDAARGOS_168 chromosome, complete genome	2583619	1854760	1864727	2583619		uncultured_Mediterranean_phage(28.57%)	11	NA	NA
AMG20363.1|1854760_1855648_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.4	5.1e-38
AMG20364.1|1855715_1856222_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
AMG20365.1|1856313_1857048_+	segregation and condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.5	1.4e-09
AMG20366.1|1857031_1857580_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	31.4	1.6e-10
AMG20367.1|1857572_1858310_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
AMG20368.1|1858436_1859162_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	42.6	1.1e-46
AMG21067.1|1859145_1860909_+	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	23.8	1.7e-21
AMG20369.1|1861336_1861882_+	ECF transporter S component	NA	NA	NA	NA	NA
AMG20370.1|1862037_1862286_-	ferredoxin	NA	A0A127AYY7	Bacillus_phage	48.0	4.9e-15
AMG20371.1|1862395_1863355_+	hypothetical protein	NA	NA	NA	NA	NA
AMG20372.1|1863347_1864727_+	ATP-dependent DNA helicase RecQ	NA	M1PGQ0	Moumouvirus	32.4	5.4e-55
>prophage 7
CP014113	Staphylococcus saprophyticus strain FDAARGOS_168 chromosome, complete genome	2583619	2194238	2284790	2583619	head,tail,integrase,portal,plate,transposase,tRNA,holin,terminase	Staphylococcus_phage(42.22%)	92	2225430:2225451	2266273:2266294
AMG20663.1|2194238_2196989_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	27.8	2.0e-88
AMG20664.1|2197231_2197834_-	DivIVA domain-containing protein	NA	NA	NA	NA	NA
AMG20665.2|2197973_2198753_-	RNA-binding protein	NA	NA	NA	NA	NA
AMG20666.1|2198860_2199151_-	YggT family protein	NA	NA	NA	NA	NA
AMG20667.1|2199164_2199770_-	cell division protein SepF	NA	NA	NA	NA	NA
AMG20668.1|2199775_2200450_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AMG20669.1|2200467_2201256_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AMG20670.1|2201702_2202875_-	cell division protein FtsZ	NA	NA	NA	NA	NA
AMG20671.1|2202904_2204335_-	cell division protein FtsA	NA	NA	NA	NA	NA
AMG20672.1|2204440_2205328_-	cell division protein DivIB	NA	NA	NA	NA	NA
AMG20673.1|2205343_2206693_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
AMG20674.1|2206694_2207660_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
AMG20675.1|2207853_2210088_-	PASTA domain-containing protein	NA	NA	NA	NA	NA
AMG20676.1|2210068_2210461_-	cell division protein FtsL	NA	NA	NA	NA	NA
AMG20677.1|2210475_2211411_-	ribosomal RNA small subunit methyltransferase H	NA	NA	NA	NA	NA
AMG20678.1|2211425_2211857_-	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
AMG20679.1|2212006_2213620_-	bacillithiol biosynthesis cysteine-adding enzyme BshC	NA	NA	NA	NA	NA
AMG20680.1|2213882_2214323_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AMG20681.1|2214437_2215121_-	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
AMG20682.1|2215260_2215395_-	beta-class phenol-soluble modulin	NA	NA	NA	NA	NA
AMG20683.1|2215433_2215568_-	beta-class phenol-soluble modulin	NA	NA	NA	NA	NA
AMG20684.1|2216184_2218068_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AMG20685.2|2220410_2222768_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.9	6.2e-160
AMG20686.1|2222960_2223275_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AMG21071.2|2223415_2224324_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	43.5	8.0e-47
AMG20687.1|2224284_2224968_-	hypothetical protein	NA	NA	NA	NA	NA
2225430:2225451	attL	GTGCCATGCCAGTGCCATAAAA	NA	NA	NA	NA
AMG20688.1|2225698_2225890_-	hypothetical protein	NA	A0A2H4J314	uncultured_Caudovirales_phage	58.9	1.2e-10
AMG20689.1|2226203_2226614_-	YolD-like family protein	NA	A0A2H4JEH6	uncultured_Caudovirales_phage	89.7	2.4e-67
AMG20690.1|2226623_2226815_-	hypothetical protein	NA	A0A2H4JGI3	uncultured_Caudovirales_phage	95.2	7.0e-30
AMG20691.1|2226910_2227159_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AMG20692.1|2227450_2227762_-	hypothetical protein	NA	NA	NA	NA	NA
AMG20693.1|2227751_2228261_-	DUF4065 domain-containing protein	NA	A8ATC0	Listeria_phage	53.7	6.0e-44
AMG21072.1|2228641_2229589_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CMK9	Staphylococcus_phage	52.4	1.0e-84
AMG20694.1|2230016_2230274_-|holin	phage holin	holin	A0A2I6PF56	Staphylococcus_phage	51.9	1.7e-10
AVC42140.1|2230327_2230426_+	hypothetical protein	NA	NA	NA	NA	NA
AMG20695.1|2230674_2230962_-	hypothetical protein	NA	NA	NA	NA	NA
AMG20696.1|2230996_2232880_-	CHAP domain-containing protein	NA	B7T0E8	Staphylococcus_virus	53.0	9.0e-194
AMG20697.1|2232933_2233266_-	DUF2977 domain-containing protein	NA	NA	NA	NA	NA
AMG20698.1|2233265_2235131_-|plate	phage baseplate upper protein	plate	A0EWU3	Staphylococcus_virus	40.5	7.2e-127
AMG20699.1|2237052_2238909_-	peptidase	NA	Q4ZC57	Staphylococcus_virus	53.2	2.3e-181
AMG20700.1|2238919_2239846_-|tail	phage tail protein	tail	Q4ZC58	Staphylococcus_virus	51.3	3.6e-79
AMG20701.1|2239857_2242947_-|terminase	terminase	terminase	Q4ZCD8	Staphylococcus_virus	56.3	6.5e-157
AMG20702.1|2242949_2243258_-	hypothetical protein	NA	A0A2H4JC15	uncultured_Caudovirales_phage	62.7	1.1e-27
AMG20703.1|2243320_2243815_-	hypothetical protein	NA	A0A2H4JI48	uncultured_Caudovirales_phage	72.0	1.1e-61
AMG20704.1|2243867_2244413_-|tail	phage tail protein	tail	A0A1W6JPA3	Staphylococcus_phage	80.8	1.0e-73
AMG20705.1|2244418_2244841_-	DUF3168 domain-containing protein	NA	A1BU61	Staphylococcus_virus	63.7	2.9e-44
AMG20706.1|2244852_2245266_-	hypothetical protein	NA	A0A0N9BAY5	Staphylococcus_phage	74.3	7.8e-58
AMG20707.1|2245252_2245588_-|head,tail	phage head-tail adapter protein	head,tail	Q4ZCE5	Staphylococcus_virus	59.1	2.0e-35
AMG20708.1|2245589_2245886_-|head,tail	phage head-tail adapter protein	head,tail	Q4ZC67	Staphylococcus_virus	63.3	4.9e-30
AMG20709.1|2245885_2246179_-	Rho termination protein	NA	A0A1W6JQI6	Staphylococcus_phage	65.3	2.5e-26
AMG20710.1|2246192_2247125_-	sugar-binding protein	NA	A0A1W6JPD7	Staphylococcus_phage	79.7	6.8e-142
AMG20711.1|2247137_2247662_-	hypothetical protein	NA	Q4ZBR6	Staphylococcus_phage	59.4	3.7e-20
AVC42141.1|2248155_2249748_-	hypothetical protein	NA	A0A2H4JC26	uncultured_Caudovirales_phage	76.7	1.3e-132
AMG20712.1|2249707_2251120_-|portal	phage portal protein	portal	A0A0H4IPW9	Staphylococcus_phage	73.9	2.2e-208
AMG20713.1|2251132_2252341_-|terminase	PBSX family phage terminase large subunit	terminase	R4IG95	Staphylococcus_phage	82.0	2.7e-199
AMG20714.1|2252333_2252855_-|terminase	terminase small subunit	terminase	I1W650	Staphylococcus_phage	62.7	1.6e-36
AMG20715.1|2252920_2253253_-	hypothetical protein	NA	NA	NA	NA	NA
AMG20716.1|2253514_2253937_-	transcriptional regulator	NA	A0A0F6N3E5	Staphylococcus_phage	80.6	1.6e-58
AMG20717.1|2254279_2254750_+	hypothetical protein	NA	NA	NA	NA	NA
AMG20718.1|2254765_2255119_-	hypothetical protein	NA	Q4ZC91	Staphylococcus_virus	29.6	2.2e-05
AMG20719.1|2255118_2255304_-	hypothetical protein	NA	NA	NA	NA	NA
AMG20720.1|2255316_2255523_-	hypothetical protein	NA	A0A1W6JPS2	Staphylococcus_phage	47.8	2.3e-10
AMG20721.1|2255500_2255701_-	hypothetical protein	NA	NA	NA	NA	NA
AMG20722.2|2255697_2256501_-	DNA replication protein DnaC	NA	A0A2I6PDV5	Staphylococcus_phage	46.2	3.5e-62
AMG20723.1|2256598_2257450_-	DnaD domain protein	NA	A0A1Q1PVU4	Staphylococcus_phage	44.8	9.4e-50
AMG20724.1|2257491_2258307_-	recombinase RecT	NA	S6AVW6	Thermus_phage	48.9	2.1e-59
AMG21073.1|2258318_2259230_-	hypothetical protein	NA	A6XMH8	Bacillus_virus	50.5	6.1e-79
AMG20725.1|2259274_2259574_-	hypothetical protein	NA	NA	NA	NA	NA
AMG20726.1|2259648_2259828_-	hypothetical protein	NA	NA	NA	NA	NA
AMG20727.1|2259833_2260139_-	DUF771 domain-containing protein	NA	Q4ZD49	Staphylococcus_phage	45.5	8.4e-17
AMG20728.1|2260339_2260879_+	hypothetical protein	NA	NA	NA	NA	NA
AMG20729.1|2261177_2261357_+	hypothetical protein	NA	NA	NA	NA	NA
AMG21074.1|2261672_2261939_-	XRE family transcriptional regulator	NA	H9A0Y0	Staphylococcus_phage	76.1	3.7e-29
AMG20730.1|2262069_2262828_+	XRE family transcriptional regulator	NA	A0A2I6PF08	Staphylococcus_phage	46.4	6.9e-52
AMG20731.1|2262922_2264266_+	hypothetical protein	NA	NA	NA	NA	NA
AMG20732.1|2264511_2265105_-	hypothetical protein	NA	B7T0F3	Staphylococcus_virus	40.6	3.1e-31
AMG20733.1|2265215_2266259_+|integrase	site-specific integrase	integrase	A0A1W6JQE7	Staphylococcus_phage	63.4	2.8e-120
AMG20734.1|2266753_2267263_-	metallophosphoesterase	NA	NA	NA	NA	NA
2266273:2266294	attR	GTGCCATGCCAGTGCCATAAAA	NA	NA	NA	NA
AMG20735.1|2267259_2267844_-	XTP/dITP diphosphatase	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	30.5	5.2e-15
AMG20736.1|2267846_2268656_-	glutamate racemase	NA	NA	NA	NA	NA
AMG20737.1|2268865_2269687_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
AMG20738.1|2269689_2271453_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
AMG20739.1|2271497_2272109_-	succinate dehydrogenase	NA	NA	NA	NA	NA
AMG20740.1|2272436_2274224_-	excinuclease ABC subunit C	NA	NA	NA	NA	NA
AMG20741.1|2274429_2274744_-	thiol reductase thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	47.6	6.6e-25
AMG20742.1|2274825_2277174_-	endonuclease MutS2	NA	F2QAF8	Phaeocystis_pouchetii_virus	24.9	3.0e-13
AMG20743.1|2277183_2278896_-	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	26.8	1.3e-18
AMG20744.1|2279007_2279529_-	colicin V production protein CvpA	NA	NA	NA	NA	NA
AMG20745.1|2279525_2279795_-	cell division protein ZapA	NA	NA	NA	NA	NA
AMG20746.1|2280103_2281036_+	ribonuclease HIII	NA	NA	NA	NA	NA
AMG20747.1|2281329_2283732_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AMG20748.1|2283731_2284790_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	37.9	1.9e-31
>prophage 8
CP014113	Staphylococcus saprophyticus strain FDAARGOS_168 chromosome, complete genome	2583619	2345093	2353568	2583619		Synechococcus_phage(16.67%)	9	NA	NA
AMG20803.1|2345093_2345660_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.2	9.7e-27
AMG20804.1|2345662_2346691_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	4.6e-67
AMG20805.1|2346683_2348171_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.7	1.6e-44
AMG20806.1|2348149_2350339_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.6	1.4e-137
AMG20807.1|2350331_2351003_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AMG20808.1|2351002_2351263_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AMG20809.1|2351265_2351967_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SE76	Cyanophage	42.5	6.8e-46
AMG20810.1|2351971_2353099_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AMG20811.1|2353085_2353568_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.0	2.6e-20
