The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP010051	Xylella fastidiosa strain Fb7, complete genome	2659912	926173	938809	2659912		Haemophilus_phage(36.36%)	17	NA	NA
ALR08543.2|926173_927670_+	hypothetical protein	NA	Q7Y5T5	Haemophilus_phage	47.4	3.1e-120
ALR09959.2|927679_928117_+	hypothetical protein	NA	Q7Y5T4	Haemophilus_phage	62.4	1.8e-44
ALR08545.2|928682_929075_+	hypothetical protein	NA	NA	NA	NA	NA
ALR08546.2|929176_930571_+	hypothetical protein	NA	D0UII2	Aggregatibacter_phage	33.5	1.7e-16
ALR08548.2|931525_931801_-	addiction module toxin RelE	NA	A0A1S5SB46	Streptococcus_phage	43.9	3.5e-14
ALR08549.2|931784_932012_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
ALR08550.2|932120_932891_+	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	33.3	2.0e-27
ALR08551.2|932890_933208_+	hypothetical protein	NA	NA	NA	NA	NA
ALR08552.2|933204_934035_+	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	52.6	1.4e-77
ALR08553.2|934031_934673_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	38.4	3.5e-33
AWG45228.1|934669_935023_+	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	47.0	1.4e-23
ALR08554.2|935078_935372_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	37.9	6.2e-09
ALR08555.2|935374_935671_-	addiction module antitoxin RelB	NA	A0A141GEX6	Brucella_phage	53.7	3.4e-23
ALR08556.2|935916_936168_+	hypothetical protein	NA	NA	NA	NA	NA
ALR08557.2|936271_936718_-	hypothetical protein	NA	NA	NA	NA	NA
ALR08558.2|936959_937937_-	ABC transporter permease	NA	NA	NA	NA	NA
ALR09960.2|937933_938809_-	multidrug ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.2	8.3e-09
>prophage 2
CP010051	Xylella fastidiosa strain Fb7, complete genome	2659912	1104161	1148044	2659912	tail,head,integrase	Xylella_phage(21.05%)	55	1094236:1094249	1132127:1132140
1094236:1094249	attL	TACCGCCCTGGGAG	NA	NA	NA	NA
ALR08681.2|1104161_1105181_-|integrase	integrase	integrase	C8CLF4	Xylella_phage	87.3	8.7e-167
ALR08682.2|1105180_1105429_-	hypothetical protein	NA	C8CLF5	Xylella_phage	81.7	1.0e-33
ALR08683.2|1105447_1105903_-	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	50.3	4.7e-32
ALR08684.2|1105972_1106773_-	hypothetical protein	NA	Q7Y5V4	Haemophilus_phage	63.8	1.2e-35
ALR08685.2|1107123_1108767_-	hypothetical protein	NA	U6C712	Ralstonia_phage	39.6	2.1e-101
ALR08686.2|1108763_1109690_-	phage recombination protein Bet	NA	U6C6J0	Ralstonia_phage	48.9	2.1e-58
ALR08687.2|1109884_1110076_-	hypothetical protein	NA	C8CLG6	Xylella_phage	70.3	3.4e-16
ALR09975.2|1110099_1110291_-	hypothetical protein	NA	NA	NA	NA	NA
AWG45249.1|1110287_1110695_-	hypothetical protein	NA	C8CLG7	Xylella_phage	73.3	1.0e-46
ALR08688.2|1110694_1111153_-	hypothetical protein	NA	NA	NA	NA	NA
ALR08689.2|1112279_1112468_+	hypothetical protein	NA	NA	NA	NA	NA
ALR08690.2|1112464_1113076_+	cell filamentation protein Fic	NA	NA	NA	NA	NA
ALR08691.2|1113126_1113906_-	repressor	NA	D0UIL9	Aggregatibacter_phage	26.3	6.3e-08
ALR08692.2|1114329_1114719_-	hypothetical protein	NA	NA	NA	NA	NA
ALR08693.2|1114846_1115035_+	hypothetical protein	NA	NA	NA	NA	NA
ALR08694.2|1115031_1115280_+	hypothetical protein	NA	NA	NA	NA	NA
ALR08695.2|1115276_1115642_+	hypothetical protein	NA	NA	NA	NA	NA
ALR08696.2|1115902_1116520_+	phage antirepressor protein	NA	C8CLH5	Xylella_phage	53.4	4.6e-30
ALR08697.2|1116526_1117639_+	hypothetical protein	NA	C8CLG1	Xylella_phage	57.0	5.6e-111
AWG45250.1|1117668_1117944_+	hypothetical protein	NA	A0A0P0I481	Acinetobacter_phage	45.7	1.5e-12
ALR08698.2|1118771_1119461_+	hypothetical protein	NA	NA	NA	NA	NA
ALR09977.1|1119508_1119898_+	hypothetical protein	NA	A0A088F6Y8	Sulfitobacter_phage	44.7	7.4e-10
ALR08699.2|1119894_1120593_+	hypothetical protein	NA	C8CLH7	Xylella_phage	84.3	1.0e-102
ALR08700.2|1121143_1121944_+	hypothetical protein	NA	M4ZRI7	Bacillus_phage	43.6	4.2e-15
AWG45251.1|1122135_1122636_+	peptidase	NA	I2GUG4	Acinetobacter_phage	50.7	3.3e-26
ALR08701.2|1122628_1122958_+	hypothetical protein	NA	NA	NA	NA	NA
AWG45252.1|1122947_1123409_+	hypothetical protein	NA	A0A0S0N8C8	Pseudomonas_phage	33.6	2.1e-11
ALR08702.2|1123410_1123623_+	hypothetical protein	NA	NA	NA	NA	NA
ALR08703.2|1123712_1124111_+	hypothetical protein	NA	NA	NA	NA	NA
ALR08704.2|1124061_1125612_+	hypothetical protein	NA	H9C0C7	Vibrio_phage	45.1	4.2e-112
ALR08706.2|1126949_1127795_+|head	phage head morphogenesis protein	head	Q7Y5U5	Haemophilus_phage	31.5	2.9e-27
ALR08707.2|1127794_1128985_+	hypothetical protein	NA	H9C194	Pectobacterium_phage	41.3	5.6e-40
AWG45253.1|1129503_1130487_+	hypothetical protein	NA	A0A2R3UA82	Siphoviridae_environmental_samples	39.7	7.6e-51
ALR08709.2|1131201_1131690_+	hypothetical protein	NA	M4SN98	Psychrobacter_phage	26.0	4.3e-07
ALR08710.2|1131682_1132051_+	hypothetical protein	NA	Q776V7	Haemophilus_phage	39.1	1.0e-16
ALR08711.2|1132037_1132508_+	hypothetical protein	NA	NA	NA	NA	NA
1132127:1132140	attR	TACCGCCCTGGGAG	NA	NA	NA	NA
ALR08712.2|1132508_1134005_+	hypothetical protein	NA	Q7Y5T5	Haemophilus_phage	47.4	3.1e-120
ALR08713.2|1134014_1134452_+	hypothetical protein	NA	Q7Y5T4	Haemophilus_phage	62.4	1.8e-44
ALR09979.2|1135017_1136907_+	hypothetical protein	NA	A0A2I7RBK9	Vibrio_phage	33.6	2.0e-31
ALR08714.2|1137861_1138137_-	addiction module toxin RelE	NA	A0A1S5SB46	Streptococcus_phage	43.9	3.5e-14
ALR08715.2|1138120_1138348_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AWG45254.1|1138456_1139227_+	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	33.3	2.0e-27
ALR08716.2|1139226_1139544_+	hypothetical protein	NA	NA	NA	NA	NA
AWG45255.1|1139540_1140371_+	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	52.6	1.4e-77
ALR08717.2|1140367_1141009_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	38.4	3.5e-33
ALR09980.2|1141005_1141359_+	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	47.8	3.7e-24
ALR09981.2|1141369_1141675_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	43.6	1.1e-11
AWG45256.1|1141671_1141974_-	addiction module antitoxin RelB	NA	A0A141GEX6	Brucella_phage	58.1	3.4e-26
ALR08718.2|1143213_1143774_+	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	26.1	1.4e-06
ALR08719.2|1143777_1144941_+|tail	phage tail protein	tail	A4PE46	Ralstonia_virus	32.7	1.9e-08
AWG45257.1|1144937_1145171_-	hypothetical protein	NA	C8CLJ6	Xylella_phage	58.0	2.7e-15
ALR08720.2|1145170_1145737_-	hypothetical protein	NA	I6R0L8	Salmonella_phage	32.5	1.8e-17
ALR08721.2|1146004_1146358_-	hypothetical protein	NA	NA	NA	NA	NA
ALR08722.2|1146365_1147382_-	peptidase M4	NA	NA	NA	NA	NA
ALR08723.2|1147711_1148044_+	transcriptional regulator	NA	A0A0P0IRJ4	Acinetobacter_phage	40.7	7.0e-17
>prophage 3
CP010051	Xylella fastidiosa strain Fb7, complete genome	2659912	1175505	1186140	2659912		Stenotrophomonas_phage(42.86%)	12	NA	NA
ALR08746.2|1175505_1176579_+	Zonular occludens toxin	NA	Q6UAZ2	Ralstonia_phage	29.3	4.3e-23
ALR08747.2|1176755_1177004_-	hypothetical protein	NA	NA	NA	NA	NA
ALR08748.2|1177988_1178267_+	hypothetical protein	NA	NA	NA	NA	NA
ALR08749.2|1178499_1179651_-	hypothetical protein	NA	S0F3F8	Stenotrophomonas_phage	59.2	2.8e-113
AWG45259.1|1179655_1180027_-	DUF2523 domain-containing protein	NA	A0A1D6ZIU0	Xanthomonas_phage	46.8	3.1e-21
ALR08750.2|1180032_1181517_-	hypothetical protein	NA	A0A1W6DXV5	Xanthomonas_phage	45.3	5.5e-37
ALR08751.2|1181619_1181865_-	hypothetical protein	NA	NA	NA	NA	NA
ALR08752.2|1181861_1182065_-	hypothetical protein	NA	S0F2M5	Stenotrophomonas_phage	60.0	2.8e-16
AWG45260.1|1182431_1183607_-	Replication initiation factor	NA	S0F3F7	Stenotrophomonas_phage	46.1	5.6e-77
ALR08753.2|1184218_1184401_-	hypothetical protein	NA	NA	NA	NA	NA
ALR09983.2|1184879_1185200_-	hypothetical protein	NA	NA	NA	NA	NA
ALR08754.2|1185792_1186140_+	hypothetical protein	NA	Q38057	Xanthomonas_phage	47.5	1.1e-07
>prophage 4
CP010051	Xylella fastidiosa strain Fb7, complete genome	2659912	1464880	1474805	2659912	integrase	Vibrio_phage(16.67%)	16	1459289:1459305	1474231:1474247
1459289:1459305	attL	GGTCGCGGCGGCGGCAA	NA	NA	NA	NA
ALR08948.2|1464880_1466092_-|integrase	integrase	integrase	T1S9J3	Salmonella_phage	39.0	1.4e-67
AWG45291.1|1466233_1466509_-	hypothetical protein	NA	A0A2R3UAA5	Siphoviridae_environmental_samples	49.1	2.3e-05
ALR08949.2|1466505_1468056_-	hypothetical protein	NA	H9C0C7	Vibrio_phage	44.9	1.6e-111
ALR08950.2|1468006_1468405_-	hypothetical protein	NA	NA	NA	NA	NA
ALR08952.2|1468710_1469172_-	hypothetical protein	NA	A0A0S0N8C8	Pseudomonas_phage	32.8	1.0e-10
ALR08953.2|1469161_1469491_-	hypothetical protein	NA	NA	NA	NA	NA
ALR08954.2|1469483_1469984_-	peptidase	NA	A0A2I7RLY1	Vibrio_phage	51.7	5.0e-27
ALR08955.2|1470188_1470527_-	hypothetical protein	NA	K4NZP3	Burkholderia_phage	54.9	1.0e-07
ALR08956.2|1470513_1470780_-	hypothetical protein	NA	K4NX81	Burkholderia_phage	40.7	8.1e-08
AWG45292.1|1471661_1472051_-	hypothetical protein	NA	A0A088F6Y8	Sulfitobacter_phage	44.7	7.4e-10
ALR08958.2|1472098_1472788_-	hypothetical protein	NA	NA	NA	NA	NA
ALR08959.2|1472768_1473620_-	hypothetical protein	NA	A0A142K7R2	Mycobacterium_phage	60.6	4.0e-16
ALR10022.2|1473616_1473892_-	hypothetical protein	NA	A0A0P0I481	Acinetobacter_phage	45.7	1.5e-12
AWG45293.1|1473921_1474260_-	hypothetical protein	NA	C8CLG1	Xylella_phage	83.9	3.2e-49
1474231:1474247	attR	GGTCGCGGCGGCGGCAA	NA	NA	NA	NA
ALR08960.2|1474298_1474538_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
ALR08961.2|1474556_1474805_+	hypothetical protein	NA	C8CLF5	Xylella_phage	81.7	2.3e-33
>prophage 5
CP010051	Xylella fastidiosa strain Fb7, complete genome	2659912	1802915	1810097	2659912	integrase	Stenotrophomonas_phage(50.0%)	10	1800917:1800968	1810114:1810165
1800917:1800968	attL	CGGACTTTTAATCCGCTGGTCGCTGGTTCGATTCCAGCACGGCCCACCAGCT	NA	NA	NA	NA
ALR09187.2|1802915_1804091_+	Replication initiation factor	NA	S0F3F7	Stenotrophomonas_phage	45.5	4.3e-77
AWG45319.1|1804510_1804831_+	hypothetical protein	NA	NA	NA	NA	NA
AWG45320.1|1804830_1805040_+	hypothetical protein	NA	S0F2M5	Stenotrophomonas_phage	65.0	1.3e-16
ALR09188.2|1805036_1805273_+	hypothetical protein	NA	NA	NA	NA	NA
AWG45321.1|1805411_1806806_+	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	49.2	6.9e-58
AWG45322.1|1806809_1807151_+	DUF2523 domain-containing protein	NA	A0A1D6ZIU0	Xanthomonas_phage	47.7	6.3e-21
ALR09189.2|1807150_1808284_+	hypothetical protein	NA	S0F3F8	Stenotrophomonas_phage	58.6	4.5e-124
AWG45323.1|1808432_1808717_+	hypothetical protein	NA	NA	NA	NA	NA
ALR10048.2|1808771_1809005_-	hypothetical protein	NA	NA	NA	NA	NA
AWG45324.1|1809266_1810097_+|integrase	integrase	integrase	Q7Y5X7	Haemophilus_phage	45.4	2.3e-61
1810114:1810165	attR	CGGACTTTTAATCCGCTGGTCGCTGGTTCGATTCCAGCACGGCCCACCAGCT	NA	NA	NA	NA
>prophage 6
CP010051	Xylella fastidiosa strain Fb7, complete genome	2659912	2071733	2105178	2659912	tail	Haemophilus_phage(19.23%)	40	NA	NA
ALR09371.2|2071733_2073371_+	hypothetical protein	NA	A0A2K9L5I4	Tupanvirus	24.2	2.3e-12
ALR09372.2|2073407_2074040_-	DNA-binding response regulator	NA	NA	NA	NA	NA
ALR09373.2|2074579_2074786_+	hypothetical protein	NA	C8CLF4	Xylella_phage	66.0	7.1e-12
ALR09374.2|2074860_2075184_+	hypothetical protein	NA	NA	NA	NA	NA
ALR09376.2|2076190_2076523_-	transcriptional regulator	NA	A0A0P0IRJ4	Acinetobacter_phage	40.7	1.4e-17
AWG45344.1|2076927_2077476_+	hypothetical protein	NA	I6R0L8	Salmonella_phage	39.4	9.5e-19
ALR09377.2|2077435_2077762_+	hypothetical protein	NA	NA	NA	NA	NA
ALR09378.2|2077761_2078031_+	hypothetical protein	NA	NA	NA	NA	NA
ALR09379.2|2078044_2078296_+	hypothetical protein	NA	C8CLJ6	Xylella_phage	63.2	2.6e-16
ALR09380.2|2078273_2079437_-|tail	phage tail protein	tail	A4PE46	Ralstonia_virus	32.7	1.9e-08
ALR10065.2|2081233_2081587_-	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	47.0	9.1e-23
ALR09382.2|2081583_2082225_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	37.3	8.7e-32
ALR09384.2|2083047_2083365_-	hypothetical protein	NA	NA	NA	NA	NA
ALR09386.2|2084191_2084518_+	hypothetical protein	NA	NA	NA	NA	NA
ALR10066.2|2084514_2084796_+	transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	51.4	8.8e-13
ALR09387.2|2084854_2086744_-	hypothetical protein	NA	A0A2I7RBK9	Vibrio_phage	33.1	1.3e-30
ALR09388.2|2086891_2087314_-	hypothetical protein	NA	NA	NA	NA	NA
ALR09389.2|2087310_2087748_-	hypothetical protein	NA	Q7Y5T4	Haemophilus_phage	61.7	8.8e-44
ALR09390.2|2087757_2089254_-	hypothetical protein	NA	Q7Y5T5	Haemophilus_phage	47.8	3.3e-122
ALR09391.2|2089254_2089725_-	hypothetical protein	NA	NA	NA	NA	NA
ALR09392.2|2089711_2090080_-	hypothetical protein	NA	Q776V7	Haemophilus_phage	37.7	1.0e-16
ALR09393.2|2090066_2090546_-	hypothetical protein	NA	M4SN98	Psychrobacter_phage	26.7	1.9e-07
ALR09394.2|2090542_2090911_-	hypothetical protein	NA	Q7Y5T9	Haemophilus_phage	37.4	1.5e-12
ALR09395.2|2090913_2091213_-	hypothetical protein	NA	NA	NA	NA	NA
ALR09396.2|2091278_2092262_-	hypothetical protein	NA	A0A2R3UA82	Siphoviridae_environmental_samples	39.3	9.9e-51
ALR09397.2|2092271_2092754_-	hypothetical protein	NA	NA	NA	NA	NA
ALR09398.2|2092781_2093972_-	hypothetical protein	NA	H9C194	Pectobacterium_phage	41.3	5.6e-40
ALR09399.2|2094727_2095930_-	hypothetical protein	NA	L7TRA1	Rhizobium_phage	35.2	2.4e-54
ALR09400.2|2096154_2097705_-	hypothetical protein	NA	H9C0C7	Vibrio_phage	45.1	9.3e-112
AWG45345.1|2097655_2098054_-	hypothetical protein	NA	NA	NA	NA	NA
AWG45346.1|2098359_2098821_-	hypothetical protein	NA	A0A0S0N8C8	Pseudomonas_phage	32.8	1.0e-10
AWG45347.1|2098810_2099140_-	hypothetical protein	NA	NA	NA	NA	NA
AWG45348.1|2099132_2099633_-	peptidase	NA	A0A2I7RLY1	Vibrio_phage	51.7	5.0e-27
ALR09402.2|2099815_2100097_+	excinuclease ABC subunit A	NA	NA	NA	NA	NA
ALR09403.2|2100106_2100406_+	addiction module antidote protein, HigA family	NA	M9MUN2	Rhodococcus_phage	45.9	1.1e-13
ALR10068.2|2101182_2101572_-	hypothetical protein	NA	A0A088F6Y8	Sulfitobacter_phage	44.7	7.4e-10
AWG45349.1|2101619_2102309_-	hypothetical protein	NA	NA	NA	NA	NA
ALR09405.2|2103136_2103412_-	hypothetical protein	NA	A0A0P0I481	Acinetobacter_phage	45.7	1.5e-12
ALR09406.2|2103441_2104554_-	hypothetical protein	NA	C8CLG1	Xylella_phage	57.0	5.6e-111
ALR09407.2|2104560_2105178_-	phage antirepressor protein	NA	C8CLH5	Xylella_phage	53.4	4.6e-30
>prophage 7
CP010051	Xylella fastidiosa strain Fb7, complete genome	2659912	2111709	2120395	2659912		Xylella_phage(18.18%)	12	NA	NA
AWG45350.1|2111709_2112111_+	hypothetical protein	NA	C8CLG7	Xylella_phage	85.0	2.6e-58
ALR09420.2|2112107_2112299_+	hypothetical protein	NA	NA	NA	NA	NA
ALR09421.2|2112322_2112514_+	hypothetical protein	NA	C8CLG6	Xylella_phage	67.2	4.1e-14
ALR09422.2|2112534_2112879_+	hypothetical protein	NA	U5P4J6	Shigella_phage	46.5	1.4e-15
ALR09423.2|2112918_2113740_+	hypothetical protein	NA	K7ZMK3	Xanthomonas_citri_phage	43.3	3.0e-53
ALR09424.2|2113755_2114682_+	phage recombination protein Bet	NA	U6C6J0	Ralstonia_phage	48.6	1.0e-57
ALR09425.2|2114678_2116322_+	hypothetical protein	NA	U6C712	Ralstonia_phage	38.2	1.1e-99
ALR09426.2|2116672_2117467_+	hypothetical protein	NA	A0A077KC96	Edwardsiella_phage	65.7	2.3e-34
ALR09427.2|2117475_2118009_+	hypothetical protein	NA	Q5QF30	Pseudomonas_virus	36.3	5.0e-25
ALR09428.2|2118356_2119184_+	hypothetical protein	NA	A4PE61	Ralstonia_virus	44.4	1.3e-19
ALR09429.2|2119180_2119894_+	DNA-binding protein	NA	G0ZND1	Cronobacter_phage	58.9	2.5e-43
ALR09430.2|2119951_2120395_+	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	53.2	2.9e-34
>prophage 8
CP010051	Xylella fastidiosa strain Fb7, complete genome	2659912	2305041	2365233	2659912	tail,tRNA,capsid,plate	Escherichia_phage(25.0%)	59	NA	NA
ALR09551.2|2305041_2305776_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
ALR09552.2|2305772_2306567_-	thiazole synthase	NA	NA	NA	NA	NA
ALR09553.2|2306615_2306816_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
ALR09554.2|2306957_2308751_+	esterase	NA	NA	NA	NA	NA
ALR09556.2|2309143_2309386_-	hypothetical protein	NA	NA	NA	NA	NA
ALR09557.2|2309517_2310042_-	hypothetical protein	NA	NA	NA	NA	NA
ALR09558.2|2310198_2312292_+	hypothetical protein	NA	A0A1R3Y5Q6	Salmonella_virus	37.2	1.0e-92
ALR10086.2|2312652_2313087_-	phosphotransferase	NA	NA	NA	NA	NA
ALR10087.2|2313064_2315431_-	hypothetical protein	NA	NA	NA	NA	NA
ALR09559.2|2315626_2316250_-	fatty acyl CoA synthetase	NA	NA	NA	NA	NA
ALR09560.2|2316197_2317178_-	acyltransferase	NA	NA	NA	NA	NA
ALR10088.2|2317174_2317462_-	hypothetical protein	NA	NA	NA	NA	NA
ALR09561.2|2317511_2317703_-	hypothetical protein	NA	NA	NA	NA	NA
ALR09562.2|2317703_2318444_-	ketosynthase	NA	NA	NA	NA	NA
ALR10089.2|2318418_2318688_-	acyl carrier protein	NA	NA	NA	NA	NA
ALR09563.2|2319051_2320032_+	pteridine-dependent deoxygenase	NA	NA	NA	NA	NA
ALR09564.2|2320457_2321753_+	TIGR01244 family protein	NA	NA	NA	NA	NA
ALR09565.2|2321746_2322091_+	transcriptional regulator	NA	NA	NA	NA	NA
AWG45368.1|2322087_2322495_+	hypothetical protein	NA	NA	NA	NA	NA
AWG45369.1|2322491_2322932_+	hypothetical protein	NA	NA	NA	NA	NA
ALR09566.2|2322928_2323714_+	hypothetical protein	NA	NA	NA	NA	NA
AWG45370.1|2324286_2324862_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	67.7	2.8e-69
ALR09567.2|2325130_2326093_-	hypothetical protein	NA	NA	NA	NA	NA
ALR09568.2|2326092_2327952_-	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	36.2	4.0e-85
ALR09570.2|2329764_2330253_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
ALR09572.2|2331762_2331984_+	hypothetical protein	NA	NA	NA	NA	NA
AWG45371.1|2332188_2333523_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	34.5	2.5e-36
ALR09573.2|2333588_2334446_-	virulence factor	NA	NA	NA	NA	NA
ALR09574.2|2334572_2336411_-	serine/threonine kinase	NA	A0A075BSL8	Microcystis_phage	34.8	1.4e-26
ALR09575.2|2336497_2337586_+	ribonuclease D	NA	NA	NA	NA	NA
ALR09576.2|2337864_2338269_+	histone-like nucleoid-structuring protein	NA	NA	NA	NA	NA
ALR09577.2|2339054_2340110_-	23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM	NA	NA	NA	NA	NA
AWG45372.1|2341805_2342162_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AWG45373.1|2342142_2342442_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.4	3.6e-12
AWG45374.1|2342465_2344844_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
ALR09578.2|2344927_2345923_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	35.5	9.7e-30
ALR09579.2|2346200_2346560_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
ALR09580.2|2346570_2346768_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
ALR09581.2|2347013_2347493_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.0	1.3e-11
ALR09582.2|2347608_2349516_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.5	1.3e-126
ALR09583.2|2349581_2349794_-	hypothetical protein	NA	NA	NA	NA	NA
ALR09584.2|2349761_2350064_+	hypothetical protein	NA	NA	NA	NA	NA
ALR09586.2|2351676_2351895_-|tail	phage tail protein	tail	NA	NA	NA	NA
ALR09587.2|2351891_2352374_-|tail	phage tail protein	tail	A0A193GYE0	Enterobacter_phage	47.6	1.2e-28
AWG45375.1|2354715_2355003_-	hypothetical protein	NA	A0A193GYZ8	Enterobacter_phage	43.4	6.9e-13
AWG45376.1|2355005_2355515_-|tail	phage major tail tube protein	tail	A0A088FRU2	Escherichia_phage	52.7	1.2e-47
AWG45377.1|2355514_2356693_-|tail	phage tail protein	tail	A0A088FVH5	Escherichia_phage	56.3	4.4e-138
ALR09589.2|2356757_2358350_-	hypothetical protein	NA	V9IQX0	Stenotrophomonas_phage	36.2	5.4e-83
ALR10090.2|2358357_2358915_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	54.4	5.1e-52
ALR09590.2|2358907_2359801_-|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	45.8	4.7e-68
ALR09591.2|2359800_2360139_-|plate	phage baseplate protein	plate	A0A088FV58	Escherichia_phage	60.4	4.6e-32
ALR09592.2|2360356_2360659_+	toxin-antitoxin system, toxin component	NA	NA	NA	NA	NA
ALR09593.2|2360661_2361063_+	antitoxin	NA	NA	NA	NA	NA
ALR09594.2|2361131_2361719_-|plate	baseplate assembly protein	plate	NA	NA	NA	NA
ALR09595.2|2361715_2362258_-	hypothetical protein	NA	D5LGZ6	Escherichia_phage	42.9	1.7e-36
ALR09596.2|2362233_2362755_-	hypothetical protein	NA	D5LGZ7	Escherichia_phage	33.9	2.8e-12
ALR09597.2|2362751_2363075_-	hypothetical protein	NA	NA	NA	NA	NA
ALR09598.2|2363074_2363335_-	hypothetical protein	NA	NA	NA	NA	NA
ALR09599.2|2363352_2365233_-|capsid	major capsid protein	capsid	V5YSS9	Pseudomonas_phage	48.4	4.2e-167
>prophage 9
CP010051	Xylella fastidiosa strain Fb7, complete genome	2659912	2375672	2392704	2659912	integrase	Xylella_phage(100.0%)	27	2374737:2374751	2396035:2396049
2374737:2374751	attL	CCGCGTTCTTCAAGG	NA	NA	NA	NA
ALR09609.2|2375672_2376455_-	hypothetical protein	NA	C8CLH5	Xylella_phage	59.7	5.5e-28
ALR09610.2|2377146_2377479_+	hypothetical protein	NA	NA	NA	NA	NA
ALR09611.2|2377548_2377797_-	hypothetical protein	NA	NA	NA	NA	NA
ALR09612.2|2377793_2377982_-	hypothetical protein	NA	NA	NA	NA	NA
ALR10093.2|2378035_2378260_-	hypothetical protein	NA	NA	NA	NA	NA
ALR09613.2|2378361_2378667_+	hypothetical protein	NA	NA	NA	NA	NA
AWG45378.1|2378663_2378864_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
ALR09614.2|2378937_2379708_+	peptidase S24	NA	C8CLH0	Xylella_phage	34.5	6.0e-27
ALR09615.2|2379876_2380416_+	hypothetical protein	NA	NA	NA	NA	NA
ALR09616.2|2380452_2380764_+	hypothetical protein	NA	NA	NA	NA	NA
ALR09617.2|2381125_2381437_-	hypothetical protein	NA	NA	NA	NA	NA
ALR09618.2|2381512_2381902_+	hypothetical protein	NA	C8CLG9	Xylella_phage	37.5	1.0e-06
ALR09619.2|2381898_2382300_+	hypothetical protein	NA	C8CLG8	Xylella_phage	68.3	1.1e-11
ALR10094.2|2382299_2382701_+	hypothetical protein	NA	C8CLG7	Xylella_phage	67.7	2.8e-44
ALR09620.2|2382697_2382892_+	hypothetical protein	NA	C8CLG6	Xylella_phage	79.7	2.7e-21
ALR09621.2|2382923_2383196_+	hypothetical protein	NA	NA	NA	NA	NA
ALR10095.2|2383192_2383384_+	hypothetical protein	NA	C8CLG5	Xylella_phage	76.8	1.1e-14
ALR09622.2|2383437_2383881_+	hypothetical protein	NA	C8CLG4	Xylella_phage	74.3	1.0e-31
ALR09623.2|2383877_2385155_+	hypothetical protein	NA	C8CLG3	Xylella_phage	80.6	1.9e-195
ALR09624.2|2385154_2385721_+	hypothetical protein	NA	C8CLG2	Xylella_phage	95.7	3.5e-101
ALR09625.2|2386188_2386947_+	antirepressor	NA	C8CLG1	Xylella_phage	91.7	4.7e-133
ALR09626.2|2386948_2389129_+	DNA polymerase	NA	C8CLG0	Xylella_phage	91.2	0.0e+00
ALR09627.2|2389125_2389404_+	hypothetical protein	NA	C8CLF9	Xylella_phage	96.7	2.5e-44
AWG45379.1|2389405_2389801_-	DUF1640 domain-containing protein	NA	NA	NA	NA	NA
ALR09628.2|2389864_2391283_+	hypothetical protein	NA	C8CLF7	Xylella_phage	92.8	6.4e-261
ALR09629.2|2391436_2391685_+	hypothetical protein	NA	C8CLF5	Xylella_phage	80.5	3.0e-33
ALR09630.2|2391684_2392704_+|integrase	integrase	integrase	C8CLF4	Xylella_phage	86.4	1.6e-165
2396035:2396049	attR	CCTTGAAGAACGCGG	NA	NA	NA	NA
