The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP030288	Salmonella enterica subsp. enterica serovar Gaminara str. SA20063285 chromosome, complete genome	4834965	1196516	1268796	4834965	tRNA,head,integrase,plate,portal,tail,lysis,capsid	Salmonella_phage(80.0%)	75	1205676:1205723	1239798:1239845
AXE07109.1|1196516_1198850_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	84.5	0.0e+00
AXE07110.1|1198864_1199185_-	hypothetical protein	NA	NA	NA	NA	NA
AXE07111.1|1199181_1199409_-	hypothetical protein	NA	NA	NA	NA	NA
AXE07112.1|1199405_1199957_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	71.3	8.6e-36
AXE07113.1|1200757_1201495_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	64.4	7.6e-80
AXE07114.1|1201491_1201737_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	76.5	6.3e-31
AXE07115.1|1201753_1202320_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	7.7e-56
AXE07116.1|1202283_1202469_-	hypothetical protein	NA	NA	NA	NA	NA
AXE07117.1|1202851_1204261_+	hypothetical protein	NA	NA	NA	NA	NA
AXE07118.1|1204297_1205494_-	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	49.8	3.4e-106
1205676:1205723	attL	ATTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AXE07119.1|1205840_1206872_-	hypothetical protein	NA	NA	NA	NA	NA
AXE07120.1|1206874_1207894_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	95.5	4.3e-190
AXE07121.1|1207895_1208528_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	69.5	4.1e-82
AXE07122.1|1208644_1208887_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
AXE07123.1|1208919_1209429_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	99.4	3.6e-89
AXE10540.1|1209436_1209637_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	98.5	2.7e-32
AXE07124.1|1209600_1209942_+	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	100.0	2.1e-56
AXE07125.1|1210009_1210243_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	96.1	1.1e-32
AXE07126.1|1210242_1210470_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	93.3	3.0e-35
AXE07127.1|1210466_1210763_+	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	45.5	1.5e-10
AXE07128.1|1210759_1211617_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	94.0	1.4e-154
AXE07129.1|1211607_1214016_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	94.5	0.0e+00
AXE07130.1|1214035_1214263_-	hypothetical protein	NA	NA	NA	NA	NA
AXE07131.1|1214400_1214589_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	91.7	5.7e-24
AXE10541.1|1214931_1216200_+	hypothetical protein	NA	NA	NA	NA	NA
AXE07132.1|1216252_1217287_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	90.9	3.1e-180
AXE07133.1|1217286_1219053_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	96.1	0.0e+00
AXE07134.1|1219195_1220029_+|capsid	capsid protein	capsid	E5G6M5	Salmonella_phage	96.0	3.8e-128
AXE07135.1|1220045_1221110_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	99.7	1.9e-196
AXE07136.1|1221113_1221764_+	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	100.0	2.2e-115
AXE07137.1|1221857_1222322_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	96.1	4.6e-83
AXE07138.1|1222321_1222525_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AXE07139.1|1222528_1222744_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
AXE07140.1|1222724_1223234_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.0	9.2e-93
AXE07141.1|1223238_1223616_+	peptidase	NA	A0A1S6KZZ2	Salmonella_phage	97.6	1.2e-60
AXE07142.1|1223615_1224041_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	99.3	3.8e-68
AXE07143.1|1224136_1224568_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
AXE07144.1|1225008_1225860_-	hypothetical protein	NA	E5G6N5	Salmonella_phage	59.2	9.0e-93
AXE07145.1|1225937_1226516_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	94.3	1.1e-102
AXE07146.1|1226512_1226872_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	91.5	3.5e-54
AXE07147.1|1226858_1227767_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	97.7	6.1e-156
AXE07148.1|1227759_1228365_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	98.0	4.6e-115
AXE07149.1|1228361_1230140_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	67.6	2.5e-201
AXE07150.1|1230109_1230727_+|tail	tail fiber assembly protein	tail	A0A1S6KZY8	Salmonella_phage	99.0	8.2e-112
AXE07151.1|1230730_1231270_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	99.4	7.2e-96
AXE07152.1|1231272_1232199_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	99.6	2.5e-160
AXE07153.1|1232168_1232726_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	98.4	5.5e-99
AXE07154.1|1232828_1234001_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	99.7	5.7e-223
AXE07155.1|1234010_1234526_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	98.8	7.9e-92
AXE07156.1|1234580_1234883_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	100.0	2.5e-45
AXE07157.1|1234897_1235017_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
AXE07158.1|1235009_1237817_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.3	0.0e+00
AXE07159.1|1237813_1238299_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	99.2	8.3e-67
AXE07160.1|1238295_1239396_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	97.3	4.8e-195
AXE07161.1|1239464_1239683_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
AXE10542.1|1240234_1241398_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
1239798:1239845	attR	ATTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AXE07162.1|1241405_1243586_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	9.9e-19
AXE07163.1|1243582_1244992_-	type I secretion protein TolC	NA	NA	NA	NA	NA
AXE07164.1|1245056_1256531_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
AXE10543.1|1257147_1257630_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
AXE07165.1|1257779_1258256_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AXE07166.1|1258245_1258536_+	RnfH family protein	NA	NA	NA	NA	NA
AXE07167.1|1258696_1259035_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AXE07168.1|1259183_1260845_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AXE07169.1|1260930_1261809_-	NAD(+) kinase	NA	NA	NA	NA	NA
AXE10544.1|1261740_1261935_+	molecular chaperone GrpE	NA	NA	NA	NA	NA
AXE07170.1|1261931_1262522_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AXE07171.1|1262556_1263162_-	cytoplasmic protein	NA	NA	NA	NA	NA
AXE07172.1|1263291_1264533_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AXE07173.1|1264597_1265389_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AXE07174.1|1265334_1265631_-	hypothetical protein	NA	NA	NA	NA	NA
AXE07175.1|1265554_1266916_+	signal recognition particle protein	NA	NA	NA	NA	NA
AXE10546.1|1267168_1267417_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AXE10545.1|1267435_1267984_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AXE07176.1|1268028_1268796_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 2
CP030288	Salmonella enterica subsp. enterica serovar Gaminara str. SA20063285 chromosome, complete genome	4834965	1758623	1767797	4834965	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AXE07611.1|1758623_1759571_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
AXE07612.1|1759554_1760286_+	ABC transporter permease	NA	NA	NA	NA	NA
AXE07613.1|1760266_1760374_-	hypothetical protein	NA	NA	NA	NA	NA
AXE07614.1|1760433_1761165_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AXE10564.1|1761390_1763076_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	2.4e-278
AXE07615.1|1763072_1763792_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AXE07616.1|1763838_1764306_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AXE07617.1|1764362_1764893_-	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
AXE07618.1|1765064_1765523_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	73.2	7.6e-54
AXE07619.1|1765763_1767797_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 3
CP030288	Salmonella enterica subsp. enterica serovar Gaminara str. SA20063285 chromosome, complete genome	4834965	1939661	1979497	4834965	head,tail,lysis	Salmonella_phage(20.45%)	55	NA	NA
AXE07770.1|1939661_1941755_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	51.6	3.3e-197
AXE07771.1|1941751_1942009_-	hypothetical protein	NA	NA	NA	NA	NA
AXE07772.1|1942102_1942282_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	62.1	4.3e-13
AXE07773.1|1942269_1943112_-	DNA adenine methylase	NA	A0A0K1LM14	Caulobacter_phage	49.8	4.0e-69
AXE07774.1|1943108_1943342_-	hypothetical protein	NA	S4TVX5	Salmonella_phage	47.7	3.3e-13
AXE07775.1|1943376_1944207_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.0e-104
AXE07776.1|1944199_1946890_-	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	75.6	1.3e-116
AXE07777.1|1946990_1947365_-	hypothetical protein	NA	NA	NA	NA	NA
AXE07778.1|1947439_1947724_-	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	53.2	1.7e-08
AXE07779.1|1948065_1948356_+	hypothetical protein	NA	NA	NA	NA	NA
AXE07780.1|1948657_1948813_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	8.0e-08
AXE07781.1|1948978_1949365_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	44.6	1.8e-19
AXE07782.1|1949468_1949729_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AXE07783.1|1949725_1950220_+	hypothetical protein	NA	NA	NA	NA	NA
AXE07784.1|1950643_1950880_-	hypothetical protein	NA	NA	NA	NA	NA
AXE07785.1|1950927_1951134_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	58.0	3.1e-15
AXE07786.1|1951140_1951893_+	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	77.4	7.7e-104
AXE07787.1|1951910_1952306_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	38.8	4.4e-18
AXE07788.1|1952302_1952575_+	hypothetical protein	NA	NA	NA	NA	NA
AXE07789.1|1952720_1952933_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	88.6	1.4e-26
AXE07790.1|1953509_1953947_+	protein ninB	NA	G8C7V3	Escherichia_phage	69.4	8.0e-53
AXE07791.1|1953943_1954138_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	59.6	1.0e-12
AXE07792.1|1954134_1954416_+	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	76.9	4.8e-35
AXE07793.1|1954412_1954949_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	3.5e-66
AXE10573.1|1955467_1955770_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AXE07794.1|1955747_1956287_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	70.1	4.9e-76
AXE10574.1|1956678_1957119_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	79.4	2.5e-54
AXE07795.1|1957344_1957527_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
AXE07796.1|1957597_1958227_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	98.6	2.5e-108
AXE07797.1|1958229_1959849_+	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	81.0	1.9e-261
AXE07798.1|1959848_1961369_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	43.7	4.8e-105
AXE07799.1|1961409_1962099_+|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	49.6	4.5e-58
AXE07800.1|1962095_1963442_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.0	1.6e-67
AXE07801.1|1963443_1963926_+	hypothetical protein	NA	A0A1X9SFC3	Acinetobacter_phage	49.4	3.2e-26
AXE07802.1|1963925_1964954_+	DUF2184 domain-containing protein	NA	Q8HAP7	Burkholderia_phage	50.2	1.1e-79
AXE07803.1|1964957_1965305_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	40.2	3.9e-10
AXE07804.1|1965311_1965767_+	DUF4054 domain-containing protein	NA	A0A068CGG9	Acinetobacter_phage	40.8	2.4e-15
AXE07805.1|1965760_1966345_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.6	3.2e-17
AXE07806.1|1966341_1966707_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	40.5	3.9e-21
AXE07807.1|1966691_1967237_+	hypothetical protein	NA	NA	NA	NA	NA
AXE07808.1|1967217_1968702_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	41.0	3.1e-96
AXE07809.1|1968702_1969149_+	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
AXE07810.1|1969148_1969553_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	1.8e-19
AXE07811.1|1969594_1969777_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
AXE07812.1|1969760_1971932_+	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	67.1	1.4e-49
AXE07813.1|1971928_1972639_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	1.1e-27
AXE07814.1|1972638_1972941_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
AXE07815.1|1972937_1973807_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.7	9.1e-32
AXE07816.1|1973787_1974465_+	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	36.4	3.2e-32
AXE07817.1|1974477_1974834_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	5.5e-20
AXE07818.1|1974830_1976072_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	49.9	1.2e-101
AXE07819.1|1976073_1976676_+	DUF2612 domain-containing protein	NA	H9C0Y0	Aeromonas_phage	43.2	5.9e-30
AXE07820.1|1976665_1978117_+|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	70.7	1.5e-42
AXE07821.1|1978113_1978938_+|tail	phage tail protein	tail	A0A0M4QWS3	Salmonella_phage	93.4	1.2e-150
AXE07822.1|1978927_1979497_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.4	4.2e-94
>prophage 4
CP030288	Salmonella enterica subsp. enterica serovar Gaminara str. SA20063285 chromosome, complete genome	4834965	1983097	1990363	4834965		Morganella_phage(33.33%)	8	NA	NA
AXE07826.1|1983097_1983517_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	59.7	5.5e-35
AXE07827.1|1983519_1984788_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	1.4e-227
AXE07828.1|1985242_1985455_+	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
AXE10575.1|1985465_1985654_+	cold-shock protein	NA	NA	NA	NA	NA
AXE07829.1|1985912_1987124_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.5	2.0e-109
AXE07830.1|1987772_1988072_+	hypothetical protein	NA	NA	NA	NA	NA
AXE07831.1|1988163_1988859_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
AXE07832.1|1988932_1990363_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
>prophage 5
CP030288	Salmonella enterica subsp. enterica serovar Gaminara str. SA20063285 chromosome, complete genome	4834965	2276035	2282697	4834965		Salmonella_phage(28.57%)	10	NA	NA
AXE08124.1|2276035_2276842_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
AXE08125.1|2276843_2277836_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
AXE08126.1|2277835_2278726_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
AXE08127.1|2278862_2279249_+	DUF4102 domain-containing protein	NA	K7PLT1	Enterobacteria_phage	59.4	1.6e-28
AXE08128.1|2279548_2280271_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	38.9	4.3e-35
AXE08129.1|2280741_2280924_+	hypothetical protein	NA	S4TSR3	Salmonella_phage	77.6	1.0e-22
AXE08130.1|2281173_2281314_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	77.1	6.5e-09
AXE08131.1|2281352_2281652_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	54.3	3.2e-13
AXE08132.1|2281578_2282004_+	subtilase cytotoxin subunit B-like protein	NA	NA	NA	NA	NA
AXE08133.1|2282382_2282697_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	86.1	4.3e-40
>prophage 6
CP030288	Salmonella enterica subsp. enterica serovar Gaminara str. SA20063285 chromosome, complete genome	4834965	2758747	2763151	4834965		Escherichia_phage(50.0%)	6	NA	NA
AXE08612.1|2758747_2758987_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
AXE10604.1|2759859_2760669_+	cytolethal distending toxin subunit B family protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AXE08613.1|2760741_2761119_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AXE08614.1|2761266_2761809_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AXE08615.1|2761992_2762721_-	pertussis toxin-like subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.5	1.6e-61
AXE08616.1|2762737_2763151_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	37.7	7.1e-19
>prophage 7
CP030288	Salmonella enterica subsp. enterica serovar Gaminara str. SA20063285 chromosome, complete genome	4834965	2924856	3008218	4834965	tRNA,head,holin,terminase,portal,tail,protease,capsid	Salmonella_phage(35.71%)	93	NA	NA
AXE08780.1|2924856_2925516_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AXE08781.1|2925602_2925932_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
AXE08782.1|2925928_2926210_-	acylphosphatase	NA	NA	NA	NA	NA
AXE08783.1|2926258_2927038_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXE08784.1|2927063_2927612_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AXE08785.1|2927826_2929038_+	ribosomal RNA large subunit methyltransferase I	NA	NA	NA	NA	NA
AXE08786.1|2929095_2929413_+	heat-shock protein HspQ	NA	NA	NA	NA	NA
AXE08787.1|2929457_2929874_-	CoA-binding protein	NA	NA	NA	NA	NA
AXE08788.1|2930044_2930707_+	DUF2057 family protein	NA	NA	NA	NA	NA
AXE08789.1|2930801_2931260_+	methylglyoxal synthase	NA	NA	NA	NA	NA
AXE08790.1|2931295_2933350_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.3	2.5e-19
AXE08791.1|2933473_2933920_+	YccF domain-containing protein	NA	NA	NA	NA	NA
AXE08792.1|2933938_2936092_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
AXE08793.1|2936078_2936684_-	DNA transformation protein	NA	NA	NA	NA	NA
AXE08794.1|2936900_2937410_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
AXE08795.1|2937766_2938819_+	porin OmpA	NA	NA	NA	NA	NA
AXE08796.1|2938890_2939343_-	macrodomain Ter protein	NA	NA	NA	NA	NA
AXE08797.1|2939528_2941289_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
AXE08798.1|2941357_2941876_+	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
AXE08799.1|2941975_2942143_-	ribosome modulation factor	NA	NA	NA	NA	NA
AXE08800.1|2942398_2942962_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
AXE08801.1|2942958_2944599_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
AXE08802.1|2944603_2945857_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
AXE08803.1|2945871_2947779_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	9.2e-53
AXE08804.1|2947791_2949900_-	ribosomal RNA large subunit methyltransferase K/L	NA	NA	NA	NA	NA
AXE08805.1|2949998_2951108_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
AXE08806.1|2951104_2951647_-	cell division protein ZapC	NA	NA	NA	NA	NA
AXE08807.1|2951813_2952824_-	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AXE08808.1|2953031_2955644_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	3.7e-20
AXE08809.1|2956070_2956295_+	DinI family protein	NA	K7PKM2	Enterobacterial_phage	89.2	1.1e-29
AXE08810.1|2956832_2957633_+	hypothetical protein	NA	NA	NA	NA	NA
AXE08811.1|2958882_2959302_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	59.7	2.5e-35
AXE08812.1|2959473_2960031_-	DNA-invertase	NA	A0A1S6L009	Salmonella_phage	89.1	1.0e-89
AXE08813.1|2960060_2961311_+|tail	phage tail protein	tail	A0A1B0VFW4	Salmonella_phage	65.9	6.5e-148
AXE08814.1|2961325_2961844_+|tail	tail assembly chaperone	tail	A0A1B0VCD0	Salmonella_phage	61.6	5.6e-45
AXE08815.1|2961847_2962381_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	74.7	5.5e-72
AXE08816.1|2962382_2965019_-	shikimate transporter	NA	Q6K1H2	Salmonella_virus	62.4	1.4e-131
AXE08817.1|2965072_2965315_-	hypothetical protein	NA	NA	NA	NA	NA
AXE08818.1|2965353_2968716_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	80.4	0.0e+00
AXE08819.1|2968778_2969426_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	78.6	7.1e-90
AXE08820.1|2969323_2970061_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	8.8e-129
AXE08821.1|2970067_2970766_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	75.4	6.0e-103
AXE08822.1|2970775_2971105_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	71.3	7.3e-43
AXE08823.1|2971107_2974203_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	61.6	1.8e-276
AXE08824.1|2974174_2974513_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
AXE08825.1|2974509_2974905_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	1.7e-30
AXE08826.1|2974955_2975702_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.5	2.8e-98
AXE08827.1|2975709_2976111_-|tail	phage tail protein	tail	Q9G0F3	Phage_Gifsy-1	99.0	5.2e-51
AXE08828.1|2976107_2976686_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	79.2	3.2e-81
AXE08829.1|2976672_2977050_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	1.5e-28
AXE08830.1|2977060_2977420_-	DNA packaging protein	NA	NA	NA	NA	NA
AXE08831.1|2977477_2978506_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.8	6.6e-114
AXE08832.1|2978560_2978908_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
AXE08833.1|2978920_2980417_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.4	5.6e-98
AXE08834.1|2980406_2981987_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
AXE08835.1|2981983_2982187_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
AXE08836.1|2982170_2984102_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	5.7e-260
AXE08837.1|2984073_2984619_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
AXE08838.1|2985026_2985476_-	hypothetical protein	NA	NA	NA	NA	NA
AXE08839.1|2985543_2986047_-	hypothetical protein	NA	NA	NA	NA	NA
AXE08840.1|2986149_2986692_-	DUF2514 family protein	NA	NA	NA	NA	NA
AXE08841.1|2986688_2987303_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	94.1	2.9e-109
AXE08842.1|2987302_2987584_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AXE08843.1|2987570_2987960_-	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	71.8	8.1e-41
AXE08844.1|2988046_2988235_-	hypothetical protein	NA	NA	NA	NA	NA
AXE08845.1|2988741_2989305_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
AXE08846.1|2989395_2989581_-	hypothetical protein	NA	NA	NA	NA	NA
AXE08847.1|2989577_2990255_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
AXE08848.1|2990251_2990392_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
AXE08849.1|2990388_2991000_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
AXE08850.1|2991002_2991209_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	98.5	4.6e-35
AXE08851.1|2991208_2991811_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AXE08852.1|2991845_2992094_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
AXE08853.1|2992210_2992444_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
AXE08854.1|2992686_2993319_-	hypothetical protein	NA	NA	NA	NA	NA
AXE08855.1|2993426_2994125_-	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	85.7	2.1e-63
AXE08856.1|2994138_2994834_-	phage replication protein	NA	G8C7U6	Escherichia_phage	45.9	3.2e-56
AXE08857.1|2994830_2995691_-	replication protein	NA	K7PGT1	Enterobacteria_phage	48.5	1.5e-47
AXE08858.1|2995782_2996157_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	3.3e-63
AXE08859.1|2996122_2996350_-	Rha family transcriptional regulator	NA	K7PKS2	Enterobacteria_phage	95.9	1.5e-34
AXE08860.1|2996363_2996831_+	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	86.5	4.2e-68
AXE08861.1|2996873_2997299_+	hypothetical protein	NA	NA	NA	NA	NA
AXE08862.1|2997300_2997735_+	hypothetical protein	NA	NA	NA	NA	NA
AXE08863.1|2997761_2997968_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	69.1	9.6e-17
AXE08864.1|2998366_2998525_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
AXE08865.1|2998546_2998897_+	DNA breaking-rejoining protein	NA	S4TSN6	Salmonella_phage	95.7	5.4e-60
AXE08866.1|2999023_3002224_+	DNA breaking-rejoining protein	NA	S4TNL0	Salmonella_phage	78.0	0.0e+00
AXE08867.1|3002186_3003344_+	enterohemolysin	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
AXE08868.1|3003386_3003626_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
AXE08869.1|3003666_3003915_+	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AXE08870.1|3003959_3005252_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	100.0	3.4e-253
AXE08871.1|3005446_3006649_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AXE08872.1|3006817_3008218_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.8	4.5e-81
>prophage 8
CP030288	Salmonella enterica subsp. enterica serovar Gaminara str. SA20063285 chromosome, complete genome	4834965	3268704	3328786	4834965	tRNA,holin,integrase,terminase,plate,portal,tail,lysis,capsid	Enterobacteria_phage(62.86%)	66	3268479:3268502	3302265:3302288
3268479:3268502	attL	AAAAAGGAGCCTTACGGCTCCTTT	NA	NA	NA	NA
AXE09097.1|3268704_3268845_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	73.9	8.2e-12
AXE09098.1|3269078_3269339_-	hypothetical protein	NA	NA	NA	NA	NA
AXE09099.1|3269384_3270530_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	73.5	8.3e-150
AXE09100.1|3270688_3271876_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	81.7	4.8e-185
AXE09101.1|3271876_3272389_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	68.0	7.6e-63
AXE09102.1|3272431_3272788_+|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	52.6	3.4e-17
AXE09103.1|3272793_3272952_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	79.6	2.4e-15
AXE09104.1|3272938_3275899_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	51.2	8.7e-252
AXE09105.1|3275912_3276401_+	oxidoreductase	NA	A0A0A7NV65	Enterobacteria_phage	78.9	5.6e-71
AXE09106.1|3276683_3277826_+	lipopolysaccharide N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
AXE09107.1|3277866_3278442_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	84.2	1.6e-88
AXE09108.1|3278431_3278752_-	hypothetical protein	NA	A0A0M4QWS3	Salmonella_phage	82.1	1.1e-46
AXE09109.1|3279252_3280956_-|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	53.7	8.3e-130
AXE09110.1|3280961_3281489_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	61.2	1.4e-56
AXE09111.1|3281481_3282378_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	69.5	6.8e-107
AXE09112.1|3282364_3282733_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	71.3	2.9e-40
AXE09113.1|3282729_3283320_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	70.2	4.4e-70
AXE09114.1|3283316_3283952_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	60.2	2.3e-64
AXE09115.1|3283948_3284425_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	50.3	7.1e-39
AXE09116.1|3284411_3284903_-|lysis	lysis protein	lysis	A0A2L1IV55	Escherichia_phage	43.1	6.9e-21
AXE09117.1|3284909_3285353_-	lysozyme	NA	A0A075B8L0	Enterobacteria_phage	63.9	1.6e-45
AXE09118.1|3285349_3285727_-|holin	phage holin, lambda family	holin	NA	NA	NA	NA
AXE09119.1|3285717_3285918_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	80.0	1.3e-21
AXE09120.1|3285917_3286412_-|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	59.5	3.8e-51
AXE09121.1|3286513_3287344_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	65.8	6.3e-91
AXE09122.1|3287390_3288476_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	68.7	7.6e-137
AXE09123.1|3288499_3289336_-|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.5	1.3e-99
AXE09124.1|3289492_3291226_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	74.8	4.9e-263
AXE09125.1|3291225_3292275_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	73.4	4.3e-153
AXE10620.1|3292524_3292719_+	hypothetical protein	NA	NA	NA	NA	NA
AXE09126.1|3293114_3293525_-	hypothetical protein	NA	NA	NA	NA	NA
AXE10621.1|3293517_3295956_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	49.2	3.5e-174
AXE09127.1|3296196_3297144_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	49.5	2.6e-64
AXE09128.1|3297140_3297419_-	hypothetical protein	NA	NA	NA	NA	NA
AXE09129.1|3297415_3297946_-	hypothetical protein	NA	NA	NA	NA	NA
AXE09130.1|3297933_3298191_-	hypothetical protein	NA	NA	NA	NA	NA
AXE09131.1|3298187_3298628_-	hypothetical protein	NA	NA	NA	NA	NA
AXE09132.1|3298864_3299068_-	LapA family protein	NA	NA	NA	NA	NA
AXE09133.1|3299073_3299316_-	hypothetical protein	NA	NA	NA	NA	NA
AXE09134.1|3299388_3299775_-	hypothetical protein	NA	NA	NA	NA	NA
AXE09135.1|3299787_3300003_-	hypothetical protein	NA	NA	NA	NA	NA
AXE09136.1|3300225_3300540_-	hypothetical protein	NA	NA	NA	NA	NA
AXE09137.1|3300821_3301178_+	transcriptional regulator	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	45.3	6.3e-16
AXE09138.1|3301183_3302158_+|integrase	integrase	integrase	Q83VS6	Escherichia_phage	50.2	4.6e-85
AXE09139.1|3302305_3303946_-	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
3302265:3302288	attR	AAAAAGGAGCCTTACGGCTCCTTT	NA	NA	NA	NA
AXE09140.1|3303970_3304513_-	replication initiation regulator SeqA	NA	NA	NA	NA	NA
AXE09141.1|3304697_3305468_+	esterase	NA	NA	NA	NA	NA
AXE09142.1|3305601_3305895_+	LexA regulated protein	NA	NA	NA	NA	NA
AXE09143.1|3306045_3306576_+	flavodoxin-1	NA	NA	NA	NA	NA
AXE09144.1|3306857_3307310_+	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
AXE09145.1|3307424_3308351_+	tricarballylate utilization LysR family transcriptional regulator TcuR	NA	NA	NA	NA	NA
AXE09146.1|3308448_3309852_+	FAD-dependent tricarballylate dehydrogenase TcuA	NA	A0A2P0ZL82	Lactobacillus_phage	26.2	7.8e-09
AXE09147.1|3309838_3310978_+	tricarballylate utilization protein TcuB	NA	NA	NA	NA	NA
AXE09148.1|3311028_3312333_+	tricarballylate/proton symporter TcuC	NA	Q6JIH2	Burkholderia_virus	35.1	5.3e-60
AXE09149.1|3312381_3312714_-	lipoprotein	NA	NA	NA	NA	NA
AXE09150.1|3312763_3314170_-	chitoporin	NA	NA	NA	NA	NA
AXE09151.1|3314297_3314483_-	hypothetical protein	NA	NA	NA	NA	NA
AXE09152.1|3314830_3316498_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	96.0	0.0e+00
AXE09153.1|3316708_3318661_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	2.9e-09
AXE09154.1|3318987_3319788_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
AXE09155.1|3319847_3321002_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
AXE09156.1|3321006_3322227_+	ROK family transcriptional regulator	NA	NA	NA	NA	NA
AXE09157.1|3322273_3323026_+	HAD-IIA family hydrolase	NA	NA	NA	NA	NA
AXE09158.1|3323315_3324980_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.0	4.7e-85
AXE09159.1|3326042_3327218_-	2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase	NA	NA	NA	NA	NA
AXE09160.1|3327361_3328786_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
>prophage 9
CP030288	Salmonella enterica subsp. enterica serovar Gaminara str. SA20063285 chromosome, complete genome	4834965	4185632	4252163	4834965	lysis,holin,integrase,terminase,plate,portal,tail,protease,capsid	Enterobacteria_phage(69.44%)	74	4216680:4216697	4227276:4227293
AXE09916.1|4185632_4186985_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
AXE09917.1|4187080_4187632_+	ribosome-associated protein	NA	NA	NA	NA	NA
AXE09918.1|4187687_4188572_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
AXE09919.1|4188624_4189440_-	inosose isomerase	NA	NA	NA	NA	NA
AXE09920.1|4189600_4190827_-	MFS transporter	NA	NA	NA	NA	NA
AXE09921.1|4190899_4191922_-	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
AXE09922.1|4192102_4194043_-	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	NA	NA	NA	NA
AXE09923.1|4194459_4196397_+	5-dehydro-2-deoxygluconokinase	NA	NA	NA	NA	NA
AXE09924.1|4196457_4197624_+	MFS transporter	NA	NA	NA	NA	NA
AXE09925.1|4197620_4198454_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
AXE09926.1|4198454_4199798_-	lysosomal glucosyl ceramidase	NA	NA	NA	NA	NA
AXE09927.1|4199895_4200906_-	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
AXE09928.1|4200924_4201845_-	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
AXE09929.1|4202104_4202929_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AXE09930.1|4203051_4203354_+	hypothetical protein	NA	NA	NA	NA	NA
AXE09931.1|4203369_4204875_+	methylmalonate-semialdehyde dehydrogenase (CoA acylating)	NA	NA	NA	NA	NA
AXE09932.1|4204899_4205709_+	5-deoxy-glucuronate isomerase	NA	NA	NA	NA	NA
AXE09933.1|4206061_4207498_-	MFS transporter	NA	NA	NA	NA	NA
AXE09934.1|4207534_4207729_+	hypothetical protein	NA	NA	NA	NA	NA
AXE09935.1|4207956_4209390_+	MFS transporter	NA	NA	NA	NA	NA
AXE09936.1|4209440_4210274_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AXE09937.1|4210453_4210768_+	hypothetical protein	NA	NA	NA	NA	NA
AXE09938.1|4210764_4212144_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
AXE09939.1|4212318_4213317_+	fructose 1,6-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.4	1.3e-69
AXE09940.1|4213543_4214074_+	inorganic pyrophosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	4.2e-56
AXE09941.1|4214483_4215647_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AXE09942.1|4215643_4216852_+	MFS transporter	NA	NA	NA	NA	NA
4216680:4216697	attL	ATGGCATCGGCGCTGGCG	NA	NA	NA	NA
AXE09943.1|4216976_4217984_-|integrase	integrase	integrase	A0A0A7NQ69	Enterobacteria_phage	75.0	1.1e-145
AXE09944.1|4218047_4218350_-	XRE family transcriptional regulator	NA	A0A0A7NPW3	Enterobacteria_phage	59.8	2.8e-25
AXE09945.1|4218458_4218866_+	hypothetical protein	NA	A0A0A7NPS5	Enterobacteria_phage	61.7	4.2e-40
AXE09946.1|4218977_4219376_+	hypothetical protein	NA	NA	NA	NA	NA
AXE09947.1|4219446_4219635_+	hypothetical protein	NA	NA	NA	NA	NA
AXE09948.1|4219975_4220218_+	hypothetical protein	NA	NA	NA	NA	NA
AXE09949.1|4220223_4220427_+	LapA family protein	NA	NA	NA	NA	NA
AXE09950.1|4220663_4221104_+	hypothetical protein	NA	NA	NA	NA	NA
AXE09951.1|4221100_4221358_+	hypothetical protein	NA	NA	NA	NA	NA
AXE09952.1|4221345_4221879_+	hypothetical protein	NA	NA	NA	NA	NA
AXE09953.1|4221875_4222115_+	hypothetical protein	NA	NA	NA	NA	NA
AXE09954.1|4222111_4223095_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1B2IE38	Erwinia_phage	43.9	2.7e-56
AXE09955.1|4223094_4223403_+	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	63.2	3.2e-24
AXE09956.1|4223399_4223933_+	AsnC family protein	NA	A0A2I7RQG9	Vibrio_phage	40.7	3.0e-09
AXE09957.1|4223929_4224949_+	DNA cytosine methyltransferase	NA	A0A0M3ULA1	Salmonella_phage	66.4	1.7e-125
AXE09958.1|4224945_4227450_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	47.3	3.5e-177
4227276:4227293	attR	CGCCAGCGCCGATGCCAT	NA	NA	NA	NA
AXE09959.1|4227442_4227853_+	hypothetical protein	NA	NA	NA	NA	NA
AXE10658.1|4228248_4228443_-	hypothetical protein	NA	NA	NA	NA	NA
AXE09960.1|4228692_4229742_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	74.0	1.9e-153
AXE09961.1|4229741_4231475_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	74.6	1.2e-261
AXE09962.1|4231631_4232468_+|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.5	5.7e-100
AXE09963.1|4232491_4233577_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	68.4	7.6e-137
AXE09964.1|4233623_4234454_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	65.5	1.4e-90
AXE09965.1|4234555_4235050_+|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	60.1	2.2e-51
AXE09966.1|4235049_4235250_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	80.3	1.9e-22
AXE09967.1|4235279_4235618_+|holin	phage holin, lambda family	holin	NA	NA	NA	NA
AXE09968.1|4235614_4236058_+	lysozyme	NA	A0A075B8L0	Enterobacteria_phage	63.2	8.1e-45
AXE09969.1|4236064_4236556_+|lysis	lysis protein	lysis	S4TNN7	Salmonella_phage	56.8	5.5e-34
AXE09970.1|4236542_4237019_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	50.3	1.4e-39
AXE09971.1|4237015_4237651_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	59.8	3.5e-65
AXE09972.1|4237647_4238238_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	68.6	8.2e-69
AXE09973.1|4238234_4238603_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	71.3	6.5e-40
AXE09974.1|4238589_4239486_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	69.1	1.2e-106
AXE09975.1|4239478_4240006_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	62.5	2.2e-57
AXE09976.1|4240011_4241883_+|tail	phage tail protein	tail	A0A1B0VFW4	Salmonella_phage	71.1	6.1e-158
AXE09977.1|4241852_4242470_+|tail	tail fiber assembly protein	tail	A0A1S6KZY8	Salmonella_phage	86.7	1.4e-98
AXE09978.1|4242473_4243007_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	83.1	2.5e-80
AXE09979.1|4244300_4244789_-	oxidoreductase	NA	A0A0A7NV65	Enterobacteria_phage	79.5	1.5e-71
AXE09980.1|4244802_4247763_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	51.8	9.0e-257
AXE09981.1|4247749_4247908_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	79.6	2.4e-15
AXE09982.1|4247913_4248270_-|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	52.6	3.4e-17
AXE09983.1|4248312_4248825_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	68.0	7.6e-63
AXE09984.1|4248825_4250013_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	81.7	3.7e-185
AXE09985.1|4250171_4251302_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	74.2	5.7e-151
AXE09986.1|4251347_4251620_+	hypothetical protein	NA	NA	NA	NA	NA
AXE09987.1|4251620_4251878_+	hypothetical protein	NA	NA	NA	NA	NA
AXE09988.1|4252022_4252163_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	67.4	3.8e-09
