The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	0	5150	4751278	tRNA	Catovirus(25.0%)	6	NA	NA
AVG28700.1|62_1580_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.1	4.8e-89
AVG28701.1|1655_2201_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
AVG28702.1|2251_2440_-	hypothetical protein	NA	NA	NA	NA	NA
AVG28703.1|2465_3224_+	endopeptidase	NA	I2E8W3	Clostridium_phage	39.5	1.2e-11
AVG28704.1|3541_4645_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	57.3	7.3e-119
AVG33082.1|4799_5150_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	51.9	6.2e-24
>prophage 2
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	15693	16230	4751278		Enterobacteria_phage(100.0%)	1	NA	NA
AVG28716.1|15693_16230_+	porin family protein	NA	A5LH44	Enterobacteria_phage	30.2	9.6e-16
>prophage 3
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	30984	33518	4751278		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
AVG28733.1|30984_31746_+	2-deoxy-D-gluconate 3-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	1.5e-17
AVG28734.1|32099_33518_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.5	6.0e-25
>prophage 4
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	44349	51304	4751278		Moraxella_phage(33.33%)	6	NA	NA
AVG28744.1|44349_45063_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	6.9e-46
AVG28745.1|45244_45940_-	DNA mismatch repair protein MutH	NA	NA	NA	NA	NA
AVG28746.1|46622_47153_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AVG28747.1|47165_49412_+	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	25.1	1.3e-10
AVG28748.1|49627_50503_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AVG28749.1|50509_51304_+	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	63.2	2.6e-118
>prophage 5
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	56786	73364	4751278	tRNA	Klosneuvirus(16.67%)	10	NA	NA
AVG28756.1|56786_59675_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	23.9	1.1e-62
AVG28757.1|59667_63213_+	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	22.1	1.8e-09
AVG28758.1|63209_65045_+	exodeoxyribonuclease V subunit alpha	NA	A0A2P0VMS9	Tetraselmis_virus	25.2	2.4e-18
AVG28759.1|65146_66478_-	N-acetylglutamate synthase	NA	NA	NA	NA	NA
AVG28760.1|66710_67964_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.9	1.9e-14
AVG28761.1|68463_69561_+	murein transglycosylase A	NA	NA	NA	NA	NA
AVG28762.1|69670_70477_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.8	5.0e-16
AVG33085.1|70528_71416_-	EamA family transporter RarD	NA	NA	NA	NA	NA
AVG28763.1|71715_72159_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
AVG28764.1|72158_73364_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.0	1.2e-71
>prophage 6
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	84907	85723	4751278		Bacillus_phage(100.0%)	1	NA	NA
AVG28776.1|84907_85723_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	31.2	9.2e-10
>prophage 7
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	90590	91439	4751278		Vibrio_phage(100.0%)	1	NA	NA
AVG28780.1|90590_91439_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	2.7e-41
>prophage 8
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	98858	104154	4751278		Streptococcus_phage(33.33%)	3	NA	NA
AVG28788.1|98858_100001_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.0	2.0e-47
AVG28789.1|100044_102801_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.6	2.3e-52
AVG28790.1|102858_104154_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	28.0	3.7e-37
>prophage 9
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	117573	121399	4751278		Only_Syngen_Nebraska_virus(33.33%)	3	NA	NA
AVG28804.1|117573_119211_+	CTP synthetase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.0	1.2e-154
AVG28805.1|119293_120592_+	enolase	NA	A0A1X9I5Z8	Streptococcus_phage	58.6	1.3e-130
AVG28806.1|120727_121399_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	24.6	3.9e-14
>prophage 10
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	142971	145003	4751278		Hokovirus(50.0%)	2	NA	NA
AVG28824.1|142971_144411_+	sulfate adenylyltransferase	NA	A0A1V0SGC3	Hokovirus	26.5	4.7e-33
AVG28825.1|144397_145003_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	39.6	1.3e-29
>prophage 11
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	148113	158541	4751278		Escherichia_phage(50.0%)	12	NA	NA
AVG28831.1|148113_148875_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.4	1.9e-57
AVG28832.1|148868_149495_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.4	4.8e-35
AVG28833.1|149670_150804_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	5.0e-06
AVG28834.1|150866_151859_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
AVG28835.1|151904_152141_-	hypothetical protein	NA	NA	NA	NA	NA
AVG28836.1|152151_153579_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
AVG28837.1|153578_154172_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
AVG28838.1|154342_154747_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AVG28839.1|154765_155530_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.5	5.1e-71
AVG28840.1|155726_156650_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	77.4	1.7e-116
AVG28841.1|156643_157906_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.5	2.5e-131
AVG28842.1|157902_158541_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	4.0e-85
>prophage 12
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	164507	168583	4751278		Catovirus(50.0%)	3	NA	NA
AVG28849.1|164507_167075_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	21.2	1.9e-29
AVG28850.1|167233_167755_+	cytoplasmic protein	NA	NA	NA	NA	NA
AVG28851.1|167926_168583_-	Serine/threonine-protein phosphatase 2	NA	Q71TJ1	Escherichia_phage	47.9	7.8e-52
>prophage 13
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	174159	175848	4751278		Vibrio_phage(100.0%)	1	NA	NA
AVG28858.1|174159_175848_+	type III secretion system outer membrane ring protein InvG	NA	R9TEZ5	Vibrio_phage	27.8	1.8e-15
>prophage 14
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	209341	210163	4751278		Brazilian_cedratvirus(100.0%)	1	NA	NA
AVG28894.1|209341_210163_-	manganese/iron ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.5	3.1e-13
>prophage 15
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	234079	235045	4751278		Tetraselmis_virus(100.0%)	1	NA	NA
AVG28919.1|234079_235045_-	arabinose 5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	34.5	3.0e-36
>prophage 16
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	240951	248458	4751278	tRNA	Pseudomonas_phage(20.0%)	8	NA	NA
AVG33091.1|240951_241449_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	51.6	4.4e-31
AVG28928.1|241533_242595_+	DNA recombination/repair protein RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.8	3.0e-114
AVG28929.1|242711_243212_+	regulatory protein RecX	NA	NA	NA	NA	NA
AVG28930.1|243208_243415_+	hypothetical protein	NA	NA	NA	NA	NA
AVG28931.1|243447_246078_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.3	3.5e-79
AVG28932.1|246312_246498_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
AVG28933.1|246510_246786_-	hypothetical protein	NA	NA	NA	NA	NA
AVG28934.1|247891_248458_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	27.6	7.2e-14
>prophage 17
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	260294	265348	4751278		Bacillus_virus(33.33%)	3	NA	NA
AVG28945.1|260294_261497_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.8	1.4e-27
AVG28946.1|261851_262811_-	ribonucleoside-diphosphate reductase 2 subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.8	4.7e-130
AVG28947.1|264937_265348_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	41.8	4.3e-16
>prophage 18
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	271846	275850	4751278		Clostridium_phage(50.0%)	4	NA	NA
AVG28960.1|271846_272296_+	peptidoglycan-binding protein LysM	NA	A0A090DBR9	Clostridium_phage	38.2	7.5e-06
AVG28961.1|272317_272995_-	transcriptional regulator	NA	NA	NA	NA	NA
AVG28962.1|273036_274437_-	GABA permease	NA	NA	NA	NA	NA
AVG28963.1|274566_275850_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	31.1	6.0e-32
>prophage 19
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	296221	306770	4751278	transposase	Bacillus_phage(33.33%)	6	NA	NA
AVG28981.1|296221_299878_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.0	8.8e-44
AVG28982.1|299958_301074_-	glycosyl transferase	NA	NA	NA	NA	NA
AVG28983.1|302046_302610_-	DNA-invertase Hin	NA	A0A0A7NPV4	Enterobacteria_phage	72.1	1.9e-67
AVG28984.1|302701_304222_+	flagellin FliC	NA	NA	NA	NA	NA
AVG28985.1|304289_304829_+	phase 1 flagellin gene repressor	NA	NA	NA	NA	NA
AVG28986.1|305607_306770_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.9	5.2e-51
>prophage 20
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	311379	311976	4751278	integrase	Escherichia_phage(100.0%)	1	308580:308593	313587:313600
308580:308593	attL	CTAATATAAATAAT	NA	NA	NA	NA
AVG28989.1|311379_311976_-|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	91.3	2.6e-99
AVG28989.1|311379_311976_-|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	91.3	2.6e-99
313587:313600	attR	CTAATATAAATAAT	NA	NA	NA	NA
>prophage 21
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	328342	328627	4751278		Vibrio_phage(100.0%)	1	NA	NA
AVG29003.1|328342_328627_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.7	5.4e-18
>prophage 22
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	331879	333949	4751278		Pseudomonas_phage(100.0%)	1	NA	NA
AVG29006.1|331879_333949_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.1	1.7e-73
>prophage 23
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	341052	343233	4751278		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVG29010.1|341052_343233_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
>prophage 24
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	356793	357276	4751278		Staphylococcus_phage(100.0%)	1	NA	NA
AVG33097.1|356793_357276_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
>prophage 25
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	369043	372285	4751278		Pseudomonas_phage(50.0%)	3	NA	NA
AVG29026.1|369043_370264_-	diguanylate cyclase	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	4.4e-08
AVG29027.1|370256_370775_-	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
AVG29028.1|371214_372285_+	phospho-2-dehydro-3-deoxyheptonate aldolase Tyr-sensitive	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
>prophage 26
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	379070	381644	4751278		Enterobacteria_phage(100.0%)	1	NA	NA
AVG29036.1|379070_381644_+	chaperone protein ClpB	NA	H6X3M6	Enterobacteria_phage	35.6	9.0e-128
>prophage 27
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	387524	389385	4751278		Prochlorococcus_phage(50.0%)	2	NA	NA
AVG29038.1|387524_387980_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
AVG29039.1|388083_389385_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	6.9e-44
>prophage 28
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	394686	400857	4751278	tRNA	Achromobacter_phage(25.0%)	7	NA	NA
AVG29044.1|394686_395106_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
AVG29045.1|395309_396347_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AVG29046.1|396462_397152_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
AVG29047.1|397470_397854_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
AVG29048.1|397915_398503_-	cysteine/O-acetylserine efflux protein	NA	NA	NA	NA	NA
AVG33102.1|398605_399505_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVG29049.1|399522_400857_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
>prophage 29
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	406697	414543	4751278		Streptococcus_phage(25.0%)	9	NA	NA
AVG29058.1|406697_408497_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
AVG29059.1|408513_409488_+	S26 family signal peptidase	NA	NA	NA	NA	NA
AVG29060.1|409761_410442_+	ribonuclease 3	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
AVG29061.1|410438_411344_+	GTPase Era	NA	NA	NA	NA	NA
AVG29062.1|411355_412084_+	DNA repair protein RecO	NA	NA	NA	NA	NA
AVG29063.1|412095_412827_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AVG29064.1|412826_413207_+	holo-ACP synthase	NA	NA	NA	NA	NA
AVG29065.1|413318_413579_-	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
AVG29066.1|413616_414543_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
>prophage 30
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	423127	433119	4751278		Bacillus_phage(50.0%)	6	NA	NA
AVG29076.1|423127_427015_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	8.0e-128
AVG29077.1|427709_429095_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	1.9e-15
AVG29078.1|429096_429861_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AVG29079.1|429857_431195_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
AVG29080.1|431271_431610_+	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
AVG29081.1|431658_433119_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
>prophage 31
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	440334	441588	4751278		Aeromonas_phage(100.0%)	1	NA	NA
AVG29086.1|440334_441588_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
>prophage 32
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	449007	459152	4751278	tRNA	Heterosigma_akashiwo_virus(16.67%)	13	NA	NA
AVG29093.1|449007_449886_-	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	6.0e-15
AVG29094.1|450030_450834_-	inositol monophosphatase	NA	NA	NA	NA	NA
AVG29095.1|450952_451684_+|tRNA	tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
AVG29096.1|451843_452338_+	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
AVG29097.1|452518_453733_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	1.2e-34
AVG29098.1|453760_454147_+	iron-sulfur cluster scaffold-like protein	NA	A0A218MKD1	uncultured_virus	78.9	2.4e-53
AVG29099.1|454175_454499_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	4.1e-22
AVG29100.1|454694_455210_+	co-chaperone protein HscB	NA	NA	NA	NA	NA
AVG29101.1|455222_457073_+	molecular chaperone HscA	NA	A0A167RF67	Powai_lake_megavirus	39.1	2.7e-102
AVG29102.1|457074_457410_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AVG29103.1|457421_457622_+	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AVG29104.1|457608_457812_+	hypothetical protein	NA	NA	NA	NA	NA
AVG29105.1|457868_459152_+	peptidase B	NA	Q6GYZ8	Mycoplasma_phage	38.6	5.3e-36
>prophage 33
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	469959	475208	4751278		Escherichia_phage(66.67%)	5	NA	NA
AVG29112.1|469959_472365_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	38.5	6.6e-141
AVG29113.1|472361_472991_+	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	55.9	4.7e-62
AVG29114.1|472983_473793_+	dimethyl sulfoxide reductase	NA	NA	NA	NA	NA
AVG29115.1|473792_474656_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
AVG29116.1|474776_475208_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.1	1.1e-17
>prophage 34
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	501537	510828	4751278		Escherichia_phage(33.33%)	3	NA	NA
AVG29130.1|501537_507690_+	fibronectin-binding autotransporter adhesin ShdA	NA	A0A2L1IV18	Escherichia_phage	24.9	1.5e-24
AVG29131.1|507851_509201_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.6	4.4e-41
AVG29132.1|509361_510828_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	4.0e-88
>prophage 35
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	514032	514224	4751278		Escherichia_phage(100.0%)	1	NA	NA
AVG29135.1|514032_514224_-	DUF2633 domain-containing protein	NA	G9L6F2	Escherichia_phage	84.1	6.4e-23
>prophage 36
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	520686	529278	4751278	protease	Prochlorococcus_phage(20.0%)	10	NA	NA
AVG29140.1|520686_521325_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.1e-30
AVG33106.1|521324_522362_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	41.8	2.9e-69
AVG29141.1|522397_522577_-	hypothetical protein	NA	NA	NA	NA	NA
AVG29142.1|522774_523401_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AVG29143.1|523488_524778_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.6	3.9e-63
AVG29144.1|524848_525574_+	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
AVG29145.1|525600_525960_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	45.6	1.1e-18
AVG29146.1|525999_527463_-|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
AVG29147.1|527670_528738_+	AI-2E family transporter	NA	NA	NA	NA	NA
AVG29148.1|528924_529278_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	40.2	1.3e-13
>prophage 37
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	532616	533330	4751278		Synechococcus_phage(100.0%)	1	NA	NA
AVG29153.1|532616_533330_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	37.5	9.1e-38
>prophage 38
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	551953	552904	4751278		Cyanophage(100.0%)	1	NA	NA
AVG29167.1|551953_552904_-	transaldolase	NA	A0A127KNC6	Cyanophage	30.3	4.8e-10
>prophage 39
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	572523	582075	4751278		Paenibacillus_phage(20.0%)	11	NA	NA
AVG29189.1|572523_573393_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N9SGH1	Paenibacillus_phage	31.9	2.8e-17
AVG29190.1|573494_574031_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AVG29191.1|574017_574467_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
AVG29192.1|574528_575104_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
AVG29193.1|575198_576098_+	iron-dependent peroxidase	NA	S4VVJ7	Pandoravirus	33.3	3.8e-25
AVG29194.1|576335_577127_+	NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	1.5e-17
AVG29195.1|577284_578301_+	thiosulfate-binding protein	NA	NA	NA	NA	NA
AVG29196.1|578300_579134_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
AVG29197.1|579133_580009_+	sulfate ABC transporter permease subunit CysW	NA	NA	NA	NA	NA
AVG29198.1|579998_581096_+	sulfate/thiosulfate import ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	38.5	7.0e-29
AVG29199.1|581163_582075_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.8	1.7e-57
>prophage 40
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	587386	597384	4751278		Hokovirus(25.0%)	9	NA	NA
AVG29207.1|587386_589114_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	31.1	7.4e-17
AVG29208.1|589162_589420_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AVG29209.1|589803_590775_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	7.4e-75
AVG29210.1|591086_591848_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
AVG29211.1|592079_593066_+	cell division protein ZipA	NA	NA	NA	NA	NA
AVG29212.1|593137_595153_+	DNA ligase (NAD(+)) LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.8	3.4e-146
AVG29213.1|595154_595373_+	hypothetical protein	NA	NA	NA	NA	NA
AVG29214.1|595369_596368_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
AVG29215.1|596457_597384_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.4	2.0e-08
>prophage 41
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	618327	620302	4751278	transposase	Saccharomonospora_phage(50.0%)	3	NA	NA
AVG29236.1|618327_618786_+|transposase	IS200/IS605 family transposase IS200F	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
AVG33108.1|618907_618979_-	membrane protein YpdK	NA	NA	NA	NA	NA
AVG29237.1|619381_620302_-	lipid A biosynthesis palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	53.5	1.1e-75
>prophage 42
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	629367	636054	4751278	capsid	Cronobacter_phage(40.0%)	8	NA	NA
AVG29245.1|629367_629595_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	56.1	2.3e-11
AVG29246.1|629612_630473_+	hypothetical protein	NA	NA	NA	NA	NA
AVG29247.1|630495_631500_+|capsid	major capsid protein	capsid	F1BUM2	Cronobacter_phage	48.3	2.9e-82
AVG29248.1|631588_632179_+	Ash-like/host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	49.2	2.6e-22
AVG29249.1|632175_632412_+	hypothetical protein	NA	NA	NA	NA	NA
AVG29250.1|632404_632815_+	hypothetical protein	NA	NA	NA	NA	NA
AVG29251.1|632811_635499_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	34.9	1.7e-113
AVG29252.1|635781_636054_+	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	50.0	3.2e-20
>prophage 43
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	639941	642375	4751278		Enterobacteria_phage(100.0%)	2	NA	NA
AVG33109.1|639941_641123_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	63.8	2.8e-145
AVG29255.1|641433_642375_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	87.8	3.5e-146
>prophage 44
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	651554	652640	4751278		Pandoravirus(100.0%)	1	NA	NA
AVG29264.1|651554_652640_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	5.3e-90
>prophage 45
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	659897	660683	4751278		Campylobacter_virus(50.0%)	2	NA	NA
AVG29273.1|659897_660266_-	hypothetical protein	NA	H6SUH4	Campylobacter_virus	37.9	3.9e-08
AVG29274.1|660434_660683_-	transcriptional regulator	NA	A0A0M4UV99	Ralstonia_phage	58.6	2.3e-17
>prophage 46
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	663690	664827	4751278		Brazilian_cedratvirus(100.0%)	1	NA	NA
AVG29278.1|663690_664827_+	erythronate-4-phosphate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	3.8e-22
>prophage 47
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	671328	672846	4751278		Mollivirus(100.0%)	1	NA	NA
AVG29286.1|671328_672846_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	6.3e-89
>prophage 48
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	684275	685049	4751278		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AVG33110.1|684275_685049_+	histidine/lysine/arginine/ornithine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	29.1	1.7e-10
>prophage 49
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	688777	689797	4751278		Enterobacteria_phage(100.0%)	1	NA	NA
AVG29303.1|688777_689797_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.7	3.2e-20
>prophage 50
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	700605	703891	4751278		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
AVG29314.1|700605_701283_+	sugar phosphatase	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	33.3	9.3e-08
AVG29315.1|701359_703186_+	SLC13 family permease	NA	NA	NA	NA	NA
AVG29316.1|703291_703891_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 51
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	722742	723747	4751278		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
AVG29334.1|722742_723747_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.6	3.2e-28
>prophage 52
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	736314	741323	4751278		Tupanvirus(50.0%)	4	NA	NA
AVG29349.1|736314_738297_-	bifunctional UDP-glucuronic acid oxidase/UDP-4-amino-4-deoxy-L-arabinose formyltransferase	NA	A0A2K9KZK0	Tupanvirus	26.4	1.0e-22
AVG29350.1|738293_739277_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	32.7	1.7e-34
AVG29351.1|739279_740437_-	UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase	NA	A0A2K9L0G1	Tupanvirus	29.3	2.7e-31
AVG29352.1|740717_741323_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	43.8	1.9e-12
>prophage 53
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	744970	746176	4751278		Oenococcus_phage(100.0%)	1	NA	NA
AVG33113.1|744970_746176_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	2.7e-26
>prophage 54
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	755789	762990	4751278		Pseudomonas_phage(50.0%)	6	NA	NA
AVG29365.1|755789_756860_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
AVG29366.1|756975_757854_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVG29367.1|758015_759206_+	MFS transporter	NA	NA	NA	NA	NA
AVG29368.1|759207_759462_-	ferredoxin	NA	G9IAA2	Pseudomonas_phage	74.6	3.1e-25
AVG29369.1|759461_760592_-	ribonucleoside-diphosphate reductase 1 subunit beta	NA	G9IAA3	Pseudomonas_phage	79.4	8.7e-176
AVG29370.1|760704_762990_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.5	6.2e-282
>prophage 55
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	766430	773643	4751278		Oenococcus_phage(33.33%)	4	NA	NA
AVG29374.1|766430_767633_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	36.3	3.5e-58
AVG29375.1|767732_767963_-	hypothetical protein	NA	NA	NA	NA	NA
AVG29376.1|768042_770679_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	30.7	4.3e-93
AVG29377.1|770796_773643_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	26.4	4.1e-41
>prophage 56
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	777809	783627	4751278		Enterobacteria_phage(33.33%)	5	NA	NA
AVG29381.1|777809_778946_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	6.6e-115
AVG29382.1|779060_780113_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
AVG29383.1|780193_781255_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A167R6J9	Powai_lake_megavirus	58.0	1.4e-18
AVG29384.1|781257_781908_+	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
AVG29385.1|781983_783627_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.2	4.4e-11
>prophage 57
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	799659	824209	4751278	tail,holin	Salmonella_phage(33.33%)	22	NA	NA
AVG29404.1|799659_800451_+|tail	phage tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
AVG29405.1|800747_800951_+|tail	phage tail protein	tail	NA	NA	NA	NA
AVG29406.1|801119_803486_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
AVG33116.1|803814_804804_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
AVG29407.1|804818_805187_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
AVG29408.1|805215_806547_-	NTPase	NA	R9TRQ8	Vibrio_phage	28.5	4.6e-19
AVG29409.1|806843_807173_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
AVG29410.1|807765_809007_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
AVG29411.1|809009_809537_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
AVG29412.1|809914_810358_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
AVG29413.1|812581_812872_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
AVG29414.1|812899_813403_+	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
AVG29415.1|813683_815444_-	hypothetical protein	NA	NA	NA	NA	NA
AVG29416.1|815475_815703_-	hypothetical protein	NA	NA	NA	NA	NA
AVG29417.1|815882_816890_+	nucleoid-associated protein	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
AVG29418.1|816917_817538_+	hypothetical protein	NA	NA	NA	NA	NA
AVG29419.1|817646_817931_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
AVG29420.1|818055_819816_-	ATP-dependent helicase	NA	M4Q3N1	Vibrio_phage	41.8	1.4e-100
AVG29421.1|819967_820663_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
AVG29422.1|820690_821881_+	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
AVG29423.1|822271_822616_+	hypothetical protein	NA	NA	NA	NA	NA
AVG29424.1|822619_824209_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.1	7.2e-19
>prophage 58
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	830133	830706	4751278		Clostridioides_phage(100.0%)	1	NA	NA
AVG29430.1|830133_830706_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
>prophage 59
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	840845	841703	4751278		Catovirus(100.0%)	1	NA	NA
AVG29442.1|840845_841703_-	endonuclease	NA	A0A1V0SBL9	Catovirus	28.5	1.3e-22
>prophage 60
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	845819	847811	4751278		Acinetobacter_phage(100.0%)	1	NA	NA
AVG29447.1|845819_847811_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
>prophage 61
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	853250	853919	4751278		Cellulophaga_phage(100.0%)	1	NA	NA
AVG29454.1|853250_853919_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
>prophage 62
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	857878	859399	4751278		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVG29457.1|857878_859399_+	galactose/methyl galactoside import ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
>prophage 63
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	885453	894624	4751278	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AVG29484.1|885453_886401_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
AVG29485.1|886384_887116_+	ABC transporter permease	NA	NA	NA	NA	NA
AVG29486.1|887096_887204_-	hypothetical protein	NA	NA	NA	NA	NA
AVG29487.1|887263_887995_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AVG29488.1|888217_889903_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
AVG29489.1|889899_890619_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AVG29490.1|890665_891133_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AVG29491.1|891189_891720_-	lipoprotein	NA	NA	NA	NA	NA
AVG29492.1|891891_892350_-	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AVG29493.1|892590_894624_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 64
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	911819	914678	4751278		Salmonella_phage(50.0%)	2	NA	NA
AVG29511.1|911819_912866_-	non-LEE encoded effector protein NleB	NA	Q8HAB2	Salmonella_phage	75.8	3.8e-149
AVG33118.1|913316_914678_-	U32 family peptidase	NA	Q6DW11	Phage_TP	95.4	2.3e-207
>prophage 65
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	919102	925714	4751278		Bacillus_phage(66.67%)	4	NA	NA
AVG29515.1|919102_919825_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	6.4e-31
AVG29516.1|919821_921225_-	two-component system sensor histidine kinase BaeA	NA	W8CYF6	Bacillus_phage	28.7	4.7e-30
AVG29517.1|921224_922637_-	MFS transporter	NA	NA	NA	NA	NA
AVG29518.1|922633_925714_-	multidrug resistance protein MdtC	NA	S5VTK5	Leptospira_phage	23.1	1.3e-64
>prophage 66
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	936162	945462	4751278		Catovirus(25.0%)	8	NA	NA
AVG29524.1|936162_936804_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	2.5e-34
AVG29525.1|936894_937476_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	43.2	9.3e-33
AVG29526.1|937514_939371_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
AVG29527.1|939456_941037_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.1e-38
AVG29528.1|941392_941629_-	hypothetical protein	NA	NA	NA	NA	NA
AVG29529.1|941711_942851_+	polysaccharide export protein Wza	NA	NA	NA	NA	NA
AVG29530.1|942856_943306_+	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
AVG29531.1|943302_945462_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.8	3.2e-17
>prophage 67
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	950637	957343	4751278		Acanthocystis_turfacea_Chlorella_virus(25.0%)	6	NA	NA
AVG29538.1|950637_951759_+	GDP-mannose 4,6-dehydratase	NA	M1HXY1	Acanthocystis_turfacea_Chlorella_virus	65.3	6.9e-133
AVG29539.1|951761_952727_+	GDP-L-fucose synthase	NA	M1HWW2	Paramecium_bursaria_Chlorella_virus	50.8	3.5e-85
AVG29540.1|952729_953203_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
AVG29541.1|953199_954423_+	colanic acid biosynthesis glycosyltransferase WcaI	NA	NA	NA	NA	NA
AVG29542.1|954419_955862_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.0	2.5e-50
AVG29543.1|955972_957343_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.1	5.8e-33
>prophage 68
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	962900	974333	4751278		Enterobacteria_phage(33.33%)	11	NA	NA
AVG29548.1|962900_964304_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	6.8e-21
AVG29549.1|964481_965375_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AVG29550.1|965751_966837_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
AVG29551.1|966836_967736_+	NAD(P)-dependent oxidoreductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
AVG33120.1|967783_968662_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
AVG29552.1|968662_969214_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
AVG29553.1|969219_970212_+	protein RfbI	NA	NA	NA	NA	NA
AVG29554.1|970208_970982_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AVG29555.1|970986_972066_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
AVG29556.1|972092_973406_+	LPS biosynthesis protein	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AVG29557.1|973433_974333_+	CDP-abequose synthase	NA	K7QJG5	Escherichia_phage	22.2	2.1e-07
>prophage 69
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	979039	980479	4751278		Hokovirus(100.0%)	1	NA	NA
AVG29562.1|979039_980479_+	mannose-1-phosphate guanylyltransferase RfbM	NA	A0A1V0SH58	Hokovirus	31.1	7.4e-55
>prophage 70
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	983564	986374	4751278		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
AVG29565.1|983564_984971_+	phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.5e-36
AVG29566.1|985207_986374_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	53.2	4.1e-112
>prophage 71
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	993817	994717	4751278		Cellulophaga_phage(100.0%)	1	NA	NA
AVG29575.1|993817_994717_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	100.0	1.7e-12
>prophage 72
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1003380	1008307	4751278		Escherichia_phage(66.67%)	4	NA	NA
AVG29581.1|1003380_1005657_+	thiosulfate reductase	NA	A0A077SK27	Escherichia_phage	27.1	2.9e-37
AVG29582.1|1005671_1006250_+	thiosulfate reductase electron transport protein PhsB	NA	A0A077SL61	Escherichia_phage	38.2	1.8e-23
AVG29583.1|1006246_1007011_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
AVG29584.1|1007134_1008307_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	88.2	2.1e-201
>prophage 73
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1028014	1028809	4751278		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
AVG29609.1|1028014_1028809_+	aquaporin	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	27.2	1.2e-11
>prophage 74
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1042321	1043137	4751278		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
AVG29625.1|1042321_1043137_+	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	25.1	4.5e-09
>prophage 75
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1059401	1074588	4751278		Morganella_phage(20.0%)	18	NA	NA
AVG29639.1|1059401_1059875_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
AVG29640.1|1060522_1060813_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	52.6	2.1e-09
AVG29641.1|1061184_1061982_-	protein MtfA	NA	NA	NA	NA	NA
AVG29642.1|1062242_1062485_+	hypothetical protein	NA	NA	NA	NA	NA
AVG29643.1|1062462_1062624_+	hypothetical protein	NA	NA	NA	NA	NA
AVG29644.1|1062750_1063170_+	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
AVG29645.1|1063172_1064441_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	1.2e-226
AVG29646.1|1064895_1065108_+	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
AVG33126.1|1065118_1065307_+	cold-shock protein	NA	NA	NA	NA	NA
AVG29647.1|1065564_1066761_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	5.1e-110
AVG29648.1|1067411_1067723_+	hypothetical protein	NA	NA	NA	NA	NA
AVG29649.1|1067802_1068498_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	1.6e-07
AVG29650.1|1068571_1070002_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
AVG29651.1|1069982_1070453_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.6e-30
AVG29652.1|1070441_1071362_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AVG29653.1|1071531_1072449_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AVG29654.1|1072465_1072711_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AVG29655.1|1072875_1074588_+	cellulose synthesis regulatory protein	NA	A0A127AWB9	Bacillus_phage	37.4	1.6e-19
>prophage 76
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1102238	1102991	4751278		Bacillus_virus(100.0%)	1	NA	NA
AVG29689.1|1102238_1102991_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.5	3.2e-25
>prophage 77
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1111252	1111918	4751278		Sphingomonas_phage(100.0%)	1	NA	NA
AVG29699.1|1111252_1111918_+	YecA family protein	NA	H9NBT7	Sphingomonas_phage	62.1	1.5e-05
>prophage 78
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1127186	1131328	4751278		Bacillus_thuringiensis_phage(66.67%)	4	NA	NA
AVG29716.1|1127186_1128848_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.8	2.2e-10
AVG29717.1|1129008_1129875_+	chemotaxis protein methyltransferase	NA	NA	NA	NA	NA
AVG29718.1|1129871_1130921_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
AVG29719.1|1130938_1131328_+	two-component system response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.4	2.2e-06
>prophage 79
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1139280	1145840	4751278	tRNA	Tupanvirus(33.33%)	8	NA	NA
AVG29726.1|1139280_1141014_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.4	4.9e-85
AVG29727.1|1141250_1141820_+	VOC family protein	NA	NA	NA	NA	NA
AVG29728.1|1141839_1142586_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AVG29729.1|1142563_1142773_+	hypothetical protein	NA	NA	NA	NA	NA
AVG29730.1|1142821_1143793_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AVG29731.1|1143789_1144533_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.9	4.1e-25
AVG29732.1|1144573_1144969_-	hypothetical protein	NA	NA	NA	NA	NA
AVG29733.1|1145021_1145840_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	81.1	2.6e-57
>prophage 80
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1149861	1157850	4751278		Bacillus_virus(50.0%)	9	NA	NA
AVG29738.1|1149861_1150383_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
AVG29739.1|1150384_1150984_-	hypothetical protein	NA	NA	NA	NA	NA
AVG33128.1|1151211_1151886_+	hypothetical protein	NA	NA	NA	NA	NA
AVG29740.1|1152245_1152857_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AVG29741.1|1152865_1153876_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.9	2.4e-07
AVG29742.1|1153954_1154740_-	zinc ABC transporter permease	NA	NA	NA	NA	NA
AVG29743.1|1154736_1155492_-	Mn2+/Zn2+ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.4	8.5e-18
AVG29744.1|1155555_1156515_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVG29745.1|1156530_1157850_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	2.6e-14
>prophage 81
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1161787	1163263	4751278		Cyanophage(100.0%)	1	NA	NA
AVG29751.1|1161787_1163263_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	2.6e-79
>prophage 82
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1171159	1177423	4751278	integrase	Klebsiella_phage(33.33%)	11	1167090:1167104	1177363:1177377
1167090:1167104	attL	AATGACGTGTGAACG	NA	NA	NA	NA
AVG29759.1|1171159_1171858_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	40.4	2.8e-07
AVG29760.1|1171881_1172538_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AVG29761.1|1172645_1172876_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
AVG29762.1|1173013_1173388_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AVG29763.1|1173388_1174264_+	hypothetical protein	NA	NA	NA	NA	NA
AVG29764.1|1174280_1174634_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AVG33130.1|1174691_1174811_+	hypothetical protein	NA	NA	NA	NA	NA
AVG33129.1|1175007_1175862_-|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
AVG33131.1|1175921_1176416_-	RecE	NA	A0A0U2I1R6	Escherichia_phage	67.6	2.0e-20
AVG29765.1|1176605_1176836_+	lytic enzyme	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
AVG29766.1|1176889_1177423_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
1177363:1177377	attR	AATGACGTGTGAACG	NA	NA	NA	NA
>prophage 83
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1181025	1181265	4751278		Salmonella_phage(100.0%)	1	NA	NA
AVG29773.1|1181025_1181265_+	Hin recombinase	NA	S4TTF2	Salmonella_phage	93.3	1.1e-16
>prophage 84
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1184741	1192255	4751278	integrase	Enterobacteria_phage(50.0%)	10	1181838:1181851	1189612:1189625
1181838:1181851	attL	AGCAATAATAATCA	NA	NA	NA	NA
AVG29777.1|1184741_1185110_-|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	39.8	5.4e-18
AVG29778.1|1186573_1186714_-	hypothetical protein	NA	NA	NA	NA	NA
AVG29779.1|1186879_1187149_-	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	39.0	1.5e-06
AVG29780.1|1187195_1187390_+	hypothetical protein	NA	NA	NA	NA	NA
AVG29781.1|1187518_1187938_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVG29782.1|1188324_1188801_-	hypothetical protein	NA	NA	NA	NA	NA
AVG29783.1|1189130_1189526_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.8	9.2e-16
AVG29784.1|1190209_1190932_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
1189612:1189625	attR	AGCAATAATAATCA	NA	NA	NA	NA
AVG29785.1|1191216_1191381_+	hypothetical protein	NA	NA	NA	NA	NA
AVG29786.1|1191604_1192255_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.9	5.5e-58
>prophage 85
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1199761	1201810	4751278	tail,protease	Moraxella_phage(100.0%)	1	NA	NA
AVG29793.1|1199761_1201810_+|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
>prophage 86
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1207187	1207397	4751278		Morganella_phage(100.0%)	1	NA	NA
AVG29801.1|1207187_1207397_+	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 87
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1214883	1216443	4751278		Moraxella_phage(100.0%)	1	NA	NA
AVG29810.1|1214883_1216443_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.4	9.5e-40
>prophage 88
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1220413	1227725	4751278	tRNA	Pandoravirus(33.33%)	8	NA	NA
AVG29814.1|1220413_1221778_-	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	35.0	3.3e-44
AVG29815.1|1221858_1222038_+	YoaH family protein	NA	NA	NA	NA	NA
AVG29816.1|1222043_1222388_-	RidA family protein	NA	NA	NA	NA	NA
AVG29817.1|1222518_1224429_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.7	4.5e-92
AVG29818.1|1224486_1225182_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AVG29819.1|1225253_1225835_+	hypothetical protein	NA	NA	NA	NA	NA
AVG29820.1|1225813_1226020_-	hypothetical protein	NA	NA	NA	NA	NA
AVG33134.1|1226039_1227725_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	3.8e-34
>prophage 89
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1262428	1265186	4751278		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
AVG29856.1|1262428_1264114_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.3	3.9e-23
AVG33136.1|1264238_1265186_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	8.6e-44
>prophage 90
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1268533	1274195	4751278		Pseudomonas_phage(33.33%)	7	NA	NA
AVG29860.1|1268533_1269616_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	8.7e-08
AVG29861.1|1269615_1270449_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AVG29862.1|1270445_1270835_+	protein sirB2	NA	NA	NA	NA	NA
AVG29863.1|1270838_1271648_+	protein sirB1	NA	NA	NA	NA	NA
AVG29864.1|1271685_1272540_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	38.8	1.9e-45
AVG29865.1|1272593_1273694_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
AVG29866.1|1273964_1274195_+	cation transport regulator	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	41.3	1.1e-05
>prophage 91
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1284534	1286070	4751278		Escherichia_phage(100.0%)	1	NA	NA
AVG29873.1|1284534_1286070_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.4	4.8e-20
>prophage 92
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1290540	1296948	4751278		Synechococcus_phage(33.33%)	7	NA	NA
AVG29878.1|1290540_1291383_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	48.8	7.5e-15
AVG29879.1|1291433_1291892_-	hypothetical protein	NA	NA	NA	NA	NA
AVG29880.1|1292002_1292908_+	patatin family protein	NA	NA	NA	NA	NA
AVG29881.1|1292998_1294012_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
AVG29882.1|1294214_1295123_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	47.5	8.2e-60
AVG29883.1|1295254_1295668_-	DNA-binding protein H-NS	NA	NA	NA	NA	NA
AVG29884.1|1296330_1296948_+	thymidine kinase	NA	A0A023W530	Serratia_phage	54.2	2.7e-54
>prophage 93
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1305320	1308213	4751278		Planktothrix_phage(33.33%)	3	NA	NA
AVG29890.1|1305320_1306328_+	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	29.4	5.8e-14
AVG29891.1|1306324_1307329_+	oligopeptide transport ATP-binding protein OppF	NA	G3M9Y6	Bacillus_virus	29.1	8.1e-16
AVG29892.1|1307376_1308213_+	voltage-gated potassium channel	NA	A0A1B0Y2S3	Lactobacillus_phage	42.4	1.0e-08
>prophage 94
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1319874	1322832	4751278		Acinetobacter_phage(100.0%)	2	NA	NA
AVG29907.1|1319874_1321233_-	bifunctional indole-3-glycerol phosphate synthase/phosphoribosylanthranilate isomerase	NA	A0A0P0IR83	Acinetobacter_phage	41.2	2.3e-37
AVG29908.1|1321236_1322832_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.8	4.5e-53
>prophage 95
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1327813	1333152	4751278	protease	Chrysochromulina_ericina_virus(33.33%)	4	NA	NA
AVG29914.1|1327813_1328575_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	22.2	7.5e-06
AVG29915.1|1328812_1329859_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	29.5	1.6e-19
AVG29916.1|1329900_1330152_-	hypothetical protein	NA	NA	NA	NA	NA
AVG29917.1|1330554_1333152_+	DNA topoisomerase 1	NA	A0A2K9L5F8	Tupanvirus	35.4	2.4e-88
>prophage 96
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1338244	1338835	4751278		Staphylococcus_phage(100.0%)	1	NA	NA
AVG29922.1|1338244_1338835_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	2.9e-42
>prophage 97
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1344419	1348598	4751278		Bacillus_virus(50.0%)	3	NA	NA
AVG33141.1|1344419_1346402_-	cyclic di-GMP phosphodiesterase	NA	G3MA91	Bacillus_virus	31.5	2.9e-17
AVG29932.1|1346416_1346638_-	hypothetical protein	NA	NA	NA	NA	NA
AVG29933.1|1346663_1348598_-	exoribonuclease 2	NA	A0A2H4UVB7	Bodo_saltans_virus	23.5	6.5e-06
>prophage 98
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1353975	1354782	4751278		Bacillus_virus(100.0%)	1	NA	NA
AVG29940.1|1353975_1354782_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
>prophage 99
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1373271	1374141	4751278		Staphylococcus_phage(100.0%)	1	NA	NA
AVG29959.1|1373271_1374141_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	43.2	3.0e-51
>prophage 100
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1377692	1378550	4751278		Streptococcus_phage(100.0%)	1	NA	NA
AVG29964.1|1377692_1378550_-	AraC family transcriptional regulator	NA	A0A1B0RXG1	Streptococcus_phage	28.1	2.0e-07
>prophage 101
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1388641	1396688	4751278	tRNA	Streptococcus_phage(20.0%)	11	NA	NA
AVG29976.1|1388641_1389157_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.5	2.3e-22
AVG29977.1|1389414_1389978_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
AVG29978.1|1389958_1390138_+	hypothetical protein	NA	NA	NA	NA	NA
AVG29979.1|1390388_1391543_+	chemoreceptor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.8	1.2e-10
AVG29980.1|1391688_1392672_+	zinc transporter ZntB	NA	NA	NA	NA	NA
AVG29981.1|1392947_1393130_+	hypothetical protein	NA	NA	NA	NA	NA
AVG29982.1|1393158_1394532_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.8e-51
AVG29983.1|1394575_1395511_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
AVG29984.1|1395720_1395873_+	multidrug transporter	NA	NA	NA	NA	NA
AVG29985.1|1395865_1396204_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
AVG29986.1|1396253_1396688_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
>prophage 102
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1401800	1402790	4751278		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AVG29991.1|1401800_1402790_-	2-hydroxyacid dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	42.5	1.2e-69
>prophage 103
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1407582	1412996	4751278		Klosneuvirus(50.0%)	3	NA	NA
AVG33144.1|1407582_1411485_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	28.8	4.2e-52
AVG29997.1|1411548_1412349_+	YdcF family protein	NA	NA	NA	NA	NA
AVG29998.1|1412465_1412996_+	cytochrome B	NA	A0A0U2QLA7	Escherichia_phage	44.9	7.0e-19
>prophage 104
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1416757	1417489	4751278		Planktothrix_phage(100.0%)	1	NA	NA
AVG30002.1|1416757_1417489_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	3.4e-24
>prophage 105
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1424028	1431127	4751278		Synechococcus_phage(33.33%)	6	NA	NA
AVG30009.1|1424028_1425147_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.8	1.5e-31
AVG30010.1|1425101_1425317_-	hypothetical protein	NA	NA	NA	NA	NA
AVG30011.1|1425315_1426941_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.1	8.5e-07
AVG30012.1|1427001_1427925_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVG30013.1|1428226_1429570_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
AVG30014.1|1429618_1431127_+	carboxylesterase/lipase family protein	NA	G5CSV8	Megavirus	38.2	2.1e-31
>prophage 106
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1447236	1449201	4751278	protease	Phage_TP(100.0%)	1	NA	NA
AVG30032.1|1447236_1449201_+|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	26.7	8.6e-22
>prophage 107
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1466808	1468929	4751278		Salmonella_phage(100.0%)	1	NA	NA
AVG30048.1|1466808_1468929_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.6	2.4e-134
>prophage 108
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1476868	1478413	4751278		Escherichia_phage(100.0%)	1	NA	NA
AVG30057.1|1476868_1478413_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	44.6	1.9e-19
>prophage 109
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1486575	1487664	4751278		Enterobacteria_phage(100.0%)	1	NA	NA
AVG30062.1|1486575_1487664_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	75.1	4.0e-154
>prophage 110
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1494030	1495041	4751278		Tupanvirus(100.0%)	1	NA	NA
AVG30069.1|1494030_1495041_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.9	8.6e-26
>prophage 111
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1517710	1517995	4751278		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVG30088.1|1517710_1517995_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	54.8	1.2e-20
>prophage 112
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1537013	1538132	4751278		Enterobacteria_phage(100.0%)	1	NA	NA
AVG30107.1|1537013_1538132_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.6e-113
>prophage 113
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1547018	1547453	4751278		Streptococcus_phage(100.0%)	1	NA	NA
AVG30117.1|1547018_1547453_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.1e-09
>prophage 114
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1556739	1576022	4751278		Escherichia_phage(40.0%)	19	NA	NA
AVG30128.1|1556739_1556943_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	2.9e-13
AVG30129.1|1557009_1558476_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.0	2.5e-42
AVG30130.1|1558619_1559999_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	25.8	5.7e-28
AVG30131.1|1560052_1561072_-	Zn-dependent oxidoreductase	NA	NA	NA	NA	NA
AVG30132.1|1561082_1562297_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.7	1.2e-45
AVG30133.1|1562418_1562745_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	52.9	2.2e-23
AVG30134.1|1562897_1563239_+	hypothetical protein	NA	NA	NA	NA	NA
AVG30135.1|1563274_1563835_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AVG30136.1|1563875_1564586_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
AVG30137.1|1564689_1564998_+	outer membrane protein	NA	NA	NA	NA	NA
AVG30138.1|1565154_1567593_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.3	1.0e-218
AVG30139.1|1567691_1570127_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	47.9	2.8e-203
AVG30140.1|1570137_1570755_+	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	59.6	4.3e-76
AVG30141.1|1570756_1571614_+	dimethylsulfoxide reductase	NA	NA	NA	NA	NA
AVG30142.1|1571656_1572271_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	37.8	1.1e-28
AVG30143.1|1572575_1573286_+	osmoprotectant import permease OsmY	NA	NA	NA	NA	NA
AVG30144.1|1573314_1574217_+	osmoprotectant ABC transporter substrate-binding protein OsmX	NA	NA	NA	NA	NA
AVG30145.1|1574226_1574874_+	osmoprotectant import permease OsmW	NA	NA	NA	NA	NA
AVG30146.1|1574873_1576022_+	osmoprotectant ABC transporter ATP-binding protein OsmV	NA	G9BWD6	Planktothrix_phage	33.9	2.2e-25
>prophage 115
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1593734	1598157	4751278		Enterobacteria_phage(50.0%)	3	NA	NA
AVG30164.1|1593734_1594886_+	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	58.8	1.2e-116
AVG30165.1|1595038_1596745_+	amidohydrolase	NA	NA	NA	NA	NA
AVG30166.1|1596855_1598157_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	22.4	2.2e-13
>prophage 116
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1619804	1621079	4751278	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
AVG30186.1|1619804_1621079_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 117
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1627993	1628515	4751278		Salmonella_phage(100.0%)	1	NA	NA
AVG30195.1|1627993_1628515_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	59.8	1.5e-50
>prophage 118
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1633589	1641013	4751278		Streptococcus_phage(20.0%)	8	NA	NA
AVG30203.1|1633589_1634444_+	peptidoglycan endopeptidase	NA	A0A1S5SEZ8	Streptococcus_phage	41.0	1.2e-15
AVG30204.1|1634570_1635152_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.5	6.9e-44
AVG30205.1|1635234_1635324_-	YnhF family membrane protein	NA	NA	NA	NA	NA
AVG30206.1|1635619_1636645_+	PurR family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	31.6	3.1e-31
AVG30207.1|1636641_1637574_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVG30208.1|1637686_1638892_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
AVG30209.1|1639181_1640330_+	cyclopropane-fatty-acyl-phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.9	2.5e-85
AVG30210.1|1640371_1641013_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	38.3	8.8e-24
>prophage 119
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1664966	1669305	4751278		Ectocarpus_siliculosus_virus(50.0%)	3	NA	NA
AVG30240.1|1664966_1667729_+	hybrid sensor histidine kinase/response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	27.2	6.0e-29
AVG30241.1|1667759_1668398_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AVG30242.1|1668576_1669305_+	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	46.4	9.2e-46
>prophage 120
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1687482	1690692	4751278		environmental_halophage(50.0%)	3	NA	NA
AVG30259.1|1687482_1688703_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	40.8	1.7e-92
AVG30260.1|1688699_1689971_-	signal peptide peptidase SppA	NA	NA	NA	NA	NA
AVG30261.1|1689945_1690692_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.2	2.5e-06
>prophage 121
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1713206	1732835	4751278	tRNA	Tupanvirus(22.22%)	19	NA	NA
AVG30281.1|1713206_1714847_+	cyclohexanecarboxylate-CoA ligase	NA	A0A1V0SBX8	Catovirus	24.1	2.3e-20
AVG30282.1|1714888_1717267_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	5.5e-172
AVG30283.1|1717603_1718437_+	phosphoenolpyruvate synthase regulatory protein	NA	NA	NA	NA	NA
AVG30284.1|1718592_1719639_+	phospho-2-dehydro-3-deoxyheptonate aldolase Trp-sensitive	NA	S4W5F1	Pandoravirus	47.6	9.7e-81
AVG30285.1|1719795_1719987_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
AVG30286.1|1720021_1721464_-	YdiU family protein	NA	NA	NA	NA	NA
AVG30287.1|1721525_1722239_-	anti-FlhDC factor YdiV	NA	NA	NA	NA	NA
AVG30288.1|1722552_1723017_-	lipoprotein	NA	A0A1V0DZX6	Clostridioides_phage	39.4	2.0e-14
AVG30289.1|1723093_1723843_-	vitamin B12 import ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	4.6e-08
AVG30290.1|1723842_1724394_-	glutathione peroxidase	NA	NA	NA	NA	NA
AVG30291.1|1724485_1725466_-	vitamin B12 import system permease BtuC	NA	NA	NA	NA	NA
AVG30292.1|1725668_1725968_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AVG30293.1|1725972_1728360_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AVG30294.1|1728375_1729359_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
AVG33157.1|1729495_1729540_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
AVG30295.1|1729660_1730017_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AVG30296.1|1730067_1730265_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AVG30297.1|1730360_1730903_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.7	4.8e-15
AVG30298.1|1730906_1732835_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.7	4.2e-130
>prophage 122
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1745668	1747921	4751278		Tupanvirus(100.0%)	1	NA	NA
AVG30313.1|1745668_1747921_+	catalase HPII	NA	A0A2K9L0T1	Tupanvirus	49.8	1.7e-143
>prophage 123
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1754088	1754916	4751278		Bacillus_virus(100.0%)	1	NA	NA
AVG30321.1|1754088_1754916_+	NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	5.0e-72
>prophage 124
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1761614	1762841	4751278		Klosneuvirus(100.0%)	1	NA	NA
AVG30329.1|1761614_1762841_-	succinylornithine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	27.8	2.1e-26
>prophage 125
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1766428	1768378	4751278		Streptococcus_phage(100.0%)	1	NA	NA
AVG30335.1|1766428_1768378_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	28.7	3.1e-40
>prophage 126
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1773263	1773920	4751278		Tupanvirus(100.0%)	1	NA	NA
AVG30340.1|1773263_1773920_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	35.2	7.3e-18
>prophage 127
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1783328	1786749	4751278		Bacillus_phage(100.0%)	3	NA	NA
AVG30349.1|1783328_1784615_+	hypothetical protein	NA	A0A140HLI1	Bacillus_phage	36.3	1.3e-10
AVG30350.1|1784764_1784962_-	hypothetical protein	NA	NA	NA	NA	NA
AVG30351.1|1785255_1786749_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	28.3	2.0e-10
>prophage 128
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1807060	1807591	4751278		Escherichia_phage(100.0%)	1	NA	NA
AVG30382.1|1807060_1807591_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	70.5	2.8e-36
>prophage 129
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1812229	1815570	4751278		Enterobacterial_phage(50.0%)	5	NA	NA
AVG30388.1|1812229_1812787_-	virulence membrane protein PagC	NA	Q9LA63	Enterobacterial_phage	33.0	1.0e-15
AVG30389.1|1813597_1813861_+	virulence protein PagD	NA	NA	NA	NA	NA
AVG30390.1|1813992_1814205_+	cold-shock protein CspH	NA	NA	NA	NA	NA
AVG30391.1|1814618_1815140_+	lipoprotein	NA	NA	NA	NA	NA
AVG30392.1|1815330_1815570_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	87.3	1.9e-32
>prophage 130
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1819450	1821355	4751278	transposase	Saccharomonospora_phage(50.0%)	2	NA	NA
AVG30397.1|1819450_1819909_-|transposase	IS200/IS605 family transposase IS200F	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
AVG30398.1|1820104_1821355_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	2.0e-19
>prophage 131
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1824882	1826253	4751278		Bodo_saltans_virus(100.0%)	1	NA	NA
AVG30403.1|1824882_1826253_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.3	8.5e-109
>prophage 132
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1832573	1834557	4751278		Bacillus_virus(50.0%)	2	NA	NA
AVG30409.1|1832573_1833710_+	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.0	2.1e-28
AVG30410.1|1833693_1834557_+	spermidine/putrescine ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	26.2	2.0e-10
>prophage 133
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1838143	1841869	4751278		Vibrio_phage(50.0%)	4	NA	NA
AVG30414.1|1838143_1838965_-	NAD-dependent deacylase	NA	A0A2I7S9Y2	Vibrio_phage	33.5	1.0e-21
AVG30415.1|1838983_1839895_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AVG30416.1|1839923_1841168_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
AVG30417.1|1841167_1841869_-	lipoprotein-releasing system ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.7	2.4e-35
>prophage 134
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1848054	1848312	4751278		Erwinia_phage(100.0%)	1	NA	NA
AVG30421.1|1848054_1848312_-	outer membrane protein	NA	A0A1B2IFR9	Erwinia_phage	37.1	2.1e-05
>prophage 135
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1861472	1862114	4751278		Pseudomonas_phage(100.0%)	1	NA	NA
AVG30434.1|1861472_1862114_-	thymidylate kinase	NA	Q2Z0N0	Pseudomonas_phage	35.7	4.2e-26
>prophage 136
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1865388	1866515	4751278		Ralstonia_phage(50.0%)	2	NA	NA
AVG30438.1|1865388_1865625_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
AVG30439.1|1865780_1866515_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.5	1.7e-15
>prophage 137
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1880330	1881281	4751278		Brevibacillus_phage(100.0%)	1	NA	NA
AVG30452.1|1880330_1881281_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.8	2.2e-10
>prophage 138
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1897292	1897538	4751278		Salmonella_phage(100.0%)	1	NA	NA
AVG30472.1|1897292_1897538_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	51.3	1.5e-13
>prophage 139
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1902197	1903118	4751278		Morganella_phage(100.0%)	1	NA	NA
AVG30480.1|1902197_1903118_+	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	40.5	8.1e-55
>prophage 140
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1912181	1912721	4751278		Scale_drop_disease_virus(100.0%)	1	NA	NA
AVG30487.1|1912181_1912721_-	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	49.0	2.9e-28
>prophage 141
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1916872	1917706	4751278		Pelagibacter_phage(100.0%)	1	NA	NA
AVG30496.1|1916872_1917706_+	curli production assembly/transport component CsgG	NA	M1ICK2	Pelagibacter_phage	40.5	3.3e-39
>prophage 142
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1927412	1931036	4751278		Aeromonas_phage(33.33%)	3	NA	NA
AVG30507.1|1927412_1928909_+	acetylneuraminate ABC transporter	NA	A0A240F3J2	Aeromonas_phage	22.9	1.3e-17
AVG30508.1|1929194_1930076_+	MurR/RpiR family transcriptional regulator	NA	A0A2P0VNK5	Tetraselmis_virus	28.9	3.3e-05
AVG30509.1|1930181_1931036_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	5.9e-92
>prophage 143
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1938980	1939148	4751278		Enterobacteria_phage(100.0%)	1	NA	NA
AVG30515.1|1938980_1939148_-	stress-induced protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
>prophage 144
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1945433	1947675	4751278		Klosneuvirus(50.0%)	4	NA	NA
AVG30523.1|1945433_1946354_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	46.7	3.2e-11
AVG30524.1|1946353_1946659_+	chaperone modulatory protein CbpM	NA	NA	NA	NA	NA
AVG30525.1|1946709_1946865_-	hypothetical protein	NA	NA	NA	NA	NA
AVG30526.1|1947312_1947675_+	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	43.5	2.4e-23
>prophage 145
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	1967491	2057391	4751278	lysis,protease,tail,transposase,terminase,portal,tRNA	Salmonella_phage(46.67%)	106	NA	NA
AVG33165.1|1967491_1967812_-	hypothetical protein	NA	E5G6P3	Salmonella_phage	76.6	1.2e-08
AVG30548.1|1968029_1968905_+	SPI-2 type III secretion system effector PipB	NA	NA	NA	NA	NA
AVG30549.1|1969126_1969807_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
AVG30550.1|1970152_1970362_-	hypothetical protein	NA	NA	NA	NA	NA
AVG30551.1|1970427_1971087_+	transmembrane protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AVG30552.1|1971173_1971503_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
AVG30553.1|1971499_1971781_-	acylphosphatase	NA	NA	NA	NA	NA
AVG30554.1|1971829_1972609_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVG30555.1|1972634_1973183_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
AVG30556.1|1973397_1974609_+	ribosomal RNA large subunit methyltransferase I	NA	NA	NA	NA	NA
AVG30557.1|1974666_1974984_+	heat-shock protein HspQ	NA	NA	NA	NA	NA
AVG30558.1|1975028_1975445_-	CoA-binding protein	NA	NA	NA	NA	NA
AVG30559.1|1975615_1976278_+	DUF2057 domain-containing protein	NA	NA	NA	NA	NA
AVG30560.1|1976372_1976831_+	methylglyoxal synthase	NA	NA	NA	NA	NA
AVG30561.1|1976866_1978921_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
AVG30562.1|1979044_1979491_+	YccF domain-containing protein	NA	NA	NA	NA	NA
AVG30563.1|1979509_1981663_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
AVG30564.1|1981649_1982255_-	DNA transformation protein	NA	NA	NA	NA	NA
AVG30565.1|1982471_1982981_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
AVG33166.1|1983337_1984390_+	outer membrane protein A	NA	NA	NA	NA	NA
AVG30566.1|1984461_1984914_-	macrodomain Ter protein	NA	NA	NA	NA	NA
AVG30567.1|1985099_1986860_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
AVG30568.1|1986928_1987447_+	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
AVG30569.1|1987546_1987714_-	ribosome modulation factor	NA	NA	NA	NA	NA
AVG30570.1|1987969_1988533_-	hypothetical protein	NA	NA	NA	NA	NA
AVG30571.1|1988529_1990170_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
AVG30572.1|1990174_1991428_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
AVG30573.1|1991442_1993350_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
AVG30574.1|1993362_1995471_-	ribosomal RNA large subunit methyltransferase K/L	NA	NA	NA	NA	NA
AVG30575.1|1995569_1996679_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
AVG30576.1|1996675_1997218_-	cell division protein ZapC	NA	NA	NA	NA	NA
AVG30577.1|1997383_1998394_-	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
AVG30578.1|1998601_2001214_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
AVG30579.1|2001648_2002146_+	hypothetical protein	NA	NA	NA	NA	NA
AVG30580.1|2002142_2003363_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AVG30581.1|2003582_2003801_-	Hin recombinase	NA	S4TTF2	Salmonella_phage	89.7	1.7e-24
AVG30582.1|2004013_2004736_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
AVG30583.1|2004932_2005514_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	87.4	1.8e-92
AVG30584.1|2005503_2005824_-	hypothetical protein	NA	A0A0M4QWS3	Salmonella_phage	79.2	4.9e-44
AVG30585.1|2006324_2008700_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	64.9	1.9e-87
AVG30586.1|2008753_2008996_-	hypothetical protein	NA	NA	NA	NA	NA
AVG30587.1|2009034_2009910_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.8	2.6e-50
AVG30588.1|2012456_2013161_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	2.0e-66
AVG30589.1|2013058_2013796_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	75.6	5.2e-113
AVG30590.1|2013805_2014501_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
AVG30591.1|2014590_2015124_+	superoxide dismutase [Cu-Zn] SodC1	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
AVG30592.1|2015213_2015738_-	Ail/OmpX	NA	A0A1B0VBR9	Salmonella_phage	35.3	1.8e-19
AVG30593.1|2015836_2016169_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
AVG33167.1|2016165_2019153_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.0	2.5e-262
AVG30594.1|2019232_2019562_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
AVG30595.1|2019558_2019957_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
AVG30596.1|2020002_2020752_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
AVG30597.1|2020763_2021165_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	2.0e-42
AVG30598.1|2021161_2021728_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	95.7	2.1e-13
AVG30599.1|2021708_2022008_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
AVG30600.1|2022000_2022324_-	recombinase RecA	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
AVG33169.1|2022414_2024493_-	peptidase S14	NA	A0A291AWT6	Escherichia_phage	69.3	2.4e-264
AVG33168.1|2024416_2025934_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.7	7.5e-175
AVG30601.1|2025960_2026167_-	primosomal replication protein PriB/PriC domain protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
AVG30602.1|2026163_2028302_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	6.9e-291
AVG30603.1|2028258_2028792_-	DNA breaking-rejoining protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
AVG33170.1|2029002_2029488_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	80.4	1.1e-58
AVG30604.1|2029804_2030344_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	72.4	2.2e-76
AVG33171.1|2030321_2030624_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AVG30605.1|2030826_2031015_-	hypothetical protein	NA	NA	NA	NA	NA
AVG30606.1|2031069_2031258_+	hypothetical protein	NA	NA	NA	NA	NA
AVG30607.1|2031295_2031514_-	hypothetical protein	NA	NA	NA	NA	NA
AVG30608.1|2031453_2031645_-	hypothetical protein	NA	NA	NA	NA	NA
AVG30609.1|2031680_2032478_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
AVG30610.1|2032467_2032614_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
AVG30611.1|2032610_2033222_-	protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	4.2e-92
AVG30612.1|2033224_2033431_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
AVG30613.1|2033430_2034033_-	hypothetical protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AVG30614.1|2034067_2034316_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
AVG30615.1|2034432_2034666_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
AVG30616.1|2034896_2035541_-	hypothetical protein	NA	NA	NA	NA	NA
AVG30617.1|2035648_2036050_-	hypothetical protein	NA	I6R0R2	Salmonella_phage	82.0	1.2e-18
AVG30618.1|2036060_2036318_-	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	95.3	4.5e-40
AVG30619.1|2036319_2036853_-	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	89.8	8.1e-92
AVG33172.1|2036849_2037251_-	chromosome partitioning protein ParB	NA	S4TTI6	Salmonella_phage	98.5	5.4e-72
AVG30620.1|2037295_2037997_-	Replication protein P	NA	A0A0M3ULE2	Salmonella_phage	99.1	1.9e-128
AVG30621.1|2037993_2038899_-	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	99.7	9.1e-176
AVG30622.1|2038990_2039365_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	1.9e-63
AVG30623.1|2039330_2039567_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	73.1	9.0e-27
AVG30624.1|2039671_2040067_+	transcriptional regulator	NA	K7PM35	Enterobacteria_phage	72.5	3.5e-47
AVG30625.1|2040109_2040535_+	hypothetical protein	NA	NA	NA	NA	NA
AVG30626.1|2040536_2040971_+	hypothetical protein	NA	NA	NA	NA	NA
AVG30627.1|2040997_2041204_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	1.6e-16
AVG30628.1|2041491_2041692_+	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AVG30629.1|2041782_2042079_+	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	100.0	1.1e-48
AVG30630.1|2042084_2042870_+	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	98.8	2.4e-148
AVG30631.1|2042866_2043547_+	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	97.8	3.3e-130
AVG30632.1|2043543_2044413_+	DNA methylase	NA	A0A1C9II58	Salmonella_phage	86.3	7.2e-146
AVG33173.1|2044418_2044658_+	DUF4060 domain-containing protein	NA	S4TR31	Salmonella_phage	98.7	3.3e-37
AVG30633.1|2044698_2044947_+	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AVG30634.1|2044991_2046284_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	100.0	3.4e-253
AVG30635.1|2046478_2047681_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AVG30636.1|2047761_2049195_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
AVG30637.1|2049439_2050654_-	PLP-dependent lyase/thiolase	NA	NA	NA	NA	NA
AVG30638.1|2050740_2050974_+	hypothetical protein	NA	NA	NA	NA	NA
AVG30639.1|2050970_2051432_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
AVG30640.1|2051632_2053033_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
AVG30641.1|2053639_2054731_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
AVG30642.1|2054915_2056106_+	aspartate aminotransferase	NA	NA	NA	NA	NA
AVG30643.1|2056167_2056815_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AVG30644.1|2056842_2057391_-	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
>prophage 146
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2072307	2076871	4751278		Bacillus_phage(66.67%)	3	NA	NA
AVG30656.1|2072307_2074056_-	lipid A export ATP-binding/permease MsbA	NA	W8CYL7	Bacillus_phage	30.5	3.2e-60
AVG30657.1|2074092_2076357_-	ComEC family protein	NA	Q332C0	Clostridium_botulinum_C_phage	22.5	8.8e-10
AVG30658.1|2076586_2076871_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	4.1e-10
>prophage 147
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2081928	2083017	4751278		Streptococcus_phage(100.0%)	1	NA	NA
AVG30663.1|2081928_2083017_-	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.5	2.8e-78
>prophage 148
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2087114	2091802	4751278		Tetraselmis_virus(100.0%)	3	NA	NA
AVG30666.1|2087114_2089397_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.0	1.1e-161
AVG30667.1|2089469_2090429_-	type III secretion system effector SopD2	NA	NA	NA	NA	NA
AVG30668.1|2090977_2091802_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	2.8e-22
>prophage 149
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2096096	2112891	4751278	tRNA	Escherichia_phage(25.0%)	11	NA	NA
AVG30672.1|2096096_2096714_-	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	59.6	4.3e-76
AVG30673.1|2096724_2099169_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.5	4.1e-223
AVG30674.1|2099405_2100698_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.5	8.6e-95
AVG30675.1|2100956_2102300_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.9	1.6e-80
AVG30676.1|2102309_2102921_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AVG33176.1|2103063_2107146_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.5	2.9e-88
AVG30677.1|2107280_2107775_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AVG30678.1|2107703_2107979_+	hypothetical protein	NA	NA	NA	NA	NA
AVG30679.1|2108320_2109289_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.5	1.1e-62
AVG30680.1|2109402_2111169_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	25.1	6.0e-22
AVG30681.1|2111169_2112891_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.5	8.4e-13
>prophage 150
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2117694	2125716	4751278	transposase,integrase,protease	Ralstonia_phage(14.29%)	10	2112301:2112315	2124452:2124466
2112301:2112315	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AVG30689.1|2117694_2118072_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	40.2	1.7e-19
AVG30690.1|2118233_2118431_+	hypothetical protein	NA	NA	NA	NA	NA
AVG30691.1|2118704_2119163_-|transposase	IS200/IS605 family transposase IS200F	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
AVG30692.1|2119119_2119302_-	hypothetical protein	NA	NA	NA	NA	NA
AVG30693.1|2119352_2121629_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
AVG30694.1|2121659_2121980_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AVG30695.1|2122303_2122525_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AVG30696.1|2122479_2122674_-	hypothetical protein	NA	NA	NA	NA	NA
AVG30697.1|2122654_2124601_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
2124452:2124466	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
AVG30698.1|2124597_2125716_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 151
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2132501	2134220	4751278		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
AVG30704.1|2132501_2134220_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.4	2.2e-29
>prophage 152
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2137809	2140561	4751278		Roseobacter_phage(50.0%)	4	NA	NA
AVG30708.1|2137809_2138640_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.7	1.3e-08
AVG30709.1|2138636_2138960_-	hypothetical protein	NA	NA	NA	NA	NA
AVG30710.1|2139087_2139603_+	lipoprotein	NA	NA	NA	NA	NA
AVG30711.1|2139832_2140561_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	35.8	5.1e-28
>prophage 153
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2147372	2156538	4751278		Streptococcus_phage(25.0%)	10	NA	NA
AVG30720.1|2147372_2148500_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	25.7	2.6e-23
AVG33178.1|2148542_2149016_-	DUF2593 domain-containing protein	NA	NA	NA	NA	NA
AVG30721.1|2149089_2149935_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AVG30722.1|2149931_2150885_-	putrescine ABC transporter permease	NA	NA	NA	NA	NA
AVG30723.1|2150894_2152028_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.9	1.1e-29
AVG30724.1|2152115_2153228_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AVG30725.1|2153576_2154053_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AVG30726.1|2154149_2155052_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.0	3.5e-34
AVG30727.1|2155814_2156105_-	hypothetical protein	NA	NA	NA	NA	NA
AVG30728.1|2156274_2156538_+	glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	70.5	5.9e-27
>prophage 154
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2164109	2166115	4751278		Escherichia_phage(50.0%)	2	NA	NA
AVG30735.1|2164109_2164868_+	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	29.6	5.2e-15
AVG30736.1|2164912_2166115_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.1	1.8e-99
>prophage 155
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2181651	2183523	4751278		Planktothrix_phage(100.0%)	1	NA	NA
AVG30752.1|2181651_2183523_-	glutathione import ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	28.5	1.3e-14
>prophage 156
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2187844	2194408	4751278		Citrobacter_phage(50.0%)	4	NA	NA
AVG30757.1|2187844_2190277_+	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	43.5	2.1e-09
AVG30758.1|2190354_2191164_-	HAD family hydrolase	NA	NA	NA	NA	NA
AVG30759.1|2191425_2192691_+	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
AVG30760.1|2192812_2194408_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	27.9	2.7e-58
>prophage 157
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2199394	2204702	4751278	protease	Enterobacteria_phage(33.33%)	7	NA	NA
AVG30766.1|2199394_2199910_-|protease	outer membrane protease	protease	A5LH44	Enterobacteria_phage	34.2	1.1e-16
AVG30767.1|2200263_2201151_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
AVG30768.1|2201453_2201957_+	DNA starvation/stationary phase protection protein	NA	A0A222YYG6	Streptomyces_phage	23.0	7.1e-05
AVG30769.1|2201906_2202086_-	hypothetical protein	NA	NA	NA	NA	NA
AVG30770.1|2202433_2203180_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
AVG30771.1|2203323_2203983_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
AVG30772.1|2203979_2204702_+	glutamine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	43.2	1.9e-35
>prophage 158
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2208170	2217483	4751278		Acinetobacter_phage(25.0%)	8	NA	NA
AVG30775.1|2208170_2208437_+	DksA/TraR family C4-type zinc finger protein	NA	E5E4B1	Acinetobacter_phage	52.8	2.2e-13
AVG30776.1|2208721_2208982_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AVG30777.1|2209137_2210112_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
AVG30778.1|2210141_2212286_-	ATP-dependent helicase DinG	NA	A0A127AW80	Bacillus_phage	26.7	7.4e-43
AVG30779.1|2212493_2213855_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.2	2.9e-53
AVG30780.1|2214084_2214759_+	transcriptional regulator	NA	NA	NA	NA	NA
AVG30781.1|2214758_2215754_+	secretion protein HlyD	NA	NA	NA	NA	NA
AVG30782.1|2215746_2217483_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.9	3.5e-19
>prophage 159
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2229199	2232467	4751278		Streptococcus_phage(50.0%)	2	NA	NA
AVG30799.1|2229199_2230108_+	hypothetical protein	NA	A1IMD5	Streptococcus_phage	29.9	7.8e-26
AVG30800.1|2230202_2232467_-	SPI-1 type III secretion system effector E3 ubiquitin transferase SlrP	NA	Q9MBL9	Phage_Gifsy-2	42.1	2.4e-15
>prophage 160
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2239327	2242756	4751278		Klosneuvirus(50.0%)	3	NA	NA
AVG30808.1|2239327_2240617_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	31.9	8.5e-18
AVG30809.1|2240674_2241151_+	kinase inhibitor	NA	NA	NA	NA	NA
AVG30810.1|2241235_2242756_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	40.0	1.7e-81
>prophage 161
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2251213	2258831	4751278		Planktothrix_phage(33.33%)	8	NA	NA
AVG30817.1|2251213_2252272_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	34.3	6.7e-21
AVG30818.1|2252274_2252964_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
AVG30819.1|2252963_2253737_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AVG33181.1|2253903_2254053_-	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
AVG30820.1|2254181_2254970_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
AVG30821.1|2255037_2256513_+	molybdate ABC transporter ATP-binding protein ModF	NA	W5SAS9	Pithovirus	30.2	4.4e-10
AVG30822.1|2256683_2257592_+	DUF2167 domain-containing protein	NA	NA	NA	NA	NA
AVG30823.1|2257814_2258831_+	UDP-glucose 4-epimerase	NA	A0A2K9L5H6	Tupanvirus	47.3	3.3e-81
>prophage 162
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2263139	2263916	4751278		Bacillus_virus(100.0%)	1	NA	NA
AVG30829.1|2263139_2263916_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.5	4.9e-13
>prophage 163
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2269622	2270870	4751278		Oenococcus_phage(100.0%)	1	NA	NA
AVG33182.1|2269622_2270870_-	cation transporter	NA	Q6A201	Oenococcus_phage	26.1	5.8e-32
>prophage 164
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2274616	2278140	4751278		Edwardsiella_phage(33.33%)	4	NA	NA
AVG30839.1|2274616_2275669_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	47.1	6.4e-80
AVG30840.1|2275988_2276375_+	hypothetical protein	NA	NA	NA	NA	NA
AVG30841.1|2276485_2277424_+	zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.1	1.8e-25
AVG30842.1|2277420_2278140_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	35.3	3.7e-23
>prophage 165
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2304268	2305060	4751278		Kaumoebavirus(100.0%)	1	NA	NA
AVG30862.1|2304268_2305060_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	26.1	4.0e-10
>prophage 166
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2310164	2317345	4751278		Tupanvirus(33.33%)	8	NA	NA
AVG30866.1|2310164_2310875_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	26.3	2.2e-07
AVG30867.1|2310878_2311649_-	ABC transporter permease	NA	NA	NA	NA	NA
AVG30868.1|2312922_2313816_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AVG30869.1|2313815_2314967_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	41.6	8.2e-81
AVG30870.1|2315252_2315993_-	transport protein	NA	NA	NA	NA	NA
AVG30871.1|2315994_2316216_-	hypothetical protein	NA	NA	NA	NA	NA
AVG30872.1|2316558_2316810_-	hypothetical protein	NA	NA	NA	NA	NA
AVG30873.1|2316778_2317345_-	DNA recombinase	NA	A0A2L1IV36	Escherichia_phage	54.4	4.3e-51
>prophage 167
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2321253	2328686	4751278		Acinetobacter_phage(33.33%)	6	NA	NA
AVG30880.1|2321253_2322735_+	dipeptide permease D	NA	A0A0P0IY73	Acinetobacter_phage	28.7	1.1e-45
AVG30881.1|2322773_2324195_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	31.5	2.3e-56
AVG30882.1|2324305_2324512_-	DUF2517 domain-containing protein	NA	NA	NA	NA	NA
AVG30883.1|2324848_2324938_+	potassium-transporting ATPase subunit F	NA	NA	NA	NA	NA
AVG30884.1|2324937_2326617_+	potassium-transporting ATPase A chain	NA	NA	NA	NA	NA
AVG30885.1|2326637_2328686_+	potassium-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.3	1.9e-27
>prophage 168
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2331956	2332634	4751278		Bacillus_phage(100.0%)	1	NA	NA
AVG30887.1|2331956_2332634_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	5.8e-26
>prophage 169
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2343717	2353721	4751278	tRNA	Lactobacillus_phage(25.0%)	8	NA	NA
AVG30898.1|2343717_2345121_+	FAD-dependent tricarballylate dehydrogenase TcuA	NA	A0A2P0ZL82	Lactobacillus_phage	26.2	7.8e-09
AVG30899.1|2345107_2346247_+	tricarballylate utilization protein TcuB	NA	NA	NA	NA	NA
AVG30900.1|2346297_2347602_+	tricarballylate/proton symporter TcuC	NA	Q6JIH2	Burkholderia_virus	34.9	1.2e-59
AVG30901.1|2347650_2347983_-	lipoprotein	NA	NA	NA	NA	NA
AVG30902.1|2348032_2349439_-	chitoporin	NA	NA	NA	NA	NA
AVG30903.1|2349566_2349752_-	hypothetical protein	NA	NA	NA	NA	NA
AVG30904.1|2349890_2351558_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	96.0	0.0e+00
AVG30905.1|2351768_2353721_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	2.9e-09
>prophage 170
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2358375	2360040	4751278		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AVG30910.1|2358375_2360040_+	asparagine synthase B	NA	H8ZJK1	Ostreococcus_tauri_virus	38.1	3.6e-85
>prophage 171
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2364656	2365742	4751278		Pseudomonas_phage(100.0%)	1	NA	NA
AVG30914.1|2364656_2365742_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.6	6.6e-48
>prophage 172
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2371642	2376445	4751278		Planktothrix_phage(50.0%)	4	NA	NA
AVG30920.1|2371642_2372368_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	8.7e-28
AVG30921.1|2372484_2373420_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
AVG30922.1|2373451_2374690_+	hypothetical protein	NA	NA	NA	NA	NA
AVG30923.1|2374765_2376445_+	molecular chaperone HscC	NA	F2Y0P3	Organic_Lake_phycodnavirus	35.9	2.3e-76
>prophage 173
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2387270	2389853	4751278	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
AVG30933.1|2387270_2389853_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.7	5.6e-186
>prophage 174
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2398080	2400565	4751278		Synechococcus_phage(50.0%)	2	NA	NA
AVG30942.1|2398080_2399214_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	4.8e-09
AVG30943.1|2399353_2400565_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	49.7	3.4e-101
>prophage 175
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2404520	2406050	4751278		Paramecium_bursaria_Chlorella_virus(33.33%)	3	NA	NA
AVG30949.1|2404520_2405309_-	hydrolase	NA	M1H2P4	Paramecium_bursaria_Chlorella_virus	23.9	1.3e-05
AVG30950.1|2405399_2405783_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	48.6	1.7e-22
AVG30951.1|2405840_2406050_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	78.1	5.9e-22
>prophage 176
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2421162	2427710	4751278		Morganella_phage(33.33%)	6	NA	NA
AVG30965.1|2421162_2421591_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.3e-18
AVG30966.1|2421658_2422426_-	hydrogenase	NA	NA	NA	NA	NA
AVG30967.1|2422425_2422983_-	DMSO reductase	NA	NA	NA	NA	NA
AVG30968.1|2422979_2425259_-	DMSO reductase	NA	A0A077SK27	Escherichia_phage	25.5	1.3e-45
AVG30969.1|2425251_2425812_-	molecular chaperone	NA	NA	NA	NA	NA
AVG30970.1|2426144_2427710_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.0	3.2e-43
>prophage 177
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2431086	2432912	4751278		Streptococcus_phage(50.0%)	2	NA	NA
AVG30974.1|2431086_2432322_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	34.3	2.9e-60
AVG30975.1|2432294_2432912_+	transcriptional regulator	NA	A0A0F7L444	uncultured_marine_virus	51.3	3.0e-53
>prophage 178
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2447384	2453502	4751278		Klosneuvirus(50.0%)	3	NA	NA
AVG30989.1|2447384_2448179_+	iron-enterobactin transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	23.4	1.1e-07
AVG30990.1|2448231_2449368_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
AVG30991.1|2449617_2453502_-	enterobactin synthase subunit F	NA	A0A2K9KZV5	Tupanvirus	28.7	1.9e-60
>prophage 179
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2477310	2485371	4751278	integrase	Salmonella_phage(80.0%)	8	2476064:2476078	2489932:2489946
2476064:2476078	attL	ATAAAATACGCCAGC	NA	NA	NA	NA
AVG31015.1|2477310_2478636_-	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.5	1.0e-103
AVG31016.1|2478851_2479706_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVG31017.1|2479756_2479936_-	cation transporter	NA	NA	NA	NA	NA
AVG31018.1|2480044_2480374_+	sensor histidine kinase	NA	NA	NA	NA	NA
AVG31019.1|2481241_2481604_+	GtrA family protein	NA	I1TED9	Salmonella_phage	100.0	3.9e-61
AVG31020.1|2481600_2482527_+	glycosyltransferase	NA	I1TED8	Salmonella_phage	97.7	3.8e-169
AVG31021.1|2482507_2484160_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	37.9	6.7e-84
AVG33196.1|2485182_2485371_+|integrase	integrase	integrase	B9UDL9	Salmonella_phage	78.6	3.8e-12
2489932:2489946	attR	ATAAAATACGCCAGC	NA	NA	NA	NA
>prophage 180
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2495393	2499827	4751278	tRNA	Enterococcus_phage(50.0%)	6	NA	NA
AVG31033.1|2495393_2496260_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	36.5	4.2e-29
AVG31034.1|2496261_2496474_+	ribosome-associated protein	NA	NA	NA	NA	NA
AVG31035.1|2496600_2497146_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AVG31036.1|2497138_2497576_+	hypothetical protein	NA	NA	NA	NA	NA
AVG31037.1|2497572_2498397_+	DUF2145 domain-containing protein	NA	NA	NA	NA	NA
AVG31038.1|2498441_2499827_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.5	1.1e-44
>prophage 181
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2511099	2512248	4751278		Streptococcus_phage(100.0%)	1	NA	NA
AVG31050.1|2511099_2512248_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.0	2.7e-47
>prophage 182
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2519698	2521480	4751278		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AVG31057.1|2519698_2521480_-	glyoxylate carboligase	NA	A0A0P0CRC5	Ostreococcus_lucimarinus_virus	27.3	1.9e-39
>prophage 183
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2525951	2526968	4751278		Planktothrix_phage(100.0%)	1	NA	NA
AVG31063.1|2525951_2526968_-	virulence-associated ABC transporter ATP-binding protein SfbB	NA	G9BWD6	Planktothrix_phage	38.2	1.3e-32
>prophage 184
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2531821	2532508	4751278		Planktothrix_phage(100.0%)	1	NA	NA
AVG31067.1|2531821_2532508_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	2.7e-31
>prophage 185
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2535783	2541002	4751278		Bacillus_virus(50.0%)	5	NA	NA
AVG31071.1|2535783_2536461_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	32.5	3.0e-22
AVG31072.1|2536607_2537525_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
AVG31073.1|2537521_2537974_+	NfeD family protein	NA	NA	NA	NA	NA
AVG31074.1|2537974_2538391_-	transcriptional regulator	NA	NA	NA	NA	NA
AVG31075.1|2538500_2541002_+	copper-exporting P-type ATPase A	NA	A0A218MNH6	uncultured_virus	37.4	6.1e-113
>prophage 186
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2553145	2558704	4751278		uncultured_Mediterranean_phage(33.33%)	5	NA	NA
AVG31085.1|2553145_2555020_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.9	7.5e-116
AVG31086.1|2555130_2555736_-	recombination protein RecR	NA	NA	NA	NA	NA
AVG31087.1|2555735_2556065_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AVG31088.1|2556110_2558039_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	2.3e-43
AVG31089.1|2558152_2558704_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.2	4.6e-29
>prophage 187
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2578759	2582306	4751278		Bacillus_phage(100.0%)	2	NA	NA
AVG31111.1|2578759_2580541_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.7	5.4e-39
AVG31112.1|2580533_2582306_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.9	6.1e-51
>prophage 188
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2586706	2587402	4751278		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVG31117.1|2586706_2587402_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	2.7e-87
>prophage 189
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2590695	2595863	4751278	protease	Bacillus_phage(25.0%)	4	NA	NA
AVG31121.1|2590695_2590968_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.9e-20
AVG31122.1|2591176_2593531_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.5	1.6e-224
AVG31123.1|2593716_2594988_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.5	5.6e-131
AVG31124.1|2595239_2595863_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 190
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2616927	2618037	4751278		Bacillus_virus(100.0%)	1	NA	NA
AVG31144.1|2616927_2618037_+	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	32.8	8.0e-25
>prophage 191
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2627556	2629219	4751278		Staphylococcus_phage(50.0%)	2	NA	NA
AVG31155.1|2627556_2628027_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.0	2.3e-29
AVG31156.1|2628115_2629219_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.2	2.5e-50
>prophage 192
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2633899	2638239	4751278	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
AVG31165.1|2633899_2634871_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	38.1	2.3e-44
AVG31166.1|2634881_2636729_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
AVG31167.1|2636756_2637089_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	3.7e-10
AVG31168.1|2637111_2638239_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.8	9.5e-90
>prophage 193
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2646210	2656131	4751278		Bacillus_phage(60.0%)	7	NA	NA
AVG31175.1|2646210_2647506_-	two-component system sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	31.1	2.0e-27
AVG31176.1|2647575_2648265_-	phosphate regulon transcriptional regulatory protein PhoB	NA	W8CYM9	Bacillus_phage	38.0	3.3e-37
AVG31177.1|2648479_2649682_+	exonuclease subunit SbcD	NA	A0A0A0PQ58	Bacillus_phage	24.9	1.3e-07
AVG31178.1|2649678_2652819_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	21.3	7.4e-07
AVG31179.1|2652991_2654164_+	MFS transporter AraJ	NA	NA	NA	NA	NA
AVG31180.1|2654185_2655094_-	fructokinase	NA	NA	NA	NA	NA
AVG31181.1|2655219_2656131_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	7.1e-104
>prophage 194
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2659818	2660931	4751278		Bacillus_phage(100.0%)	1	NA	NA
AVG31188.1|2659818_2660931_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	32.0	2.1e-17
>prophage 195
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2675494	2677381	4751278		Staphylococcus_phage(100.0%)	1	NA	NA
AVG31203.1|2675494_2677381_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.2	1.2e-52
>prophage 196
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2690797	2700508	4751278		Escherichia_phage(33.33%)	6	NA	NA
AVG31216.1|2690797_2693770_-	type III restriction-modification system endonuclease	NA	Q71TG1	Escherichia_phage	26.3	2.1e-83
AVG31217.1|2693779_2695738_-	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	32.2	2.0e-82
AVG31218.1|2695926_2697180_-	MFS transporter	NA	NA	NA	NA	NA
AVG31219.1|2697471_2697666_-	copper chaperone	NA	NA	NA	NA	NA
AVG31220.1|2697743_2698208_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AVG31221.1|2698219_2700508_-	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.2	1.7e-90
>prophage 197
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2708155	2708680	4751278		Shigella_phage(100.0%)	1	NA	NA
AVG31228.1|2708155_2708680_-	outer membrane protein	NA	A0A088CE87	Shigella_phage	29.4	1.3e-09
>prophage 198
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2721223	2721496	4751278		Salmonella_phage(100.0%)	1	NA	NA
AVG31241.1|2721223_2721496_+	cytoplasmic protein	NA	B8K1I9	Salmonella_phage	60.9	5.4e-07
>prophage 199
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2729655	2773251	4751278	lysis,protease,tail,integrase,terminase,portal,coat	Enterobacteria_phage(44.78%)	68	2730095:2730140	2769360:2769405
AVG31249.1|2729655_2729931_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	64.1	1.9e-23
2730095:2730140	attL	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
AVG31250.1|2730132_2730312_-	hypothetical protein	NA	M1E3P7	Enterobacteria_phage	100.0	1.9e-16
AVG31251.1|2730428_2730791_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
AVG31252.1|2730787_2731720_+	glycosyltransferase	NA	A0A192Y8W7	Salmonella_phage	100.0	5.5e-176
AVG31253.1|2731709_2733167_+	hypothetical protein	NA	A0A192Y7W8	Salmonella_phage	100.0	4.5e-241
AVG31254.1|2733225_2735229_-	endorhamnosidase	NA	A0A2H4FWI0	Salmonella_phage	99.9	0.0e+00
AVG31255.1|2735364_2735619_+	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	63.3	4.4e-19
AVG31256.1|2736021_2736507_+	hypothetical protein	NA	NA	NA	NA	NA
AVG31257.1|2736597_2738595_-	DNA transfer protein	NA	Q716G2	Shigella_phage	94.9	0.0e+00
AVG31258.1|2738594_2739890_-	acyltransferase	NA	Q716G3	Shigella_phage	84.5	2.1e-181
AVG31259.1|2739899_2740592_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	98.7	1.2e-108
AVG31260.1|2740594_2741050_-	hypothetical protein	NA	A0A192Y6V9	Salmonella_phage	100.0	5.2e-87
AVG31261.1|2741049_2741751_-|tail	phage tail protein	tail	A0A192Y6T9	Salmonella_phage	100.0	8.8e-78
AVG31262.1|2741754_2743173_-	hypothetical protein	NA	A0A075B8I2	Enterobacteria_phage	100.0	7.6e-278
AVG31263.1|2743132_2743633_-	hypothetical protein	NA	I1TEJ0	Salmonella_phage	99.4	5.5e-90
AVG31264.1|2743616_2743826_-	hypothetical protein	NA	A0A192Y697	Salmonella_phage	100.0	1.3e-32
AVG31265.1|2743864_2745157_-|coat	coat protein	coat	A0A192Y6V4	Salmonella_phage	100.0	3.2e-243
AVG31266.1|2745156_2746068_-	scaffolding protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
AVG31267.1|2746081_2748259_-|portal	portal protein	portal	A0A2H4FNE2	Salmonella_phage	99.9	0.0e+00
AVG31268.1|2748258_2749758_-|terminase	terminase	terminase	A0A192Y824	Salmonella_phage	99.8	1.4e-306
AVG31269.1|2749735_2750224_-	DNA-packaging protein	NA	O80290	Bacteriophage	100.0	2.9e-88
AVG31270.1|2750247_2750427_-	hypothetical protein	NA	Q9AZ02	Salmonella_phage	91.5	3.0e-22
AVG31271.1|2750428_2750671_-	DUF2560 domain-containing protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
AVG31272.1|2750973_2751660_-	hypothetical protein	NA	A0A192Y918	Salmonella_phage	99.6	4.7e-124
AVG31273.1|2751646_2751838_-	hypothetical protein	NA	A0A1V0E5I0	Salmonella_phage	95.2	1.1e-27
AVG31274.1|2751872_2752310_-|lysis	lysis protein	lysis	O80289	Bacteriophage	99.3	9.1e-73
AVG31275.1|2752398_2752896_-	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	97.0	6.0e-89
AVG31276.1|2752873_2753077_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
AVG31277.1|2753216_2753426_-	hypothetical protein	NA	M1E3N9	Enterobacteria_phage	100.0	6.7e-34
AVG31278.1|2753515_2754139_-	antitermination protein	NA	A0A075B8H9	Enterobacteria_phage	100.0	2.3e-114
AVG31279.1|2754135_2754315_-	hypothetical protein	NA	A0A1U8QR34	Salmonella_phage	100.0	1.4e-24
AVG31280.1|2754295_2754499_-	protein ninH	NA	A0A075B8J4	Enterobacteria_phage	100.0	7.2e-33
AVG31281.1|2754495_2754720_-	protein ninY	NA	Q5G8R9	Enterobacteria_phage	100.0	2.2e-38
AVG31282.1|2754716_2755328_-	recombination protein NinG	NA	A0A075B8E9	Enterobacteria_phage	100.0	1.3e-98
AVG31283.1|2755320_2755497_-	protein ninF	NA	I6S668	Salmonella_phage	100.0	2.5e-26
AVG31284.1|2755489_2755828_-	DUF2591 domain-containing protein	NA	A0A075B8G3	Enterobacteria_phage	100.0	3.3e-62
AVG31285.1|2755824_2756001_-	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
AVG31286.1|2755967_2756141_-	protein ninD	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
AVG31287.1|2756137_2756593_-	recombination protein NinB	NA	A8CGE3	Salmonella_phage	100.0	1.4e-79
AVG31288.1|2756648_2758025_-	replicative DNA helicase	NA	A0A075B8G2	Enterobacteria_phage	100.0	3.3e-254
AVG31289.1|2758021_2758837_-	DNA replication protein	NA	A0A075B8J2	Enterobacteria_phage	100.0	9.4e-148
AVG31290.1|2758829_2758976_-	DUF2740 domain-containing protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
AVG31291.1|2759010_2759289_-	hypothetical protein	NA	Q5G8T2	Enterobacteria_phage	100.0	2.5e-44
AVG31292.1|2759395_2759581_-	hypothetical protein	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
AVG31293.1|2759661_2760312_+	LexA family transcriptional repressor	NA	B1B6L9	Salmonella_phage	100.0	5.4e-122
AVG31294.1|2760665_2760968_+	regulator	NA	B8K1E6	Salmonella_phage	98.0	1.1e-48
AVG33204.1|2760988_2761567_-	superinfection exclusion protein B	NA	A0A075B8E6	Enterobacteria_phage	100.0	8.8e-92
AVG31295.1|2761781_2761976_+	restriction endonuclease	NA	A0A075B8G0	Enterobacteria_phage	100.0	2.5e-30
AVG31296.1|2762012_2762249_+	hypothetical protein	NA	A0A075B8J0	Enterobacteria_phage	100.0	4.3e-37
AVG31297.1|2762248_2762452_+	DUF551 domain-containing protein	NA	A0A0N7CAQ5	Salmonella_phage	100.0	1.7e-34
AVG31298.1|2762599_2762911_+	superinfection exclusion protein	NA	A0A075B8E5	Enterobacteria_phage	100.0	1.1e-48
AVG31299.1|2762996_2763155_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A075B8H4	Enterobacteria_phage	100.0	4.0e-23
AVG31300.1|2763135_2763324_+	protein kil	NA	A0A075B8F9	Enterobacteria_phage	100.0	1.4e-30
AVG31301.1|2763453_2764071_+	recombinase	NA	A0A0N7CFJ3	Salmonella_phage	100.0	3.3e-105
AVG31302.1|2764070_2764355_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	97.9	2.6e-44
AVG31303.1|2764401_2764698_+	RecBCD nuclease inhibitor	NA	Q76H42	Enterobacteria_phage	90.8	3.9e-43
AVG33205.1|2764708_2764873_+	DUF2737 domain-containing protein	NA	A0A2I6PID4	Escherichia_phage	98.1	1.6e-22
AVG31304.1|2764869_2765496_+	hNH endonuclease	NA	A5VWB1	Enterobacteria_phage	71.2	7.1e-71
AVG31305.1|2765492_2765978_+	hypothetical protein	NA	A5VWB3	Enterobacteria_phage	86.1	1.3e-43
AVG31306.1|2765979_2766243_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	2.0e-30
AVG31307.1|2766253_2766940_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	53.2	4.3e-53
AVG31308.1|2767036_2767216_+	Eag protein	NA	A0A075B8F7	Enterobacteria_phage	98.3	1.6e-28
AVG31309.1|2767316_2767952_+	Eac protein	NA	A0A075B8I7	Enterobacteria_phage	99.5	1.3e-120
AVG31310.1|2767954_2768305_+	DNA-binding protein	NA	A0A075B8K2	Enterobacteria_phage	100.0	6.4e-61
AVG33206.1|2768676_2769345_+|integrase	site-specific integrase	integrase	A0A192Y6Q1	Salmonella_phage	100.0	6.1e-129
AVG31311.1|2769550_2770801_-	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	48.2	2.1e-98
2769360:2769405	attR	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
AVG31312.1|2770812_2771916_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
AVG31313.1|2772198_2773251_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	2.2e-112
>prophage 200
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2778023	2779163	4751278		Mycobacterium_phage(100.0%)	1	NA	NA
AVG31319.1|2778023_2779163_-	RNA ligase RtcB family protein	NA	A0A222ZM82	Mycobacterium_phage	31.0	2.0e-31
>prophage 201
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2782377	2782956	4751278		Caulobacter_phage(100.0%)	1	NA	NA
AVG31323.1|2782377_2782956_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	30.8	1.3e-13
>prophage 202
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2799813	2804520	4751278		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVG31339.1|2799813_2804520_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	38.4	1.4e-30
>prophage 203
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2824594	2827234	4751278		Vibrio_phage(100.0%)	1	NA	NA
AVG31360.1|2824594_2827234_-	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	34.5	1.1e-77
>prophage 204
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2834294	2838505	4751278		Bradyrhizobium_phage(33.33%)	5	NA	NA
AVG33210.1|2834294_2835026_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.9	6.4e-39
AVG31367.1|2835089_2835557_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.9	4.7e-51
AVG31368.1|2835553_2836276_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AVG31369.1|2836310_2837066_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AVG31370.1|2837137_2838505_+	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	33.0	1.4e-10
>prophage 205
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2842555	2843359	4751278		Indivirus(100.0%)	1	NA	NA
AVG31375.1|2842555_2843359_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	34.6	1.1e-36
>prophage 206
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2850411	2851443	4751278		Planktothrix_phage(100.0%)	1	NA	NA
AVG31377.1|2850411_2851443_+	methionine import ATP-binding protein MetN 1	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 207
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2865430	2869533	4751278		Saccharomonospora_phage(50.0%)	2	NA	NA
AVG31393.1|2865430_2868913_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	2.8e-209
AVG31394.1|2868936_2869533_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.3	1.5e-25
>prophage 208
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2878344	2879103	4751278		Flavobacterium_phage(100.0%)	1	NA	NA
AVG31403.1|2878344_2879103_-	ditrans,polycis-undecaprenyl-diphosphate synthase ((2E,6E)-farnesyl-diphosphate specific)	NA	R9W0U9	Flavobacterium_phage	42.2	1.9e-25
>prophage 209
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2892539	2893967	4751278	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVG31417.1|2892539_2893967_-|protease	periplasmic serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.2	4.2e-26
>prophage 210
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2897950	2898295	4751278		Lake_Baikal_phage(100.0%)	1	NA	NA
AVG31422.1|2897950_2898295_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	1.0e-26
>prophage 211
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2911683	2912481	4751278		Planktothrix_phage(100.0%)	1	NA	NA
AVG31435.1|2911683_2912481_-	iron-hydroxamate transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	27.4	2.7e-14
>prophage 212
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2917728	2920203	4751278		Bodo_saltans_virus(100.0%)	1	NA	NA
AVG31438.1|2917728_2920203_-	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	28.0	5.6e-34
>prophage 213
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2923219	2924638	4751278		unidentified_phage(100.0%)	1	NA	NA
AVG31442.1|2923219_2924638_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.8	1.1e-26
>prophage 214
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2942669	2952373	4751278		Anomala_cuprea_entomopoxvirus(25.0%)	9	NA	NA
AVG31461.1|2942669_2943596_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.7	5.9e-21
AVG31462.1|2943704_2944367_+	carbonate dehydratase	NA	NA	NA	NA	NA
AVG31463.1|2944424_2944961_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	1.0e-17
AVG31464.1|2945166_2947557_+	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
AVG31465.1|2947634_2949245_-	multicopper oxidase	NA	A0A0C6DWA2	Mamastrovirus	59.8	3.0e-20
AVG31466.1|2949446_2949794_+	hypothetical protein	NA	NA	NA	NA	NA
AVG31467.1|2949900_2950761_+	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
AVG31468.1|2950781_2951576_+	S-adenosylmethionine decarboxylase proenzyme	NA	NA	NA	NA	NA
AVG31469.1|2951605_2952373_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	35.7	1.7e-29
>prophage 215
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2968563	2969988	4751278		Erysipelothrix_phage(100.0%)	1	NA	NA
AVG31484.1|2968563_2969988_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.2e-41
>prophage 216
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2981077	2981641	4751278		Sphingobium_phage(100.0%)	1	NA	NA
AVG31492.1|2981077_2981641_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	30.0	2.6e-11
>prophage 217
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	2985898	2986942	4751278		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AVG31497.1|2985898_2986942_-	guanosine monophosphate reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.2	3.4e-102
>prophage 218
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3017257	3018829	4751278		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
AVG31525.1|3017257_3018829_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.1	6.9e-06
>prophage 219
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3026878	3027586	4751278		Bacillus_virus(100.0%)	1	NA	NA
AVG31533.1|3026878_3027586_+	thiamine import ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	38.3	8.2e-23
>prophage 220
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3035361	3040793	4751278		Lymphocystis_disease_virus(50.0%)	3	NA	NA
AVG31541.1|3035361_3037713_+	DNA polymerase II	NA	A0A1B2RW58	Lymphocystis_disease_virus	25.5	2.5e-15
AVG31542.1|3037613_3037862_-	hypothetical protein	NA	NA	NA	NA	NA
AVG31543.1|3037886_3040793_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.1	2.9e-21
>prophage 221
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3048522	3049956	4751278		Enterococcus_phage(50.0%)	2	NA	NA
AVG31551.1|3048522_3049371_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0E3T919	Enterococcus_phage	47.8	5.8e-07
AVG31552.1|3049476_3049956_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	47.1	2.3e-29
>prophage 222
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3053092	3054982	4751278		Catovirus(100.0%)	1	NA	NA
AVG31557.1|3053092_3054982_-	sulfatase	NA	A0A1V0SA98	Catovirus	24.7	5.0e-27
>prophage 223
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3062723	3068363	4751278		Vibrio_phage(50.0%)	4	NA	NA
AVG31567.1|3062723_3064241_+	L-carnitine/gamma-butyrobetaine antiporter	NA	A0A2I7QNT1	Vibrio_phage	22.2	1.4e-08
AVG31568.1|3064275_3065418_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AVG31569.1|3065529_3066747_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
AVG31570.1|3066809_3068363_+	ATP-dependent acyl-CoA ligase	NA	Q75ZG1	Hepacivirus	24.4	9.8e-29
>prophage 224
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3073888	3075037	4751278		Halovirus(100.0%)	1	NA	NA
AVG31575.1|3073888_3075037_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.1	2.0e-50
>prophage 225
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3094048	3096883	4751278	tRNA	Tupanvirus(100.0%)	1	NA	NA
AVG33216.1|3094048_3096883_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	5.0e-79
>prophage 226
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3103381	3104548	4751278		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVG31598.1|3103381_3104548_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.1	7.5e-90
>prophage 227
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3107806	3109300	4751278		Tetraselmis_virus(100.0%)	1	NA	NA
AVG31602.1|3107806_3109300_-	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	29.3	1.5e-29
>prophage 228
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3125028	3137332	4751278		Plodia_interpunctella_granulovirus(20.0%)	12	NA	NA
AVG31616.1|3125028_3127128_-	chitinase	NA	A0A1L5JGH0	Plodia_interpunctella_granulovirus	28.5	9.5e-35
AVG31617.1|3127508_3127952_+	transcriptional regulator	NA	NA	NA	NA	NA
AVG31618.1|3127968_3128502_+	hypothetical protein	NA	A0A0U2I1S0	Escherichia_phage	56.6	1.2e-53
AVG31619.1|3128562_3128907_-	hypothetical protein	NA	NA	NA	NA	NA
AVG31620.1|3129033_3129981_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVG31621.1|3130261_3131401_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	36.0	4.2e-29
AVG31622.1|3131486_3133403_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	48.9	5.8e-148
AVG31623.1|3133751_3134156_+	hypothetical protein	NA	NA	NA	NA	NA
AVG31624.1|3134191_3134905_+	hypothetical protein	NA	NA	NA	NA	NA
AVG31625.1|3135054_3135621_+	hypothetical protein	NA	NA	NA	NA	NA
AVG31626.1|3135677_3136268_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
AVG31627.1|3136378_3137332_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.0	9.7e-11
>prophage 229
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3156081	3157506	4751278		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
AVG31644.1|3156081_3157506_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	23.6	7.9e-09
>prophage 230
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3161455	3166619	4751278		Bacillus_phage(33.33%)	3	NA	NA
AVG31652.1|3161455_3163429_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	36.4	1.8e-11
AVG31653.1|3163601_3165269_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.7	1.7e-42
AVG33220.1|3165386_3166619_-	trifunctional nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase/transcriptional regulator NadR	NA	A0A0C5K935	Enterococcus_phage	45.5	6.7e-89
>prophage 231
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3178761	3180084	4751278		Geobacillus_virus(100.0%)	1	NA	NA
AVG31666.1|3178761_3180084_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	41.4	1.8e-79
>prophage 232
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3185631	3188530	4751278		Salmonella_phage(50.0%)	3	NA	NA
AVG31672.1|3185631_3185811_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	66.0	1.5e-10
AVG31673.1|3185921_3186539_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
AVG31674.1|3186940_3188530_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	3.1e-30
>prophage 233
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3192307	3193372	4751278		Bacillus_virus(100.0%)	1	NA	NA
AVG31679.1|3192307_3193372_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	33.1	4.2e-15
>prophage 234
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3198346	3199626	4751278		Salmonella_phage(50.0%)	2	NA	NA
AVG31685.1|3198346_3198886_+	primosomal protein 1	NA	T1SA92	Salmonella_phage	65.6	2.2e-28
AVG31686.1|3198888_3199626_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.2	1.2e-64
>prophage 235
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3203880	3204942	4751278		Acanthamoeba_polyphaga_lentillevirus(100.0%)	1	NA	NA
AVG31690.1|3203880_3204942_-	glucosamine--fructose-6-phosphate aminotransferase	NA	J3IZE6	Acanthamoeba_polyphaga_lentillevirus	23.8	2.7e-09
>prophage 236
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3210674	3212336	4751278		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AVG31695.1|3210674_3212336_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	72.3	6.0e-08
>prophage 237
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3218149	3221659	4751278		Cellulophaga_phage(100.0%)	1	NA	NA
AVG31702.1|3218149_3221659_+	type I restriction-modification system deoxyribonuclease	NA	S0A182	Cellulophaga_phage	34.8	1.1e-06
>prophage 238
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3252323	3272263	4751278		uncultured_Mediterranean_phage(60.0%)	8	NA	NA
AVG31735.1|3252323_3254441_-	ATP-dependent helicase	NA	G3MA40	Bacillus_virus	24.8	3.1e-09
AVG31736.1|3254437_3260779_-	DUF1998 domain-containing protein	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	22.9	1.1e-57
AVG31737.1|3260778_3265701_-	class I SAM-dependent DNA methyltransferase	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	21.4	1.4e-31
AVG31738.1|3265703_3268535_-	ATP-dependent helicase	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	26.8	2.2e-42
AVG31739.1|3269179_3269959_-	HNH endonuclease	NA	NA	NA	NA	NA
AVG31740.1|3270119_3270434_+	hypothetical protein	NA	NA	NA	NA	NA
AVG31741.1|3270430_3270718_-	DUF4102 domain-containing protein	NA	NA	NA	NA	NA
AVG31742.1|3271243_3272263_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	4.6e-43
>prophage 239
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3280083	3285030	4751278	tRNA	Mycoplasma_phage(50.0%)	3	NA	NA
AVG31751.1|3280083_3281595_+	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.7	8.3e-49
AVG31752.1|3281692_3282175_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AVG31753.1|3282174_3285030_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.4	1.8e-140
>prophage 240
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3288773	3289232	4751278	transposase	Saccharomonospora_phage(100.0%)	1	NA	NA
AVG31757.1|3288773_3289232_-|transposase	IS200/IS605 family transposase IS200F	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
>prophage 241
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3297849	3304398	4751278	transposase	Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
AVG31768.1|3297849_3298785_+	aspartate carbamoyltransferase catalytic subunit	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.2	6.5e-52
AVG31769.1|3298797_3299259_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AVG31770.1|3299335_3299722_+	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
AVG31771.1|3299796_3300243_+|transposase	transposase	transposase	NA	NA	NA	NA
AVG33226.1|3300358_3303067_-	magnesium-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	25.2	3.4e-45
AVG31772.1|3303450_3304398_+	transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	21.5	1.2e-13
>prophage 242
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3308064	3311404	4751278		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
AVG31775.1|3308064_3310203_+	anaerobic ribonucleoside triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	1.5e-266
AVG31776.1|3310419_3310884_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	55.8	2.7e-51
AVG31777.1|3310887_3311172_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	71.3	1.3e-32
AVG31778.1|3311161_3311404_-	type II toxin-antitoxin system antitoxin, RelB/DinJ family	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	51.2	5.6e-16
>prophage 243
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3323327	3325083	4751278		Klosneuvirus(50.0%)	2	NA	NA
AVG31792.1|3323327_3324326_+	fructose 1,6-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.4	1.3e-69
AVG31793.1|3324552_3325083_+	inorganic pyrophosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	4.2e-56
>prophage 244
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3360294	3361458	4751278		Ralstonia_phage(100.0%)	1	NA	NA
AVG31833.1|3360294_3361458_-	hypothetical protein	NA	B2ZXR7	Ralstonia_phage	43.8	2.0e-82
>prophage 245
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3366321	3370729	4751278		Lactococcus_phage(50.0%)	3	NA	NA
AVG31841.1|3366321_3368760_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	9.9e-68
AVG31842.1|3368797_3369223_-	transcriptional regulator	NA	NA	NA	NA	NA
AVG31843.1|3369430_3370729_-	adenylosuccinate synthetase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
>prophage 246
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3376274	3379463	4751278		Wolbachia_phage(50.0%)	2	NA	NA
AVG31850.1|3376274_3378131_-	DNA mismatch repair protein MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.8	5.8e-60
AVG31851.1|3378140_3379463_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	29.2	1.8e-15
>prophage 247
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3384484	3385030	4751278		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AVG31855.1|3384484_3385030_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.6	4.5e-29
>prophage 248
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3392843	3393821	4751278		Tupanvirus(100.0%)	1	NA	NA
AVG31861.1|3392843_3393821_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.1	1.7e-26
>prophage 249
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3397548	3398082	4751278		Morganella_phage(100.0%)	1	NA	NA
AVG31866.1|3397548_3398082_+	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	54.8	9.4e-48
>prophage 250
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3403149	3405133	4751278		Vibrio_phage(50.0%)	2	NA	NA
AVG31874.1|3403149_3404796_-	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.7	1.2e-189
AVG31875.1|3404839_3405133_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	1.2e-12
>prophage 251
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3423543	3428018	4751278		Escherichia_phage(100.0%)	4	NA	NA
AVG31891.1|3423543_3424197_-	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	72.4	3.0e-80
AVG31892.1|3424212_3424986_-	dimethyl sulfoxide reductase	NA	A0A077SK59	Escherichia_phage	79.8	1.3e-103
AVG31893.1|3424978_3425605_-	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	92.3	2.9e-120
AVG33231.1|3425618_3428018_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	81.4	0.0e+00
>prophage 252
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3446197	3454557	4751278		Bacillus_phage(25.0%)	8	NA	NA
AVG33233.1|3446197_3447268_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.3	6.0e-09
AVG31906.1|3447275_3447365_-	LpxT activity modulator PmrR	NA	NA	NA	NA	NA
AVG31907.1|3447434_3448937_-	proline/betaine transporter	NA	Q6JIH2	Burkholderia_virus	30.5	3.5e-55
AVG31908.1|3449404_3449740_+	hypothetical protein	NA	NA	NA	NA	NA
AVG31909.1|3449859_3450303_+	VOC family protein	NA	NA	NA	NA	NA
AVG31910.1|3450424_3450889_+	aminoalkylphosphonate N-acetyltransferase	NA	NA	NA	NA	NA
AVG31911.1|3451146_3452055_+	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	37.1	5.9e-34
AVG31912.1|3452409_3454557_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	24.5	1.3e-31
>prophage 253
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3464250	3466209	4751278		Staphylococcus_phage(100.0%)	1	NA	NA
AVG31923.1|3464250_3466209_+	acetyl-coenzyme A synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	40.2	2.2e-89
>prophage 254
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3472421	3473771	4751278		Moraxella_phage(100.0%)	1	NA	NA
AVG31931.1|3472421_3473771_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.4	6.7e-159
>prophage 255
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3478656	3480723	4751278		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVG31937.1|3478656_3480723_-	peptidase domain-containing ABC transporter	NA	F2Y2R6	Organic_Lake_phycodnavirus	23.7	6.3e-15
>prophage 256
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3503105	3506709	4751278		Enterobacteria_phage(50.0%)	3	NA	NA
AVG31944.1|3503105_3503636_-	ssDNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	88.9	3.9e-54
AVG31945.1|3503802_3503919_-	hypothetical protein	NA	NA	NA	NA	NA
AVG31946.1|3503883_3506709_+	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.7	0.0e+00
>prophage 257
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3510798	3562478	4751278	tail,plate,tRNA	Burkholderia_phage(37.5%)	54	NA	NA
AVG31954.1|3510798_3511878_-	alanine racemase biosynthetic	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.1	1.2e-28
AVG31955.1|3511909_3513325_-	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	78.4	7.0e-199
AVG31956.1|3513389_3514373_+	quinone oxidoreductase	NA	NA	NA	NA	NA
AVG31957.1|3514547_3514790_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
AVG31958.1|3514957_3515956_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AVG31959.1|3516043_3517354_-	conjugal transfer protein	NA	NA	NA	NA	NA
AVG31960.1|3517600_3518116_+	transcriptional regulator Zur	NA	NA	NA	NA	NA
AVG31961.1|3518214_3518424_-	CsbD family protein	NA	NA	NA	NA	NA
AVG33235.1|3518445_3518559_-	hypothetical protein	NA	NA	NA	NA	NA
AVG31962.1|3518555_3519881_-	MATE family efflux transporter	NA	NA	NA	NA	NA
AVG31963.1|3520059_3520668_-	LexA repressor	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
AVG31964.1|3520776_3521145_-	diacylglycerol kinase	NA	NA	NA	NA	NA
AVG31965.1|3521315_3523736_+	glycerol-3-phosphate 1-O-acyltransferase	NA	NA	NA	NA	NA
AVG31966.1|3523834_3524707_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
AVG31967.1|3524720_3525218_-	chorismate--pyruvate lyase	NA	NA	NA	NA	NA
AVG31968.1|3525398_3526316_-	maltose operon protein MalM	NA	NA	NA	NA	NA
AVG31969.1|3526479_3527838_-	maltoporin	NA	NA	NA	NA	NA
AVG31970.1|3527926_3529036_-	maltose/maltodextrin import ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
AVG31971.1|3529397_3530588_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
AVG31972.1|3530719_3532264_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
AVG31973.1|3532278_3533169_+	maltose ABC transporter permease	NA	NA	NA	NA	NA
AVG31974.1|3533334_3533745_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
AVG31975.1|3533887_3535984_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
AVG31976.1|3535983_3536721_-	hypothetical protein	NA	NA	NA	NA	NA
AVG31977.1|3536717_3537356_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
AVG31978.1|3537419_3537662_-	outer membrane protein	NA	NA	NA	NA	NA
AVG31979.1|3538105_3539755_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
AVG31980.1|3540099_3541449_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
AVG31981.1|3541581_3541929_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
AVG31982.1|3542504_3542792_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
AVG31983.1|3542794_3543400_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
AVG31984.1|3543412_3543727_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
AVG31985.1|3543886_3544342_+	hypothetical protein	NA	NA	NA	NA	NA
AVG31986.1|3544338_3544536_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
AVG31987.1|3544525_3545953_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
AVG31988.1|3545952_3546477_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	2.3e-67
AVG31989.1|3546528_3546846_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AVG31990.1|3546805_3546934_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AVG31991.1|3547030_3549385_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
AVG31992.1|3549384_3550338_+	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
AVG31993.1|3550337_3550547_+	hypothetical protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
AVG31994.1|3550534_3551578_+	phage protein D	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
AVG31995.1|3551587_3552310_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
AVG31996.1|3552637_3553000_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
AVG31997.1|3552996_3553926_+	glycosyltransferase	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
AVG31998.1|3553925_3555473_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
AVG31999.1|3555636_3555996_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
AVG32000.1|3555986_3557102_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	3.1e-101
AVG32001.1|3557094_3557727_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	8.6e-24
AVG32002.1|3557729_3559388_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	1.8e-52
AVG32003.1|3559394_3560009_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
AVG32004.1|3560005_3560461_+	hypothetical protein	NA	NA	NA	NA	NA
AVG33236.1|3560841_3561258_+	serine acetyltransferase	NA	NA	NA	NA	NA
AVG32005.1|3561836_3562478_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.9	4.6e-33
>prophage 258
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3568460	3572144	4751278		Dickeya_phage(100.0%)	1	NA	NA
AVG32013.1|3568460_3572144_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 259
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3586411	3588001	4751278		Prochlorococcus_phage(100.0%)	1	NA	NA
AVG32021.1|3586411_3588001_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/inosine monophosphate cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	48.1	6.5e-68
>prophage 260
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3593485	3595248	4751278		Bacillus_phage(50.0%)	3	NA	NA
AVG32027.1|3593485_3593758_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	57.8	5.5e-20
AVG32028.1|3593944_3594535_-	DUF416 domain-containing protein	NA	NA	NA	NA	NA
AVG32029.1|3594576_3595248_-	endonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	1.6e-20
>prophage 261
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3600603	3601362	4751278		Catovirus(100.0%)	1	NA	NA
AVG32035.1|3600603_3601362_+	HesA/MoeB/ThiF family protein	NA	A0A1V0SAV8	Catovirus	29.1	8.2e-13
>prophage 262
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3604910	3613239	4751278		Vibrio_phage(50.0%)	2	NA	NA
AVG32043.1|3604910_3609134_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.1	5.0e-67
AVG32044.1|3609210_3613239_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 263
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3617359	3620453	4751278		Tupanvirus(50.0%)	3	NA	NA
AVG32051.1|3617359_3618544_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.5	2.6e-13
AVG32052.1|3619120_3619294_+	hypothetical protein	NA	NA	NA	NA	NA
AVG32053.1|3619502_3620453_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.5	6.0e-29
>prophage 264
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3629107	3630952	4751278		Acinetobacter_phage(100.0%)	1	NA	NA
AVG32057.1|3629107_3630952_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	30.0	2.2e-11
>prophage 265
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3647003	3647666	4751278		Synechococcus_phage(100.0%)	1	NA	NA
AVG32070.1|3647003_3647666_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	2.5e-29
>prophage 266
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3671004	3675615	4751278		Erwinia_phage(50.0%)	5	NA	NA
AVG32089.1|3671004_3672336_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
AVG32090.1|3672402_3673332_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AVG32091.1|3673424_3673910_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
AVG32092.1|3674131_3674371_-	cell division protein ZapB	NA	NA	NA	NA	NA
AVG32093.1|3674769_3675615_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.6e-15
>prophage 267
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3686448	3687984	4751278		Staphylococcus_phage(100.0%)	1	NA	NA
AVG32106.1|3686448_3687984_-	autoinducer 2 import ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	6.3e-20
>prophage 268
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3701042	3705269	4751278		Feldmannia_irregularis_virus(33.33%)	6	NA	NA
AVG32120.1|3701042_3701741_+	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
AVG32121.1|3701737_3703111_+	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
AVG32122.1|3703158_3703362_-	hypothetical protein	NA	NA	NA	NA	NA
AVG32123.1|3703482_3703878_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
AVG32124.1|3703889_3704642_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AVG32125.1|3704648_3705269_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
>prophage 269
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3735239	3738034	4751278		Escherichia_phage(50.0%)	3	NA	NA
AVG32156.1|3735239_3736043_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.8	7.6e-25
AVG32157.1|3736076_3736973_-	sugar kinase	NA	NA	NA	NA	NA
AVG32158.1|3737137_3738034_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	100.0	1.5e-66
>prophage 270
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3752215	3753265	4751278		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
AVG32172.1|3752215_3753265_+	two-component system sensor histidine kinase NtrB	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	1.5e-09
>prophage 271
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3758622	3761409	4751278		Enterococcus_phage(100.0%)	1	NA	NA
AVG32179.1|3758622_3761409_-	DNA polymerase I	NA	A0A0C5K9B9	Enterococcus_phage	27.0	1.3e-47
>prophage 272
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3773856	3774471	4751278		Streptococcus_phage(100.0%)	1	NA	NA
AVG32188.1|3773856_3774471_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	39.3	6.2e-19
>prophage 273
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3785398	3788833	4751278		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
AVG32197.1|3785398_3786178_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	30.7	1.5e-25
AVG32198.1|3786180_3786729_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
AVG32199.1|3786732_3786987_-	twin-arginine translocase subunit TatA	NA	NA	NA	NA	NA
AVG32200.1|3787192_3788833_-	ubiquinone biosynthesis protein UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	28.5	3.4e-40
>prophage 274
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3803085	3804915	4751278		Catovirus(100.0%)	1	NA	NA
AVG33242.1|3803085_3804915_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.4	3.4e-81
>prophage 275
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3809791	3813708	4751278		Bacillus_phage(100.0%)	3	NA	NA
AVG32221.1|3809791_3811954_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.1	1.7e-116
AVG32222.1|3812089_3812806_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
AVG32223.1|3812805_3813708_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	30.2	2.7e-26
>prophage 276
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3831166	3836670	4751278		Enterobacteria_phage(40.0%)	6	NA	NA
AVG32241.1|3831166_3832297_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	40.9	3.3e-18
AVG32242.1|3832301_3833006_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
AVG32243.1|3832956_3833181_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	52.2	2.0e-07
AVG32244.1|3833213_3834281_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.1	1.4e-98
AVG32245.1|3834280_3835543_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1H3J6	Paramecium_bursaria_Chlorella_virus	27.0	1.2e-24
AVG32246.1|3835539_3836670_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	27.7	2.3e-27
>prophage 277
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3840794	3846215	4751278		Indivirus(33.33%)	5	NA	NA
AVG32250.1|3840794_3841124_-	thiol reductase thioredoxin	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
AVG32251.1|3841267_3842533_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.7	3.7e-42
AVG32252.1|3842541_3842664_+	addiction module toxin RelE	NA	NA	NA	NA	NA
AVG32253.1|3842669_3844151_+	guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase	NA	NA	NA	NA	NA
AVG32254.1|3844190_3846215_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.3	1.1e-112
>prophage 278
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3849655	3849997	4751278		Pseudomonas_phage(100.0%)	1	NA	NA
AVG32259.1|3849655_3849997_-	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	38.5	1.7e-05
>prophage 279
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3855358	3857005	4751278		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AVG32264.1|3855358_3857005_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
>prophage 280
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3872384	3876382	4751278		Staphylococcus_phage(50.0%)	3	NA	NA
AVG32275.1|3872384_3873890_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	24.6	5.1e-14
AVG32276.1|3873897_3874317_-	D-ribose pyranase	NA	NA	NA	NA	NA
AVG32277.1|3874513_3876382_-	low affinity potassium transport system protein kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	1.5e-63
>prophage 281
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3879675	3880668	4751278		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
AVG32280.1|3879675_3880668_-	asparagine synthetase A	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.3	3.2e-49
>prophage 282
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3893552	3896941	4751278		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
AVG32293.1|3893552_3894923_+	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	38.7	1.5e-36
AVG32294.1|3895111_3896941_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.5	1.4e-130
>prophage 283
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3901350	3908242	4751278		Cyanophage(33.33%)	7	NA	NA
AVG32298.1|3901350_3902391_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	35.9	1.2e-46
AVG32299.1|3902526_3903486_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
AVG32300.1|3903485_3904376_+	phosphate ABC transporter permease PtsA	NA	NA	NA	NA	NA
AVG33248.1|3904462_3905236_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.6	2.0e-14
AVG32301.1|3905250_3905976_+	phosphate transport system regulator PhoU	NA	NA	NA	NA	NA
AVG32302.1|3906070_3906736_-	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
AVG32303.1|3906778_3908242_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.1	2.0e-63
>prophage 284
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3915235	3925026	4751278		Staphylococcus_phage(25.0%)	9	NA	NA
AVG32309.1|3915235_3915493_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
AVG32310.1|3915456_3915816_-	ribonuclease P protein component	NA	NA	NA	NA	NA
AVG32311.1|3915832_3915973_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
AVG32312.1|3916633_3918034_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
AVG32313.1|3918038_3919139_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	34.7	4.1e-53
AVG32314.1|3919286_3920360_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
AVG32315.1|3920388_3922803_+	DNA gyrase subunit B	NA	G3M9Z3	Bacillus_virus	34.6	2.2e-115
AVG32316.1|3922821_3923718_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AVG32317.1|3923832_3925026_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	31.8	8.0e-47
>prophage 285
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3929876	3943687	4751278		Oenococcus_phage(20.0%)	10	NA	NA
AVG32323.1|3929876_3931025_+	D-galactonate dehydratase	NA	Q6A202	Oenococcus_phage	33.4	8.0e-52
AVG32324.1|3931109_3932447_+	MFS transporter	NA	NA	NA	NA	NA
AVG32325.1|3932472_3935208_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.5	5.6e-35
AVG32326.1|3935287_3936328_+	TMAO reductase system protein TorT	NA	NA	NA	NA	NA
AVG33250.1|3936300_3936993_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	3.8e-17
AVG32327.1|3937122_3938307_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
AVG32328.1|3938296_3940849_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.7	4.8e-73
AVG32329.1|3940841_3941474_+	molecular chaperone TorD	NA	NA	NA	NA	NA
AVG32330.1|3941663_3943064_+	cytochrome-c peroxidase	NA	NA	NA	NA	NA
AVG33251.1|3943069_3943687_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	1.1e-10
>prophage 286
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3951330	3952281	4751278		Cyanophage(50.0%)	2	NA	NA
AVG33252.1|3951330_3951744_+	heat-shock protein IbpA	NA	A0A1D7SU06	Cyanophage	37.0	1.0e-17
AVG33253.1|3951852_3952281_+	heat-shock protein IbpB	NA	A0A1D8KPX5	Synechococcus_phage	38.2	1.7e-15
>prophage 287
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3960784	3965741	4751278		Salmonella_phage(50.0%)	6	NA	NA
AVG32347.1|3960784_3961969_-	multidrug transporter EmrD	NA	S4TR35	Salmonella_phage	24.1	1.7e-12
AVG32348.1|3962171_3963032_-	EamA family transporter	NA	NA	NA	NA	NA
AVG32349.1|3963124_3963214_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
AVG32350.1|3963669_3963861_-	hypothetical protein	NA	NA	NA	NA	NA
AVG32351.1|3963847_3963946_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
AVG32352.1|3964052_3965741_+	acetolactate synthase large subunit	NA	G8DDL3	Micromonas_pusilla_virus	30.7	4.2e-57
>prophage 288
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3984332	3985715	4751278		Pandoravirus(100.0%)	1	NA	NA
AVG32373.1|3984332_3985715_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	29.1	1.2e-41
>prophage 289
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	3994079	4000116	4751278	transposase	Sodalis_phage(33.33%)	4	NA	NA
AVG32382.1|3994079_3995021_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	53.4	4.7e-66
AVG33255.1|3995063_3995966_-	EamA family transporter	NA	NA	NA	NA	NA
AVG32383.1|3996474_3997170_+	protein MgtC	NA	G3MA03	Bacillus_virus	42.4	2.8e-15
AVG32384.1|3997389_4000116_+	magnesium-translocating P-type ATPase	NA	M1HXH2	Paramecium_bursaria_Chlorella_virus	24.8	4.2e-35
>prophage 290
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4004029	4011649	4751278		Escherichia_phage(33.33%)	5	NA	NA
AVG32390.1|4004029_4006897_-	intestinal colonization autotransporter adhesin MisL	NA	A0A2L1IV18	Escherichia_phage	44.1	3.3e-94
AVG32391.1|4006971_4007589_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AVG32392.1|4008887_4009925_-	hydroxyacid dehydrogenase	NA	Q9JMN3	Wolbachia_phage	43.4	7.2e-68
AVG32393.1|4010111_4010462_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AVG32394.1|4010458_4011649_-	ATP-binding protein	NA	C7BGE8	Burkholderia_phage	34.3	1.2e-10
>prophage 291
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4019014	4020406	4751278		environmental_Halophage(100.0%)	1	NA	NA
AVG32399.1|4019014_4020406_-	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	95.9	6.7e-69
>prophage 292
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4025476	4030502	4751278		Bordetella_phage(33.33%)	4	NA	NA
AVG32404.1|4025476_4027588_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis(diphosphate) 3'-diphosphatase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
AVG32405.1|4027606_4027882_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AVG32406.1|4027936_4028560_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.6	2.8e-19
AVG32407.1|4028816_4030502_+	DNA ligase B	NA	F8SJM3	Pseudomonas_phage	21.8	4.8e-21
>prophage 293
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4036480	4041034	4751278		Xanthomonas_phage(25.0%)	7	NA	NA
AVG33258.1|4036480_4036936_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	60.1	1.2e-48
AVG32416.1|4036916_4038137_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.8	5.5e-43
AVG32417.1|4038312_4038978_+	JAB domain-containing protein	NA	NA	NA	NA	NA
AVG32418.1|4039195_4039432_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
AVG32419.1|4039452_4039620_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
AVG32420.1|4039717_4040527_+	formamidopyrimidine-DNA glycosylase	NA	F8WPX6	Bacillus_phage	31.9	1.0e-24
AVG32421.1|4040554_4041034_-	phosphopantetheine adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.2e-28
>prophage 294
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4055409	4065110	4751278		Prochlorococcus_phage(16.67%)	9	NA	NA
AVG32435.1|4055409_4056342_-	ADP-L-glycero-D-mannoheptose-6-epimerase	NA	R9S880	Prochlorococcus_phage	36.4	8.5e-36
AVG32436.1|4056544_4057741_+	2-amino-3-ketobutyrate CoA ligase	NA	V5LQ39	Emiliania_huxleyi_virus	30.0	1.9e-35
AVG32437.1|4057750_4058776_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
AVG32438.1|4059269_4060304_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.3	1.1e-07
AVG32439.1|4060290_4061253_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AVG32440.1|4061256_4062540_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	30.3	6.1e-08
AVG32441.1|4062549_4064094_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AVG32442.1|4064341_4064773_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AVG32443.1|4064858_4065110_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	53.4	2.2e-15
>prophage 295
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4088917	4090768	4751278	tRNA	Tupanvirus(100.0%)	1	NA	NA
AVG32465.1|4088917_4090768_+|tRNA	selenocysteinyl-tRNA-specific translation elongation factor SelB	tRNA	A0A2K9KZ60	Tupanvirus	24.3	6.5e-11
>prophage 296
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4117214	4118210	4751278		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AVG32489.1|4117214_4118210_-	O-acetyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	27.1	2.8e-13
>prophage 297
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4122072	4131256	4751278		Macacine_betaherpesvirus(25.0%)	11	NA	NA
AVG32494.1|4122072_4122264_+	hypothetical protein	NA	A0A2I6AZV9	Macacine_betaherpesvirus	69.8	1.5e-19
AVG32495.1|4122435_4122903_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AVG32496.1|4123080_4123368_+	hypothetical protein	NA	NA	NA	NA	NA
AVG32497.1|4123355_4123841_+	N-acetyltransferase	NA	NA	NA	NA	NA
AVG32498.1|4124212_4124752_-	hypothetical protein	NA	NA	NA	NA	NA
AVG32499.1|4124925_4125138_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
AVG32500.1|4125426_4125717_-	transcriptional regulator	NA	NA	NA	NA	NA
AVG32501.1|4126154_4126865_+	DUF3053 domain-containing protein	NA	NA	NA	NA	NA
AVG32502.1|4126914_4127889_-	bifunctional glyoxylate/hydroxypyruvate reductase B	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	27.1	5.4e-17
AVG32503.1|4128107_4128770_-	OmpA family lipoprotein	NA	NA	NA	NA	NA
AVG32504.1|4128922_4131256_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	30.4	9.8e-73
>prophage 298
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4149238	4151232	4751278		Planktothrix_phage(50.0%)	2	NA	NA
AVG32520.1|4149238_4150222_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.3	3.3e-14
AVG32521.1|4150218_4151232_+	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.9	9.6e-17
>prophage 299
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4179950	4180853	4751278		Burkholderia_virus(100.0%)	1	NA	NA
AVG32541.1|4179950_4180853_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.5	3.4e-05
>prophage 300
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4195567	4197610	4751278		Indivirus(100.0%)	1	NA	NA
AVG32554.1|4195567_4197610_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.2	3.6e-47
>prophage 301
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4205854	4208596	4751278		Staphylococcus_phage(100.0%)	1	NA	NA
AVG32562.1|4205854_4208596_+	ABC transporter ATP-binding protein/permease	NA	A0A2H4PQG7	Staphylococcus_phage	29.5	4.6e-21
>prophage 302
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4213976	4225639	4751278		Dickeya_phage(28.57%)	12	NA	NA
AVG33263.1|4213976_4214642_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	55.3	2.1e-57
AVG33264.1|4214811_4215057_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	6.1e-10
AVG32568.1|4215080_4216724_-	methyl-accepting chemotaxis citrate transducer	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	1.9e-14
AVG32569.1|4216923_4219122_-	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	35.8	7.2e-110
AVG32570.1|4219202_4219829_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	64.6	3.8e-32
AVG32571.1|4219970_4220342_+	DUF2500 domain-containing protein	NA	NA	NA	NA	NA
AVG32572.1|4220363_4220636_-	DUF1145 domain-containing protein	NA	NA	NA	NA	NA
AVG32573.1|4220622_4221219_-	16S rRNA (guanine(966)-N(2))-methyltransferase	NA	NA	NA	NA	NA
AVG32574.1|4221344_4222820_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
AVG32575.1|4222822_4223491_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	24.6	1.9e-13
AVG32576.1|4223483_4224539_+	cell division protein FtsX	NA	NA	NA	NA	NA
AVG32577.1|4224784_4225639_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	42.3	7.0e-45
>prophage 303
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4231430	4232913	4751278		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
AVG32584.1|4231430_4232198_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.4	7.5e-14
AVG32585.1|4232199_4232913_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	3.7e-15
>prophage 304
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4236698	4238506	4751278		Planktothrix_phage(50.0%)	2	NA	NA
AVG32590.1|4236698_4237769_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.5	2.0e-20
AVG32591.1|4237765_4238506_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	24.6	3.2e-09
>prophage 305
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4259905	4262353	4751278		Dickeya_phage(100.0%)	1	NA	NA
AVG32610.1|4259905_4262353_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	82.1	3.6e-33
>prophage 306
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4276586	4279702	4751278		Halovirus(50.0%)	2	NA	NA
AVG32621.1|4276586_4278140_+	TROVE domain-containing protein	NA	R4TL80	Halovirus	25.5	5.8e-29
AVG32622.1|4278487_4279702_+	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	60.6	5.5e-136
>prophage 307
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4284800	4287194	4751278		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
AVG32627.1|4284800_4287194_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	39.1	1.8e-13
>prophage 308
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4293254	4294169	4751278	transposase	Sodalis_phage(100.0%)	1	NA	NA
AVG32633.1|4293254_4294169_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	45.5	3.7e-68
>prophage 309
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4300781	4304544	4751278		Bacillus_phage(66.67%)	3	NA	NA
AVG32640.1|4300781_4301501_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
AVG32641.1|4301497_4302850_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	22.9	9.5e-12
AVG32642.1|4302924_4304544_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	53.3	1.2e-141
>prophage 310
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4321582	4322419	4751278		Vibrio_phage(100.0%)	1	NA	NA
AVG32657.1|4321582_4322419_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	48.7	1.9e-66
>prophage 311
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4340051	4344048	4751278		Acinetobacter_phage(50.0%)	3	NA	NA
AVG32670.1|4340051_4340615_+	glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	4.2e-62
AVG32671.1|4340700_4341918_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AVG32672.1|4341960_4344048_-	hypothetical protein	NA	H9YQA8	environmental_Halophage	89.1	4.2e-67
>prophage 312
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4348634	4350542	4751278		Tupanvirus(100.0%)	1	NA	NA
AVG32680.1|4348634_4350542_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.7	8.5e-75
>prophage 313
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4356500	4362071	4751278		uncultured_Caudovirales_phage(33.33%)	7	NA	NA
AVG32689.1|4356500_4356887_+	sulfurtransferase TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	1.8e-19
AVG32690.1|4356886_4357243_+	sulfurtransferase TusC	NA	NA	NA	NA	NA
AVG32691.1|4357250_4357538_+	sulfurtransferase TusB	NA	NA	NA	NA	NA
AVG32692.1|4357663_4358038_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
AVG32693.1|4358133_4358604_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
AVG32694.1|4358700_4360815_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	8.1e-58
AVG32695.1|4360886_4362071_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.5	2.6e-13
>prophage 314
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4381964	4386284	4751278	tRNA	Prochlorococcus_phage(33.33%)	6	NA	NA
AVG32735.1|4381964_4382912_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	8.4e-07
AVG32736.1|4382927_4383437_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	6.7e-19
AVG32737.1|4383568_4384693_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
AVG32738.1|4384664_4385138_+	hypothetical protein	NA	NA	NA	NA	NA
AVG32739.1|4385164_4385707_+	DNA topoisomerase	NA	NA	NA	NA	NA
AVG32740.1|4385711_4386284_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	A0A291ATS8	Pandoravirus	27.3	9.9e-11
>prophage 315
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4400219	4403601	4751278		Bacillus_virus(50.0%)	3	NA	NA
AVG32747.1|4400219_4402319_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	33.5	7.1e-22
AVG32748.1|4402469_4402634_-	DUF2556 domain-containing protein	NA	NA	NA	NA	NA
AVG32749.1|4402716_4403601_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	32.8	1.3e-25
>prophage 316
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4415696	4416740	4751278		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AVG32762.1|4415696_4416740_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 317
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4435191	4436460	4751278		Oenococcus_phage(100.0%)	1	NA	NA
AVG32780.1|4435191_4436460_+	cation transporter	NA	Q6A201	Oenococcus_phage	33.0	1.1e-59
>prophage 318
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4443470	4444838	4751278	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVG32788.1|4443470_4444838_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.5	2.1e-22
>prophage 319
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4448806	4452841	4751278	protease	Pseudomonas_phage(50.0%)	4	NA	NA
AVG32794.1|4448806_4449307_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.8	2.5e-26
AVG32795.1|4449415_4450207_+	transcriptional regulator NanR	NA	NA	NA	NA	NA
AVG32796.1|4450341_4451235_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
AVG32797.1|4451350_4452841_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	21.9	7.8e-07
>prophage 320
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4457631	4458735	4751278		Salmonella_phage(100.0%)	1	NA	NA
AVG32803.1|4457631_4458735_-	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	88.1	1.9e-74
>prophage 321
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4465501	4480407	4751278		Staphylococcus_phage(28.57%)	17	NA	NA
AVG32806.1|4465501_4466431_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	34.2	1.5e-16
AVG32807.1|4466524_4468861_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.6	2.7e-38
AVG32808.1|4469087_4469741_+	isoprenoid biosynthesis protein ElbB	NA	NA	NA	NA	NA
AVG32809.1|4469737_4470466_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AVG32810.1|4470540_4471173_-	hypothetical protein	NA	NA	NA	NA	NA
AVG32811.1|4471421_4471694_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AVG32812.1|4471690_4472545_-	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
AVG32813.1|4472590_4473082_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AVG32814.1|4473199_4473487_-	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
AVG32815.1|4473509_4474943_-	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
AVG32816.1|4474990_4475716_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	7.1e-22
AVG32817.1|4475722_4476277_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AVG32818.1|4476245_4476821_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AVG32819.1|4476817_4477384_-	3-deoxy-D-manno-octulosonate 8-phosphate phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	74.3	3.6e-53
AVG32820.1|4477404_4478391_-	arabinose 5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.2	1.1e-38
AVG32821.1|4478404_4479382_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
AVG32822.1|4479594_4480407_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	30.2	9.7e-20
>prophage 322
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4484516	4486007	4751278		Vibrio_phage(50.0%)	2	NA	NA
AVG32828.1|4484516_4484804_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	68.7	3.5e-17
AVG32829.1|4485035_4486007_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	7.8e-08
>prophage 323
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4492729	4495617	4751278	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
AVG32838.1|4492729_4494664_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.3	9.2e-117
AVG32839.1|4494768_4495617_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	30.3	1.4e-21
>prophage 324
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4499087	4505744	4751278		Dickeya_phage(50.0%)	4	NA	NA
AVG32843.1|4499087_4500431_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.1	9.0e-63
AVG32844.1|4501046_4501511_+	ribosome maturation factor	NA	NA	NA	NA	NA
AVG32845.1|4501538_4503041_+	transcription termination protein NusA	NA	NA	NA	NA	NA
AVG32846.1|4503065_4505744_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	1.9e-24
>prophage 325
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4511228	4513169	4751278		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AVG32851.1|4511228_4513169_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	7.9e-52
>prophage 326
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4518949	4525598	4751278		Invertebrate_iridovirus(25.0%)	9	NA	NA
AVG32858.1|4518949_4519267_-	GIY-YIG nuclease family protein	NA	S6DF82	Invertebrate_iridovirus	50.0	8.4e-12
AVG32859.1|4519304_4519748_+	hypothetical protein	NA	NA	NA	NA	NA
AVG32860.1|4519727_4520246_-	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	28.2	9.0e-11
AVG32861.1|4520376_4521012_+	hypothetical protein	NA	NA	NA	NA	NA
AVG32862.1|4521078_4521654_-	osmotically-inducible protein OsmY	NA	NA	NA	NA	NA
AVG32863.1|4521663_4522254_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.9	7.1e-12
AVG32864.1|4522275_4522671_-	YraN family protein	NA	NA	NA	NA	NA
AVG32865.1|4522628_4524671_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
AVG32866.1|4524734_4525598_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	42.6	1.5e-50
>prophage 327
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4536285	4537431	4751278		Streptococcus_phage(100.0%)	1	NA	NA
AVG32875.1|4536285_4537431_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	40.6	1.6e-47
>prophage 328
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4543583	4545878	4751278		Tetraselmis_virus(100.0%)	1	NA	NA
AVG32880.1|4543583_4545878_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	9.7e-158
>prophage 329
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4559064	4560033	4751278		Enterobacteria_phage(100.0%)	1	NA	NA
AVG32897.1|4559064_4560033_-	hypothetical protein	NA	I7HPH5	Enterobacteria_phage	34.9	5.0e-39
>prophage 330
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4566224	4583088	4751278	tRNA	Klosneuvirus(14.29%)	16	NA	NA
AVG32903.1|4566224_4567604_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	29.0	3.8e-32
AVG32904.1|4567563_4567746_-	hypothetical protein	NA	NA	NA	NA	NA
AVG32905.1|4568033_4569554_+	PAS domain S-box protein	NA	A0A1B0V854	Salmonella_phage	48.5	6.4e-33
AVG32906.1|4569941_4571507_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.0e-12
AVG32907.1|4571503_4572151_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AVG32908.1|4572382_4573150_+	siderophore-interacting protein	NA	NA	NA	NA	NA
AVG32909.1|4573430_4573937_+	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
AVG32910.1|4574060_4576043_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	9.0e-35
AVG32911.1|4576057_4577803_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
AVG32912.1|4578038_4578254_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
AVG32913.1|4578481_4579495_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
AVG33278.1|4579398_4579668_-	hypothetical protein	NA	NA	NA	NA	NA
AVG32914.1|4579745_4580357_-	acyl-phosphate--glycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
AVG32915.1|4580463_4580823_+	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
AVG32916.1|4580920_4581742_+	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
AVG32917.1|4581846_4583088_-|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	47.9	6.5e-92
>prophage 331
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4588316	4589750	4751278		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AVG32921.1|4588316_4589750_+	bifunctional heptose 7-phosphate kinase/heptose 1-phosphate adenyltransferase	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.0	8.8e-40
>prophage 332
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4593800	4594454	4751278		Staphylococcus_phage(100.0%)	1	NA	NA
AVG32925.1|4593800_4594454_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.8	1.6e-44
>prophage 333
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4600209	4602050	4751278		Ralstonia_phage(50.0%)	2	NA	NA
AVG32932.1|4600209_4601373_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	42.9	1.4e-88
AVG32933.1|4601378_4602050_-	DUF1190 domain-containing protein	NA	A0A173GEW8	Erwinia_phage	44.9	5.7e-34
>prophage 334
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4606450	4608343	4751278		Bacillus_virus(100.0%)	1	NA	NA
AVG32939.1|4606450_4608343_+	DNA topoisomerase 4 subunit B	NA	G3M9Z3	Bacillus_virus	34.8	5.3e-93
>prophage 335
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4611658	4615358	4751278		Stx_converting_phage(50.0%)	3	NA	NA
AVG32944.1|4611658_4612051_+	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	48.1	1.6e-20
AVG32945.1|4612122_4612989_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AVG32946.1|4613099_4615358_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.8	3.0e-87
>prophage 336
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4621196	4626901	4751278		Pseudomonas_phage(33.33%)	5	NA	NA
AVG32952.1|4621196_4623368_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.8	2.0e-104
AVG32953.1|4623570_4623765_+	hypothetical protein	NA	NA	NA	NA	NA
AVG32954.1|4623922_4624378_-	HIT family protein	NA	Q5YEY9	Rock_bream_iridovirus	36.8	2.4e-20
AVG32955.1|4624422_4625877_-	anion permease	NA	NA	NA	NA	NA
AVG32956.1|4626073_4626901_-	2,5-diketo-D-gluconic acid reductase A	NA	A0A2H4PQR8	Staphylococcus_phage	46.0	8.6e-64
>prophage 337
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4632842	4637774	4751278		Diadromus_pulchellus_ascovirus(50.0%)	6	NA	NA
AVG32964.1|4632842_4633727_-	SDR family NAD(P)-dependent oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	48.2	1.5e-66
AVG32965.1|4633850_4634255_-	cytoplasmic protein	NA	NA	NA	NA	NA
AVG32966.1|4634241_4634652_-	hypothetical protein	NA	NA	NA	NA	NA
AVG32967.1|4634743_4635259_+	RNA helicase	NA	NA	NA	NA	NA
AVG32968.1|4635329_4635824_+	TIGR00645 family protein	NA	NA	NA	NA	NA
AVG32969.1|4636130_4637774_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	56.7	1.1e-09
>prophage 338
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4653202	4654675	4751278		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AVG32987.1|4653202_4654675_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.8	7.9e-44
>prophage 339
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4658074	4658953	4751278		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AVG32990.1|4658074_4658953_+	amidohydrolase	NA	M1HPY5	Paramecium_bursaria_Chlorella_virus	27.9	7.8e-07
>prophage 340
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4680859	4681942	4751278		Geobacillus_virus(100.0%)	1	NA	NA
AVG33009.1|4680859_4681942_-	lytic murein transglycosylase	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
>prophage 341
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4699254	4700409	4751278		Staphylococcus_phage(100.0%)	1	NA	NA
AVG33030.1|4699254_4700409_-	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	3.3e-130
>prophage 342
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4706236	4707709	4751278		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AVG33035.1|4706236_4707709_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	32.8	5.8e-47
>prophage 343
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4715725	4716382	4751278		Bacillus_virus(100.0%)	1	NA	NA
AVG33043.1|4715725_4716382_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.2	2.5e-10
>prophage 344
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4727565	4728798	4751278		Catovirus(100.0%)	1	NA	NA
AVG33057.1|4727565_4728798_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.9	1.8e-102
>prophage 345
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4737066	4742770	4751278		Prochlorococcus_phage(50.0%)	4	NA	NA
AVG33066.1|4737066_4739940_+	glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.2	1.8e-262
AVG33067.1|4740165_4740312_+	immunoglobulin	NA	NA	NA	NA	NA
AVG33068.1|4740395_4741289_+	transporter	NA	NA	NA	NA	NA
AVG33069.1|4741336_4742770_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.2	8.8e-32
>prophage 346
CP026976	Salmonella enterica subsp. enterica strain FDAARGOS_54 chromosome, complete genome	4751278	4746755	4750128	4751278		Brevibacillus_phage(50.0%)	3	NA	NA
AVG33078.1|4746755_4747652_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.9	1.0e-30
AVG33079.1|4747675_4748389_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
AVG33080.1|4748394_4750128_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.4	1.4e-63
