The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP006834	Escherichia coli APEC O2-211 chromosome, complete genome	5114241	642802	702679	5114241	transposase,tRNA	uncultured_marine_virus(18.75%)	59	NA	NA
AKK41689.1|642802_644320_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
AKK41690.1|644556_646014_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.6	3.1e-48
AKK41691.1|646072_648220_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
AKK41692.1|648299_649634_-	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
AXF91828.1|649860_650109_+	hypothetical protein	NA	NA	NA	NA	NA
AKK41693.1|649999_651538_-	transcriptional regulator CadC	NA	NA	NA	NA	NA
AXF91829.1|651824_652043_+	hypothetical protein	NA	NA	NA	NA	NA
AKK41694.1|652341_653877_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AKK41695.1|653947_654793_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AKK41696.1|654877_655075_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
AKK41697.1|655086_655575_-	hypothetical protein	NA	NA	NA	NA	NA
AKK41698.1|655571_655949_-	toxin	NA	NA	NA	NA	NA
AKK41699.2|655995_656373_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
AKK41700.1|656451_656673_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
AKK41701.2|656741_657188_-	DNA repair protein RadC	NA	NA	NA	NA	NA
AKK41702.1|657232_657718_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.2	3.8e-11
AKK41703.1|657808_658627_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	1.8e-45
AXF91830.1|658716_658950_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AKK41798.2|658955_659633_-	hypothetical protein	NA	NA	NA	NA	NA
AXF91831.1|659780_660461_-	WYL domain-containing protein	NA	NA	NA	NA	NA
AKK41705.2|660663_661548_-	GTPase	NA	NA	NA	NA	NA
AKK41706.1|661653_662616_+	hypothetical protein	NA	NA	NA	NA	NA
AKK41707.1|662612_663482_-	replication regulatory RepB family protein	NA	NA	NA	NA	NA
AXF91832.1|664157_664337_+	hypothetical protein	NA	NA	NA	NA	NA
AKK41709.1|665482_666214_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AXF91833.1|666409_666655_-	hypothetical protein	NA	NA	NA	NA	NA
AKK41710.1|666723_667176_+	N-acetyltransferase	NA	NA	NA	NA	NA
AXF91834.1|667618_668892_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	1.1e-171
AKK41711.1|669039_671088_+	TonB-dependent siderophore receptor IreA	NA	A0A0P0I887	Acinetobacter_phage	33.5	1.1e-11
AXF91835.1|673648_673840_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.4e-06
AXF91836.1|674818_675358_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AXF91837.1|675427_676636_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
AKK37138.2|676980_677553_+	hypothetical protein	NA	NA	NA	NA	NA
AKK37139.2|677621_677858_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
AXF91838.1|678123_678672_+	hypothetical protein	NA	NA	NA	NA	NA
AXF91839.1|679007_679199_-	osmoprotectant transport activator ProQ	NA	NA	NA	NA	NA
AXF91840.1|681081_681279_-	hypothetical protein	NA	NA	NA	NA	NA
AKK37141.1|682535_683351_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
AKK37142.1|683437_683740_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AXF91841.1|683633_683885_-	hypothetical protein	NA	NA	NA	NA	NA
AXF91842.1|684505_684784_-	pilus assembly protein	NA	NA	NA	NA	NA
AXF91843.1|684820_685012_+	papI protein	NA	NA	NA	NA	NA
AXF91844.1|685037_685220_+	hypothetical protein	NA	NA	NA	NA	NA
AKK37144.1|685206_685521_+	major pilus subunit operon regulatory protein PapB	NA	NA	NA	NA	NA
AKK37145.1|685706_686051_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AKK37146.1|686110_687319_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
AKK37148.1|687757_688426_+	putative tetracyline resistance transcriptional regulator TetC	NA	NA	NA	NA	NA
AKK37149.1|688538_689744_-	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
AKK37150.2|689822_690449_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AKK37151.1|690426_691113_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AKK37152.2|691120_691507_-	amino acid-binding protein	NA	NA	NA	NA	NA
AXF91845.1|691499_691820_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AKK37153.1|692263_693469_+	sodium/glutamate symporter	NA	NA	NA	NA	NA
AKK37154.2|693834_695043_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
AKK37155.2|696118_698650_+	PapC/FimD family outer membrane usher protein	NA	NA	NA	NA	NA
AKK37156.1|698681_700253_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
AKK37157.1|700272_700620_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AKK37158.2|700619_701267_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.1e-21
AXF91846.1|701334_702679_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.3	3.5e-75
>prophage 2
CP006834	Escherichia coli APEC O2-211 chromosome, complete genome	5114241	1808118	1863097	5114241	head,tail,portal,lysis,terminase,integrase,capsid	Enterobacteria_phage(53.03%)	81	1822113:1822128	1835293:1835308
AKK38104.1|1808118_1809189_-|integrase	integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
AKK38105.1|1809166_1809385_-	excisionase	NA	Q77WA4	Escherichia_phage	98.6	1.1e-34
AKK38106.1|1809424_1809592_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	96.4	8.3e-27
AKK38107.2|1809828_1810527_-	DUF1311 domain-containing protein	NA	J9Q6K3	Salmonella_phage	80.6	4.8e-100
AKK38108.2|1810657_1811206_-	ead/Ea22-like family protein	NA	K7PKY4	Enterobacterial_phage	58.2	7.7e-45
AXF91927.1|1811202_1811424_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
AKK38110.1|1811522_1811804_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
AKK38111.1|1811814_1812006_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
AKK38112.1|1811978_1812161_-	DUF1317 family protein	NA	A0A1U8QQC1	Enterobacteria_phage	95.0	2.6e-26
AKK38113.1|1812157_1812838_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.3	9.6e-130
AKK38114.1|1812834_1813620_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
AKK38115.2|1813625_1814042_-	Host-nuclease inhibitor protein gam	NA	C6ZCV5	Enterobacteria_phage	97.8	1.9e-72
AXF92172.1|1813975_1814266_-	host cell division inhibitory peptide Kil	NA	M1FN78	Enterobacteria_phage	100.0	1.4e-42
AKK38118.1|1814345_1814714_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	98.4	2.2e-64
AKK38119.1|1814902_1815784_-	hypothetical protein	NA	NA	NA	NA	NA
AKK38120.2|1815780_1816104_-	antitermination protein	NA	A4KWR8	Enterobacteria_phage	94.3	1.4e-49
AKK38121.1|1816457_1816862_-	hypothetical protein	NA	Q716D7	Shigella_phage	98.5	4.3e-69
AKK38122.1|1816858_1817491_-	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	99.5	1.6e-118
AKK38123.1|1817595_1817811_+	XRE family transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
AKK38124.1|1817930_1818224_+	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
AXF91928.1|1818256_1819156_+	Replication protein O	NA	A0A0K2FJ31	Enterobacteria_phage	99.3	7.9e-172
AKK38125.2|1819152_1819854_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	98.3	1.2e-127
AKK38126.1|1819850_1820141_+	protein ren	NA	O48423	Enterobacteria_phage	92.7	1.1e-42
AKK38128.2|1820196_1820655_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.3e-81
AKK38129.1|1820651_1821179_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
AKK38130.1|1821175_1821352_+	NinE family protein	NA	K7PHE6	Enterobacteria_phage	96.6	3.9e-27
AKK38131.2|1821312_1821696_+	DUF2591 domain-containing protein	NA	Q76H72	Enterobacteria_phage	96.5	1.7e-62
AKK38132.1|1821688_1821883_+	protein ninF	NA	NA	NA	NA	NA
AKK38133.1|1821902_1822265_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	7.3e-60
1822113:1822128	attL	CTGGATAATCTGCAAA	NA	NA	NA	NA
AKK38134.1|1822261_1822402_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
AKK38135.1|1822487_1822871_+	antitermination protein Q	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
AKK38136.1|1823059_1824142_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	78.7	4.4e-161
AKK38137.1|1824730_1824946_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
AKK38138.1|1824945_1825443_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	96.4	2.1e-89
AKK38139.2|1825439_1825907_+|lysis	lysis protein	lysis	Q9AZ06	Salmonella_phage	91.6	4.1e-71
AKK38140.1|1825894_1826047_+	hypothetical protein	NA	Q716B2	Shigella_phage	100.0	2.1e-21
AKK38141.1|1826280_1826691_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	77.8	2.7e-55
AXF91929.1|1826748_1826982_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
AXF91930.1|1827087_1827231_+	DNA-packaging protein	NA	NA	NA	NA	NA
AKK38142.1|1827370_1827916_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
AKK38143.1|1827890_1829816_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
AKK38144.1|1829812_1830019_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AKK38145.1|1830015_1830897_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.6	5.0e-163
AKK38146.1|1831045_1832287_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	42.9	9.1e-94
AKK38147.1|1832288_1832546_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AKK38148.1|1832602_1833181_+	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	63.0	9.2e-57
AXF91931.1|1833212_1834208_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
AKK38150.1|1834200_1834386_+	hypothetical protein	NA	NA	NA	NA	NA
AKK38151.1|1834385_1834577_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	59.3	1.5e-11
AKK38152.1|1834577_1834799_+	hypothetical protein	NA	NA	NA	NA	NA
AKK38153.1|1834816_1835116_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AKK38154.1|1835112_1836867_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.1	6.0e-91
1835293:1835308	attR	CTGGATAATCTGCAAA	NA	NA	NA	NA
AKK38155.2|1837213_1837465_+	hypothetical protein	NA	NA	NA	NA	NA
AKK38156.1|1837461_1837884_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AKK38157.1|1838101_1839142_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.2	3.0e-66
AKK38158.1|1839151_1839493_+|head	head decoration protein	head	NA	NA	NA	NA
AKK38159.1|1839504_1839888_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AXF91932.1|1839880_1840090_+	hypothetical protein	NA	NA	NA	NA	NA
AKK38160.1|1840089_1840632_+|terminase	terminase	terminase	O64316	Escherichia_phage	48.8	3.4e-37
AKK38161.1|1840643_1840925_+	hypothetical protein	NA	NA	NA	NA	NA
AXF91933.1|1841042_1841318_+	hypothetical protein	NA	NA	NA	NA	NA
AKK38162.2|1842494_1843814_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	3.1e-233
AKK38163.1|1843823_1844156_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	1.1e-54
AKK38164.1|1844211_1845237_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
AKK38165.2|1845278_1845674_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	90.9	1.0e-54
AKK38166.1|1845685_1846039_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	7.6e-62
AKK38167.1|1846050_1846629_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	8.6e-79
AKK38168.1|1846625_1847021_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
AKK38169.2|1847028_1847769_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.2	2.5e-131
AKK38170.1|1847784_1848207_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.1e-70
AKK38171.2|1848188_1848623_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AKK38172.1|1848615_1851195_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	97.4	0.0e+00
AKK38173.1|1851191_1851521_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
AKK38174.1|1851520_1852219_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	1.6e-132
AKK38175.1|1852224_1852968_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
AKK38176.2|1852865_1853537_+|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	98.2	3.8e-102
AKK38177.1|1853597_1857095_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	98.0	0.0e+00
AKK38178.1|1857165_1857765_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
AKK38179.1|1857829_1861108_+|tail	phage tail protein	tail	X2KTY7	Enterobacteria_phage	59.2	3.2e-05
AKK38180.1|1861107_1861692_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	3.0e-103
AKK38181.1|1861765_1863097_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
>prophage 3
CP006834	Escherichia coli APEC O2-211 chromosome, complete genome	5114241	2234323	2283686	5114241	head,plate,tail,portal,transposase,protease,terminase,tRNA,holin,integrase,capsid	Shigella_phage(47.27%)	68	2234949:2234966	2253658:2253675
AKK38524.1|2234323_2235430_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
2234949:2234966	attL	TTATGGCTGAGCGTATAA	NA	NA	NA	NA
AKK38525.1|2235483_2235945_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AKK38526.1|2235954_2236608_-	23S rRNA pseudouridine synthase E	NA	NA	NA	NA	NA
AKK38527.1|2236779_2238030_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
AKK41741.2|2238431_2239778_+	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
AKK38528.1|2240485_2241601_+	hypothetical protein	NA	A0A2D1GR68	Pseudomonas_phage	39.0	3.6e-25
AKK38529.1|2241812_2242940_-|integrase	integrase	integrase	O21925	Phage_21	61.2	2.5e-122
AXF91954.1|2242920_2243166_-	excisionase	NA	NA	NA	NA	NA
AKK38530.2|2243221_2243758_-	HD family hydrolase	NA	A5LH62	Enterobacteria_phage	92.6	1.8e-91
AKK38531.1|2243886_2244711_-	DUF2303 family protein	NA	U5P439	Shigella_phage	98.5	1.5e-148
AKK38532.1|2244776_2245139_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	2.5e-60
AXF91955.1|2245418_2245760_+	hypothetical protein	NA	NA	NA	NA	NA
AKK38533.1|2245697_2246006_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	5.0e-09
AKK38534.1|2246179_2246854_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
AKK38535.2|2246944_2247145_+	transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.9e-30
AKK38536.1|2247188_2247740_+	protein YmfL	NA	S5FXP0	Shigella_phage	98.4	2.2e-100
AXF91956.1|2247915_2248095_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
AKK38538.1|2248084_2249026_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.0	4.9e-140
AKK38539.1|2249022_2249517_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	96.9	1.8e-85
AKK38540.1|2249516_2250170_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	4.0e-125
AKK38541.1|2250166_2250493_+	LexA family transcriptional regulator	NA	A5LH73	Enterobacteria_phage	99.1	3.5e-53
AKK38542.1|2250489_2250879_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	97.7	1.0e-67
AKK38543.1|2250898_2251696_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	100.0	5.2e-151
AKK38544.2|2251703_2252693_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	3.3e-195
AKK38545.1|2252710_2253067_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	92.0	2.3e-58
AKK38546.1|2253046_2254261_-	hypothetical protein	NA	NA	NA	NA	NA
2253658:2253675	attR	TTATGGCTGAGCGTATAA	NA	NA	NA	NA
AKK38547.1|2254263_2255439_-	hypothetical protein	NA	NA	NA	NA	NA
AKK38548.1|2255730_2256057_+|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	99.1	1.2e-56
AKK38549.1|2256060_2256537_+	lysozyme	NA	K7PKX1	Enterobacterial_phage	96.8	8.6e-85
AXF91957.1|2256753_2256936_+	hypothetical protein	NA	K7PHU6	Enterobacteria_phage	96.7	3.2e-16
AKK38551.1|2257029_2257320_-	increased serum survival lipoprotein Iss	NA	C6ZCX3	Enterobacteria_phage	91.7	1.0e-43
AXF91958.1|2257412_2257553_+	Rz1 lytic protein	NA	U5P461	Shigella_phage	81.0	3.5e-10
AXF91959.1|2257844_2258195_+	HNH endonuclease	NA	Q8HA82	Salmonella_phage	94.8	2.0e-62
AKK38552.2|2258311_2258815_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	100.0	1.4e-88
AKK38553.1|2258811_2260545_+|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.8	0.0e+00
AKK38554.1|2260556_2260739_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
AKK38555.1|2260738_2261980_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
AXF91960.1|2261921_2262608_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	1.1e-125
AKK38556.1|2262622_2263828_+|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.5	9.1e-224
AKK38557.1|2263876_2264077_+	hypothetical protein	NA	S5FNU1	Shigella_phage	95.5	3.2e-25
AKK38558.1|2264079_2264403_+|head,tail	phage gp6-like head-tail connector protein	head,tail	S5FKK6	Shigella_phage	100.0	5.1e-57
AKK38559.1|2264399_2264810_+|head,tail	head-tail adaptor protein	head,tail	M1FJ87	Enterobacteria_phage	100.0	3.1e-75
AKK38560.1|2264784_2265291_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	3.2e-90
AKK38561.1|2265287_2265848_+	hypothetical protein	NA	Q8SBH4	Shigella_phage	99.5	1.8e-105
AKK38562.1|2265856_2266027_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	2.7e-25
AKK38563.1|2266010_2267507_+|tail	phage tail protein	tail	M1FN90	Enterobacteria_phage	99.4	7.0e-274
AKK38564.1|2267506_2267863_+|tail	phage tail protein	tail	U5P076	Shigella_phage	99.2	9.0e-63
AKK38565.1|2267862_2268132_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
AXF91961.1|2268098_2268281_+	hypothetical protein	NA	NA	NA	NA	NA
AKK38566.1|2268273_2270109_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.0	1.9e-305
AKK38567.2|2270127_2271498_+	DNA circularization protein	NA	S5FUX4	Shigella_phage	97.8	9.0e-252
AKK38568.1|2271494_2272574_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	98.6	2.5e-204
AKK38569.1|2272573_2273122_+|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	98.9	5.1e-97
AKK38570.2|2273118_2273547_+|tail	phage tail protein	tail	U5P0R9	Shigella_phage	99.3	2.6e-80
AKK38571.1|2273533_2274592_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	98.6	4.7e-200
AKK38572.1|2274582_2275167_+	DUF2313 domain-containing protein	NA	O22003	Shigella_phage	97.9	1.7e-111
AKK38573.1|2275170_2276094_+	hypothetical protein	NA	U5P0I1	Shigella_phage	98.1	4.2e-51
AXF91962.1|2276068_2276272_+	hypothetical protein	NA	NA	NA	NA	NA
AKK38574.1|2276237_2276846_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	87.3	7.6e-94
AKK38575.1|2276845_2277343_-|tail	phage tail protein	tail	Q9MCR6	Enterobacteria_phage	68.9	1.5e-55
AXF91963.1|2277373_2277565_+	DNA invertase	NA	A0A1S6L009	Salmonella_phage	83.3	1.9e-14
AKK38576.1|2277598_2279488_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AKK38577.2|2280303_2280495_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	4.4e-24
AKK38578.1|2280595_2280919_-	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	65.4	3.0e-41
AXF91964.1|2281389_2281596_+	hypothetical protein	NA	NA	NA	NA	NA
AKK38579.1|2281501_2282011_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	3.2e-13
AKK38580.1|2282329_2282734_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
AKK38581.1|2282954_2283686_-	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.5	3.5e-53
>prophage 4
CP006834	Escherichia coli APEC O2-211 chromosome, complete genome	5114241	2483246	2587882	5114241	tail,transposase,lysis,coat,protease,terminase,tRNA,holin	Escherichia_phage(38.18%)	106	NA	NA
AKK38758.2|2483246_2484479_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
AKK38759.1|2484733_2485717_+	zinc transporter ZntB	NA	NA	NA	NA	NA
AXF91982.1|2485991_2486165_+	hypothetical protein	NA	NA	NA	NA	NA
AKK38760.1|2486194_2487568_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.4	5.1e-53
AKK38761.1|2487696_2488632_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
AKK38762.1|2488683_2489919_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
AKK38763.2|2489920_2490136_-	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
AKK38764.2|2490214_2490424_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
AXF92179.1|2490416_2490611_-	restriction alleviation and modification enhancement protein	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
AXF91983.1|2490667_2491477_-	DNA recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
AKK38765.1|2491469_2494070_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	3.0e-248
AKK38766.2|2494171_2494447_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
AKK38767.2|2494521_2494692_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
AKK38768.1|2494691_2494913_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
AKK38769.2|2495353_2495842_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
AKK38770.1|2495838_2495994_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
AKK38771.1|2496004_2496184_-	hypothetical protein	NA	NA	NA	NA	NA
AKK38772.1|2496393_2496813_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
AKK38773.1|2496913_2497195_+	Cro/Cl family transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	71.2	1.9e-23
AKK38774.1|2497178_2497604_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AKK38775.1|2497675_2498746_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	64.6	4.7e-62
AKK38776.1|2498786_2499209_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
AKK38777.1|2499543_2501547_+|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	26.2	3.4e-21
AKK38778.1|2501610_2502888_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
AKK38779.1|2503018_2503900_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AKK38780.1|2503896_2504589_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
AKK38781.1|2504600_2505800_-	MFS transporter	NA	NA	NA	NA	NA
AXF91984.1|2506161_2506305_+	hypothetical protein	NA	NA	NA	NA	NA
AKK38782.1|2506463_2506676_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	75.7	3.0e-21
AXF91985.1|2507026_2507242_+	hypothetical protein	NA	NA	NA	NA	NA
AKK38783.1|2507144_2507744_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
AKK38784.1|2507743_2508034_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
AKK38785.1|2508030_2508573_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	2.9e-76
AXF91986.1|2509892_2511166_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
AKK38786.2|2511553_2511928_+	tolA family protein	NA	NA	NA	NA	NA
AKK38787.1|2512179_2512395_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
AKK38788.1|2512394_2512892_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	3.2e-90
AXF91987.1|2513108_2513294_+	hypothetical protein	NA	K7PHU6	Enterobacteria_phage	96.5	3.6e-15
AKK38790.1|2513490_2514948_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
AXF91988.1|2514886_2515168_+	hypothetical protein	NA	NA	NA	NA	NA
AKK38791.1|2515085_2515877_+	transcriptional regulator	NA	R4TG31	Halovirus	40.2	2.8e-48
AKK38792.2|2515869_2516802_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	55.2	2.2e-84
AKK41746.1|2516779_2516989_+	hypothetical protein	NA	NA	NA	NA	NA
AKK38793.1|2516992_2518087_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	5.9e-113
AKK38794.2|2518067_2519369_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
AKK38795.1|2519371_2520778_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.0	3.0e-186
AKK38796.2|2520761_2521874_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	4.2e-114
AKK38797.2|2521978_2522743_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	63.8	2.0e-83
AKK38798.2|2522841_2523981_+|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	75.0	7.4e-159
AKK38800.1|2524203_2524599_+	protein singed	NA	NA	NA	NA	NA
AKK38801.1|2524598_2524982_+	glutamate 5-kinase	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
AKK38802.1|2524982_2525363_+	HK97 gp10 family phage protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
AKK38803.1|2525359_2525752_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
AKK38804.1|2525778_2526741_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	5.8e-56
AKK38805.1|2526801_2527353_+	hypothetical protein	NA	NA	NA	NA	NA
AKK38806.2|2527358_2527559_+	hypothetical protein	NA	NA	NA	NA	NA
AKK38807.1|2527724_2530958_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	33.3	1.3e-104
AKK38808.1|2530950_2531289_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
AKK38809.1|2531288_2531987_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.1	9.6e-125
AKK38810.1|2531992_2532736_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	8.0e-146
AKK41747.2|2532633_2533281_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.9	1.4e-109
AKK38811.1|2533341_2536755_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	98.0	0.0e+00
AKK38812.1|2536824_2537424_+	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	5.7e-110
AXF92180.1|2537488_2540887_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	36.4	8.2e-12
AKK38813.1|2540886_2541462_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
AKK38814.1|2541559_2542150_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	9.5e-25
AKK38815.2|2542466_2542700_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AKK38817.2|2543659_2544094_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
AKK38818.1|2544234_2545368_-	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	54.1	1.5e-103
AKK38819.1|2545733_2549258_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
AKK38820.1|2549531_2549798_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AKK38821.1|2549794_2550217_-	heat shock protein HslJ	NA	NA	NA	NA	NA
AKK38822.1|2550327_2551317_-	2-hydroxyacid dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
AKK38823.1|2551524_2554164_+	YdbH family protein	NA	NA	NA	NA	NA
AKK38824.1|2554160_2554346_+	YnbE family lipoprotein	NA	NA	NA	NA	NA
AKK38825.2|2554353_2554680_+	DUF1318 domain-containing protein	NA	NA	NA	NA	NA
AXF92181.1|2554851_2555064_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AXF92182.1|2555028_2555211_+	phenylacetic acid degradation protein PaaX	NA	NA	NA	NA	NA
AKK38827.1|2555192_2555783_+	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
AKK38828.1|2556013_2556874_+	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
AKK38829.1|2558471_2559077_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
AKK38830.1|2559076_2559973_+	hypothetical protein	NA	NA	NA	NA	NA
AKK38831.1|2559988_2561746_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
AKK38832.2|2561759_2563052_+	hypothetical protein	NA	NA	NA	NA	NA
AKK38833.1|2563105_2563711_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AKK38834.1|2563911_2567814_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.7	1.3e-53
AKK38835.1|2568085_2568886_+	YdcF family protein	NA	NA	NA	NA	NA
AKK38836.1|2569082_2570522_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AKK38837.1|2570562_2571564_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AKK38838.2|2571752_2572283_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	4.1e-19
AKK38839.1|2572527_2572701_+	hypothetical protein	NA	A0A0R6PI25	Moraxella_phage	59.6	2.6e-07
AKK38840.1|2572772_2572922_-	type I toxin-antitoxin system hok family toxin	NA	NA	NA	NA	NA
AKK38841.1|2573320_2574961_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
AKK38842.2|2574998_2575922_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AKK38843.1|2576138_2577482_+	VOC family protein	NA	NA	NA	NA	NA
AKK38844.1|2577706_2579362_+	glucan biosynthesis protein D	NA	NA	NA	NA	NA
AXF91989.1|2579282_2579486_-	hypothetical protein	NA	NA	NA	NA	NA
AKK38845.1|2579501_2579726_+	DUF465 domain-containing protein	NA	NA	NA	NA	NA
AKK38846.1|2579788_2580328_+	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
AKK38847.1|2580319_2581300_-	hypothetical protein	NA	NA	NA	NA	NA
AKK38848.1|2581423_2582416_+	TDT family transporter	NA	NA	NA	NA	NA
AKK38849.1|2582412_2583006_+	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
AKK38850.1|2583344_2584013_+	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
AKK38851.2|2584047_2585259_-	benzoate transporter BenE	NA	NA	NA	NA	NA
AKK38852.1|2585311_2585848_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AKK38853.1|2585920_2587882_+|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	27.9	1.6e-23
>prophage 5
CP006834	Escherichia coli APEC O2-211 chromosome, complete genome	5114241	2710280	2743114	5114241	tail,portal,lysis,protease,terminase	Enterobacteria_phage(58.06%)	38	NA	NA
AKK38952.1|2710280_2710862_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	91.7	4.0e-100
AKK38953.2|2710861_2714260_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	9.1e-11
AKK38954.1|2714324_2714924_-	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	93.5	2.5e-105
AXF92001.1|2714991_2718471_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
AKK41748.2|2718531_2719173_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.0	2.5e-95
AKK38955.1|2719070_2719814_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	4.7e-146
AKK38956.1|2719819_2720518_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.7	5.6e-133
AKK38957.1|2720527_2720857_-|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	100.0	1.7e-60
AKK38958.1|2723893_2724223_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
AKK38959.2|2724231_2724618_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	3.6e-65
AKK38960.2|2724678_2725422_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
AKK38961.2|2725433_2725835_-|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
AKK38962.1|2725831_2726410_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	7.2e-102
AKK38963.1|2726421_2726697_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
AKK38964.1|2726689_2727058_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	99.1	6.3e-51
AKK38965.2|2727099_2729127_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.1	0.0e+00
AKK38966.2|2729071_2730580_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.4	1.1e-287
AXF92002.1|2730579_2730792_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
AKK38967.1|2730788_2732888_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	98.9	0.0e+00
AKK38968.1|2732896_2733436_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
AKK38969.1|2733985_2734192_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
AKK38970.2|2734487_2734661_-	protein GnsB	NA	NA	NA	NA	NA
AXF92185.1|2734833_2734989_-	hypothetical protein	NA	NA	NA	NA	NA
AXF92186.1|2735135_2735324_-	cold-shock protein	NA	NA	NA	NA	NA
AKK38971.1|2735334_2735547_-	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.6e-22
AKK38972.1|2735910_2736408_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
AKK38973.1|2736404_2736938_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	8.4e-97
AKK38974.1|2736934_2737246_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	62.6	5.0e-25
AKK38975.1|2737250_2737466_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
AKK38976.2|2737717_2738092_-	tolA family protein	NA	NA	NA	NA	NA
AKK38977.1|2738263_2738692_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
AKK38978.2|2739058_2739187_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	96.4	4.7e-06
AKK38979.2|2739225_2739552_-	hypothetical protein	NA	NA	NA	NA	NA
AKK38980.1|2739908_2740730_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.8e-77
AKK38981.1|2740726_2741101_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
AKK38982.1|2741113_2742163_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	2.7e-107
AXF92187.1|2742164_2742443_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	4.3e-12
AKK38983.1|2742901_2743114_-	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
>prophage 6
CP006834	Escherichia coli APEC O2-211 chromosome, complete genome	5114241	2748311	2762949	5114241		Escherichia_phage(30.0%)	19	NA	NA
AKK38989.1|2748311_2748566_-	DNA-binding protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
AKK38990.1|2748645_2749065_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
AKK38991.2|2749362_2749518_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	3.4e-06
AKK38992.2|2749477_2750095_+	hypothetical protein	NA	NA	NA	NA	NA
AKK38993.1|2750581_2750770_+	division inhibition protein DicB	NA	NA	NA	NA	NA
AKK38994.1|2750766_2750958_+	DUF1482 family protein	NA	NA	NA	NA	NA
AKK38995.1|2751051_2753523_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
AXF92004.1|2753595_2753847_+	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
AKK38996.2|2753866_2755162_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.3	6.7e-156
AXF92005.1|2755163_2755292_-	transporter	NA	NA	NA	NA	NA
AKK38997.1|2755349_2756369_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	3.3e-17
AKK38998.1|2756380_2757595_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AXF92006.1|2757575_2757764_-	hypothetical protein	NA	NA	NA	NA	NA
AKK38999.1|2757800_2758127_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	7.6e-24
AKK39000.1|2758261_2758603_+	DUF1283 family protein	NA	NA	NA	NA	NA
AKK39001.1|2758637_2759198_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AKK39002.2|2759200_2759911_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
AKK39003.2|2760018_2760324_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AKK39004.1|2760522_2762949_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	3.8e-213
>prophage 7
CP006834	Escherichia coli APEC O2-211 chromosome, complete genome	5114241	3245466	3253200	5114241		Enterobacteria_phage(33.33%)	9	NA	NA
AKK39444.1|3245466_3246573_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	32.5	6.5e-43
AKK39445.1|3246565_3247033_-	N-acetyltransferase	NA	NA	NA	NA	NA
AKK39446.2|3247019_3247430_-	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
AKK39447.1|3247447_3248323_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	5.1e-107
AKK39448.1|3248380_3249280_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	8.2e-28
AKK39449.1|3249279_3250365_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	8.0e-102
AXF92050.1|3250437_3250701_+	hypothetical protein	NA	NA	NA	NA	NA
AKK39451.1|3250737_3251631_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.4	2.3e-46
AKK39452.1|3251805_3253200_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	3.7e-19
>prophage 8
CP006834	Escherichia coli APEC O2-211 chromosome, complete genome	5114241	3344517	3353960	5114241		Enterobacteria_phage(85.71%)	10	NA	NA
AKK39521.1|3344517_3345654_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	98.4	5.9e-164
AKK39522.1|3345650_3347651_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.4	0.0e+00
AKK39523.1|3347775_3348237_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
AKK39524.2|3348278_3348749_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AKK39525.2|3348795_3349515_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AKK39526.1|3349511_3351197_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
AKK39527.1|3351418_3352150_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.0	2.2e-111
AKK39528.1|3352209_3352317_+	hypothetical protein	NA	NA	NA	NA	NA
AKK39529.1|3352297_3353029_-	ABC transporter permease	NA	NA	NA	NA	NA
AKK39530.1|3353033_3353960_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 9
CP006834	Escherichia coli APEC O2-211 chromosome, complete genome	5114241	3567567	3642587	5114241	head,tail,portal,lysis,terminase,tRNA,holin	Enterobacteria_phage(54.55%)	97	NA	NA
AKK39719.1|3567567_3568380_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AKK39720.1|3568379_3569393_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AKK39721.1|3569458_3570595_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	8.5e-22
AKK39722.1|3570693_3571689_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
AKK39723.1|3571685_3572864_-	MFS transporter	NA	NA	NA	NA	NA
AXF92064.1|3572805_3573027_+	hypothetical protein	NA	NA	NA	NA	NA
AKK39724.1|3573128_3574349_-	3-oxoacyl-ACP synthase I	NA	NA	NA	NA	NA
AKK39725.1|3574507_3576514_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AKK39726.1|3576634_3576913_-	YfcL family protein	NA	NA	NA	NA	NA
AKK39727.1|3576946_3577495_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AKK39728.1|3577494_3578304_-	hypothetical protein	NA	NA	NA	NA	NA
AKK39729.1|3578303_3579128_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AKK39730.1|3579130_3580216_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
AKK39731.1|3580250_3581183_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AKK39732.1|3581348_3581900_+	endonuclease SmrB	NA	NA	NA	NA	NA
AKK39733.1|3582015_3582858_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
AKK39734.1|3582859_3583384_-	fimbrial protein	NA	NA	NA	NA	NA
AKK39735.1|3583380_3583851_-	fimbrial protein	NA	NA	NA	NA	NA
AKK39736.2|3583847_3584462_-	fimbrial protein	NA	NA	NA	NA	NA
AKK39737.1|3584370_3585120_-	fimbrial protein	NA	NA	NA	NA	NA
AKK39738.1|3587864_3588431_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AKK39739.1|3589091_3589577_-	phosphohistidine phosphatase	NA	NA	NA	NA	NA
AKK39740.1|3589779_3591924_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AKK39741.1|3591923_3593234_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AKK39742.2|3593415_3593700_-	DUF406 family protein	NA	NA	NA	NA	NA
AXF92065.1|3593784_3594036_-	hypothetical protein	NA	NA	NA	NA	NA
AKK39743.2|3594071_3595412_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
AKK39744.1|3595473_3596229_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AXF92066.1|3596254_3596425_-	hypothetical protein	NA	NA	NA	NA	NA
AKK39745.1|3596522_3597455_+	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
AKK39746.1|3597766_3598924_+	DUF4102 domain-containing protein	NA	A5VW56	Enterobacteria_phage	99.7	2.8e-222
AKK41755.1|3599002_3601165_-	hypothetical protein	NA	A5VW57	Enterobacteria_phage	77.5	7.2e-62
AXF92201.1|3601265_3602156_-	phage antirepressor Ant	NA	I6R977	Salmonella_phage	98.6	1.3e-166
AKK41756.1|3602218_3602488_-	hypothetical protein	NA	NA	NA	NA	NA
AKK39747.1|3602484_3602643_-	Arc family DNA-binding protein	NA	I6S1K8	Salmonella_phage	92.3	9.3e-20
AKK39748.1|3602733_3602991_+	Arc family DNA-binding protein	NA	A0A2H4FVY6	Salmonella_phage	97.6	2.0e-40
AKK39749.1|3602983_3603253_+	hypothetical protein	NA	A0A2H4FNC7	Salmonella_phage	100.0	2.9e-45
AKK39750.2|3603421_3603706_+	hypothetical protein	NA	A0A2H4FNB7	Salmonella_phage	98.9	5.9e-41
AKK39751.2|3603796_3604165_+	hypothetical protein	NA	I6S5X4	Salmonella_phage	97.5	5.5e-63
AKK39752.1|3604189_3606028_-	DNA transfer protein	NA	A0A192Y934	Salmonella_phage	74.5	1.4e-247
AKK39753.1|3606027_3607443_-	acyltransferase	NA	I6RSG0	Salmonella_phage	80.7	1.3e-200
AKK39754.1|3607452_3608145_-	DNA transfer protein	NA	A0A2H4FUQ9	Salmonella_phage	96.1	1.3e-113
AKK39755.1|3608147_3608603_-	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	98.7	6.7e-87
AKK39756.1|3608602_3609304_-|tail	phage tail protein	tail	A0A2H4FWI9	Salmonella_phage	98.3	1.6e-79
AKK39757.1|3609303_3610722_-	hypothetical protein	NA	Q716G7	Shigella_phage	99.2	1.2e-275
AKK39758.1|3610731_3611193_-|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
AKK39759.2|3611173_3611362_-	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	100.0	2.9e-28
AKK39760.1|3612676_3613570_-	scaffolding protein	NA	A0A088CPT0	Enterobacteria_phage	99.0	4.3e-130
AKK39761.1|3613660_3615859_-|portal	portal protein	portal	A5VW74	Enterobacteria_phage	97.1	0.0e+00
AKK39762.1|3615860_3617276_-|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	99.6	7.5e-278
AKK39763.2|3617272_3617695_-	ubiquitin carboxyl-hydrolase	NA	Q716H4	Shigella_phage	100.0	7.2e-75
AKK39764.1|3617718_3617898_-	hypothetical protein	NA	A0A088CPS9	Enterobacteria_phage	96.6	5.4e-24
AKK39765.1|3617899_3618142_-	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
AKK39766.1|3618245_3618626_-	hypothetical protein	NA	Q716B1	Shigella_phage	99.2	1.4e-66
AKK39767.2|3618909_3619428_-	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	99.4	7.2e-93
AKK39768.2|3619630_3619783_-	hypothetical protein	NA	Q716B2	Shigella_phage	98.0	6.2e-21
AKK39769.1|3619770_3620238_-|lysis	lysis protein	lysis	Q9AZ06	Salmonella_phage	93.5	2.8e-72
AKK39770.1|3620234_3620711_-	lysozyme	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
AKK39771.1|3620694_3621018_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
AKK39772.1|3621684_3622308_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
AKK39773.1|3622304_3622493_-	protein ninH	NA	K7PH29	Enterobacteria_phage	100.0	1.9e-27
AKK39774.1|3622489_3622852_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
AKK39775.1|3622848_3623139_-	DUF1364 domain-containing protein	NA	Q9MCN9	Enterobacteria_phage	97.9	4.2e-50
AKK39776.1|3623138_3623408_-	hypothetical protein	NA	K7PHK7	Enterobacteria_phage	100.0	7.1e-44
AKK39777.1|3623400_3623577_-	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
AKK39778.2|3623569_3624520_-	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	47.0	8.2e-95
AKK39779.1|3624516_3624693_-	NinE family protein	NA	K7PHE6	Enterobacteria_phage	100.0	2.7e-28
AKK39780.1|3624689_3625217_-	phage N-6-adenine-methyltransferase	NA	Q8H9Z7	Enterobacteria_phage	99.4	3.6e-100
AKK39781.2|3625213_3625672_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.3e-81
AKK39783.1|3625727_3627104_-	replicative DNA helicase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
AKK39784.2|3627100_3627988_-	replication protein	NA	A5VW95	Enterobacteria_phage	91.5	4.0e-144
AKK39785.1|3628050_3628323_-	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
AKK39786.1|3628345_3628642_-	hypothetical protein	NA	A5VW96	Enterobacteria_phage	96.9	2.1e-44
AKK39787.1|3628760_3628961_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
AKK39788.1|3629061_3629775_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
AKK39789.2|3629941_3630760_+	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	46.2	3.3e-36
AKK39790.2|3631241_3631565_+	antitermination protein	NA	K7P718	Enterobacteria_phage	100.0	1.0e-52
AKK39791.2|3631557_3632052_-	hypothetical protein	NA	K7P861	Enterobacteria_phage	99.4	1.4e-85
AKK39792.1|3632308_3632677_+	lambda prophage-derived protein ea10	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
AKK39793.2|3632752_3632887_+	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
AKK39794.1|3632871_3633024_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
AKK39796.1|3633108_3633417_+	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	100.0	1.1e-53
AKK39797.1|3633413_3634325_+	DNA recombinase	NA	K7PKG9	Enterobacteria_phage	99.7	2.2e-169
AKK39798.1|3634308_3634791_+	hypothetical protein	NA	K7P6T5	Enterobacteria_phage	99.4	8.4e-80
AKK39799.1|3634802_3635117_+	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	100.0	1.2e-50
AKK39800.1|3635133_3635301_+	DUF2737 family protein	NA	K7PJY9	Enterobacterial_phage	100.0	1.3e-24
AKK39801.1|3635297_3635843_+	hypothetical protein	NA	J9Q748	Salmonella_phage	83.8	4.9e-84
AKK39802.1|3635839_3636139_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	96.0	5.3e-56
AXF92067.1|3636140_3636548_+	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	97.0	6.3e-68
AKK39803.1|3636549_3636741_+	hypothetical protein	NA	A0A2I6TD51	Escherichia_phage	100.0	2.1e-26
AKK39804.1|3636743_3637394_+	DUF550 domain-containing protein	NA	K7P7E3	Enterobacteria_phage	57.9	1.3e-54
AKK39805.1|3637555_3637867_+	hypothetical protein	NA	Q9G076	Enterobacteria_phage	97.1	1.9e-53
AKK39806.1|3637975_3638176_+	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
AXF92202.1|3638472_3638625_+	hypothetical protein	NA	NA	NA	NA	NA
AKK39808.1|3638704_3639952_-	MFS transporter	NA	NA	NA	NA	NA
AKK39809.1|3640023_3640938_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
AKK39810.1|3641153_3642587_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.0	9.1e-29
>prophage 10
CP006834	Escherichia coli APEC O2-211 chromosome, complete genome	5114241	3979924	3987064	5114241		Escherichia_phage(83.33%)	6	NA	NA
AKK40111.1|3979924_3982486_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	7.8e-31
AKK40112.1|3982591_3983248_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	4.3e-50
AKK40113.2|3983298_3984066_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	7.4e-70
AKK40114.1|3984261_3985170_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
AKK40115.1|3985166_3986429_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
AKK40116.1|3986425_3987064_+	class II aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.8e-82
>prophage 11
CP006834	Escherichia coli APEC O2-211 chromosome, complete genome	5114241	4040994	4109757	5114241	transposase,plate,tRNA	uncultured_marine_virus(16.67%)	54	NA	NA
AKK40168.1|4040994_4042203_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
AKK40170.1|4043393_4046150_+	signal transduction histidine kinase	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
AKK40171.1|4046380_4047721_-	glucarate dehydratase	NA	NA	NA	NA	NA
AKK40172.1|4047741_4049082_-	glucarate dehydratase	NA	NA	NA	NA	NA
AKK40173.1|4049083_4050436_-	MFS transporter	NA	NA	NA	NA	NA
AKK40174.1|4050870_4051320_-	flavodoxin	NA	NA	NA	NA	NA
AKK40175.1|4051337_4052120_-|tRNA	tRNA pseudouridine(65) synthase TruC	tRNA	NA	NA	NA	NA
AKK40176.1|4052119_4052449_-	YqcC family protein	NA	NA	NA	NA	NA
AKK40178.1|4053070_4053616_-	protein Syd	NA	NA	NA	NA	NA
AKK40179.1|4053683_4054532_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	3.6e-41
AKK40180.1|4054643_4056008_+	LOG family protein YgdH	NA	NA	NA	NA	NA
AKK40181.1|4056563_4057853_+	HAAAP family serine/threonine permease	NA	NA	NA	NA	NA
AKK40182.1|4057910_4059278_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AKK40183.2|4059388_4060144_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	8.5e-10
AKK40184.2|4060198_4061347_-	lactaldehyde reductase	NA	NA	NA	NA	NA
AKK40185.1|4061374_4062022_-	L-fuculose-phosphate aldolase	NA	NA	NA	NA	NA
AKK40186.1|4062568_4063885_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
AKK40187.1|4063917_4065693_+	L-fucose isomerase	NA	NA	NA	NA	NA
AKK40188.2|4065801_4067220_+	L-fuculokinase	NA	NA	NA	NA	NA
AKK40189.1|4067221_4067644_+	L-fucose mutarotase	NA	NA	NA	NA	NA
AKK40190.1|4067701_4068433_+	l-fucose operon activator	NA	NA	NA	NA	NA
AKK40191.1|4068476_4069577_-	23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM	NA	NA	NA	NA	NA
AKK40192.1|4069569_4069965_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
AKK40193.1|4069983_4070901_-	glycine cleavage system transcriptional activator	NA	NA	NA	NA	NA
AKK40194.2|4071251_4071479_-	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
AKK40195.1|4071670_4072876_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	1.7e-73
AKK40196.1|4072875_4073319_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
AKK40197.1|4073369_4074176_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	1.7e-16
AKK40199.2|4074602_4075700_-	murein transglycosylase A	NA	NA	NA	NA	NA
AKK40200.2|4076836_4077337_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AKK40201.2|4077395_4078934_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AKK40202.1|4078953_4080291_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AKK40203.1|4080287_4080953_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AXF92081.1|4080965_4082618_+	OmpA family protein	NA	NA	NA	NA	NA
AKK40205.1|4082675_4083167_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
AKK40206.1|4083358_4085995_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.9	2.6e-98
AKK40207.1|4086006_4088487_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	38.8	3.4e-07
AKK40208.1|4088519_4089254_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
AKK40209.1|4089243_4089633_+	hypothetical protein	NA	NA	NA	NA	NA
AKK40210.1|4089738_4090953_+	hypothetical protein	NA	NA	NA	NA	NA
AKK40211.2|4091009_4094336_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
AKK40212.2|4094328_4095939_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AKK40213.2|4095944_4097351_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
AKK40214.1|4097979_4099740_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AKK40215.1|4099703_4100783_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AKK40216.1|4100763_4101300_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AKK40217.1|4101303_4101732_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AKK40218.1|4101731_4103108_+	type VI secretion system protein VasL	NA	NA	NA	NA	NA
AKK41790.1|4103406_4104354_-	phosphoglycerate dehydrogenase	NA	M1I1Q8	Acanthocystis_turfacea_Chlorella_virus	27.3	1.4e-14
AXF92082.1|4104424_4105021_-	SIS domain-containing protein	NA	A0A2P0VNK5	Tetraselmis_virus	33.5	2.4e-23
AKK40219.1|4105023_4106199_-	putative C-S lyase	NA	NA	NA	NA	NA
AKK40220.1|4106198_4107779_-	PTS glucose transporter subunit IIBC	NA	A0A2I7SAJ6	Vibrio_phage	35.7	2.0e-05
AKK40221.1|4107810_4108476_-	PRD domain-containing protein	NA	NA	NA	NA	NA
AKK40222.1|4108548_4109757_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
>prophage 12
CP006834	Escherichia coli APEC O2-211 chromosome, complete genome	5114241	4332708	4341634	5114241	transposase	Stx2-converting_phage(66.67%)	6	NA	NA
AKK40415.2|4332708_4336206_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	34.9	7.0e-99
AKK40418.1|4338418_4338844_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
AKK40419.1|4338840_4339191_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	1.2e-40
AKK40420.1|4339221_4340814_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.4	1.9e-181
AKK40421.1|4340909_4341257_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	4.8e-61
AKK40422.2|4341253_4341634_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
>prophage 13
CP006834	Escherichia coli APEC O2-211 chromosome, complete genome	5114241	4837166	4873260	5114241	head,plate,tail,portal,lysis,terminase,holin,integrase,capsid	Escherichia_phage(35.0%)	44	4837009:4837055	4870472:4870518
4837009:4837055	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
AKK40857.1|4837166_4837421_-	DNA-binding transcriptional regulator	NA	M1SNR2	Escherichia_phage	100.0	1.3e-44
AKK40858.1|4837466_4838630_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.0	2.0e-204
AKK40859.1|4838629_4839109_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	3.3e-84
AKK40860.1|4839123_4841571_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	95.3	0.0e+00
AKK40861.2|4841563_4841683_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AKK40862.1|4841715_4841991_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
AKK40863.1|4842047_4842566_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	3.2e-93
AKK40864.1|4842578_4843769_-|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.8e-224
AKK40865.1|4844027_4845371_-	hypothetical protein	NA	NA	NA	NA	NA
AKK40866.1|4845652_4846180_-|tail	tail assembly chaperone	tail	U5N0T1	Enterobacteria_phage	93.7	6.4e-89
AKK40867.1|4846183_4848433_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	55.7	2.1e-136
AKK40868.1|4848443_4848974_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
AKK40869.1|4848966_4849875_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.3	3.4e-162
AKK40870.1|4849879_4850227_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
AKK40871.1|4850223_4850859_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.9e-112
AKK40872.1|4850942_4851728_+	hypothetical protein	NA	NA	NA	NA	NA
AKK40873.1|4851799_4852252_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	2.4e-76
AKK40874.1|4852244_4852712_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	100.0	3.0e-82
AKK40875.2|4852674_4852848_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
AKK40876.1|4852819_4853245_-|lysis	LysB family phage lysis regulatory protein	lysis	Q7Y4E2	Escherichia_virus	96.5	1.6e-66
AKK40877.1|4853232_4853658_-	protein lysA	NA	U5N096	Enterobacteria_phage	96.5	7.2e-59
AKK40878.1|4853672_4854170_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.2e-92
AKK40879.1|4854169_4854451_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
AKK40880.1|4854454_4854658_-|tail	phage tail protein	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
AKK40881.2|4854657_4855167_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
AKK40882.1|4855266_4856010_-|terminase	terminase	terminase	Q94MH3	Enterobacteria_phage	99.2	1.4e-121
AKK40883.1|4856013_4857087_-|capsid	phage major capsid protein, P2 family	capsid	Q83VT1	Escherichia_phage	99.7	1.9e-201
AKK40884.1|4857145_4858000_-|capsid	capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
AKK40885.1|4858173_4859946_+	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
AKK40886.1|4859945_4860980_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.1	1.2e-200
AKK40887.1|4861411_4863370_+	ATP-binding protein	NA	NA	NA	NA	NA
AKK40888.2|4863410_4864460_-	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	56.2	7.4e-105
AKK40889.1|4864571_4866842_-	replication endonuclease	NA	Q858T4	Yersinia_virus	97.2	0.0e+00
AKK40890.1|4866831_4867107_-	hypothetical protein	NA	S4TP00	Salmonella_phage	98.9	8.6e-45
AKK40891.1|4867103_4867328_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
AKK40892.1|4867330_4867630_-	hypothetical protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
AKK40893.2|4867629_4867854_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
AKK40894.1|4867917_4868418_-	replication protein B	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
AKK40896.1|4868587_4868860_-	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
AKK40897.1|4869012_4869306_+	helix-turn-helix domain-containing protein	NA	Q1JS45	Enterobacteria_phage	100.0	1.0e-48
AKK40898.1|4869375_4870356_+|integrase	integrase	integrase	U5N0A8	Enterobacteria_phage	100.0	4.7e-186
AKK40899.2|4870541_4871042_-	periplasmic protein CpxP	NA	NA	NA	NA	NA
4870472:4870518	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
AKK40900.1|4871191_4871890_+	DNA-binding transcriptional regulator CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
AKK40901.1|4871886_4873260_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
>prophage 1
CP030791	Escherichia coli strain APEC O2-211 plasmid pAPEC-O2-211A-ColV, complete sequence	197773	5197	69012	197773	transposase,protease,bacteriocin	Shigella_phage(11.76%)	46	NA	NA
AXF92226.1|5197_6151_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
AXF92227.1|6254_6644_+	GlcNAc transferase	NA	NA	NA	NA	NA
AXF92228.1|7422_7839_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	33.6	3.3e-16
AXF92229.1|9553_10741_+	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	55.7	6.0e-10
AXF92230.1|10737_12678_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	39.0	1.8e-35
AXF92231.1|12681_14052_+	TolC family protein	NA	NA	NA	NA	NA
AXF92382.1|16447_17224_+	hypothetical protein	NA	NA	NA	NA	NA
AXF92232.1|17225_19490_+	DNA helicase UvrD	NA	NA	NA	NA	NA
AXF92233.1|21831_22203_-	hypothetical protein	NA	NA	NA	NA	NA
AXF92234.1|22245_22713_-	hypothetical protein	NA	NA	NA	NA	NA
AXF92235.1|22712_22982_-	hypothetical protein	NA	NA	NA	NA	NA
AXF92236.1|25245_26439_-	cobalamin biosynthesis protein CobW	NA	NA	NA	NA	NA
AXF92237.1|26893_28122_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	97.0	3.7e-172
AXF92238.1|28828_29122_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
AXF92239.1|29636_29819_-	hypothetical protein	NA	NA	NA	NA	NA
AXF92383.1|31804_32068_+	hypothetical protein	NA	NA	NA	NA	NA
AXF92240.1|32266_33382_+	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
AXF92241.1|33395_37181_+	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	30.0	1.3e-45
AXF92242.1|37284_38514_+	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
AXF92243.1|38598_39555_+	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
AXF92244.1|39599_41777_-	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	31.8	9.6e-06
AXF92245.1|42064_42292_+	hypothetical protein	NA	NA	NA	NA	NA
AXF92246.1|42515_42701_-	phospho-2-dehydro-3-deoxyheptonate aldolase	NA	NA	NA	NA	NA
AXF92247.1|42621_43656_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	42.6	1.1e-73
AXF92248.1|43673_43865_-	hypothetical protein	NA	NA	NA	NA	NA
AXF92249.1|44215_44524_-	hypothetical protein	NA	NA	NA	NA	NA
AXF92250.1|44622_44805_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AXF92251.1|44801_44999_-	toxin-antitoxin system protein	NA	NA	NA	NA	NA
AXF92384.1|45713_46955_+	colicin V secretion protein CvaA	NA	NA	NA	NA	NA
AXF92252.1|46929_49044_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.5	3.6e-34
AXF92253.1|49213_49525_-	colicin V	NA	NA	NA	NA	NA
AXF92254.1|49620_49827_+	hypothetical protein	NA	NA	NA	NA	NA
AXF92255.1|50678_50948_+	hypothetical protein	NA	NA	NA	NA	NA
AXF92256.1|50944_51925_+	FAD-binding protein	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	41.5	3.3e-06
AXF92385.1|52000_52381_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
AXF92257.1|52377_52725_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AXF92258.1|59673_60042_+|transposase	transposase	transposase	Q716C1	Shigella_phage	98.9	1.9e-39
AXF92259.1|59998_61150_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	3.4e-42
AXF92260.1|61271_61637_+|transposase	transposase	transposase	NA	NA	NA	NA
AXF92261.1|62103_63114_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	1.1e-20
AXF92262.1|63691_64282_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.3	6.2e-24
AXF92263.1|64636_65635_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AXF92264.1|65634_66672_+	iron ABC transporter permease	NA	NA	NA	NA	NA
AXF92265.1|66671_67433_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.2	8.8e-15
AXF92266.1|67444_68677_+	MFS transporter	NA	NA	NA	NA	NA
AXF92267.1|68754_69012_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
